#7 Restriction Enzyme plot disappears

open
nobody
Spin (1)
1
2004-05-24
2004-03-11
No

I tried to plot a restriction map of HindIII on the following sequence
in Spin (Staden 1.4 release):

ggctgtcctcaaaagtctgcatcactgggtcaggtcttgacttctctctcatctctcttcctgtctttca
accctctctcctccctgcaaccctcagGGTACAGCCTGTTCCTCGTGGCAGCCCACG
AGTTTGGCCACGCCATGGGGCTGGAGCACTCCCAAGACCCTGGGGCCC
TGATGGCACCCATTTACACCTACACCAAGAACTTCCGTCTGTCCCAGGAT
GACATCAAGGGCATTCAGGAGCTCTATGgtaaacctccgggcgggggttgggggt
ggagggtgaggaggggggaggtcatgtagcctgggatggaggcccagggggtgggaccagca
agatctcatccagccaggagtg

The plot appears for a fraction of a second and then the window
disappears. The Spin main window just says "restriction enzyme
plot", no error message or anything else.

Is this a bug?

Discussion

  • James Bonfield

    James Bonfield - 2004-05-11

    Logged In: YES
    user_id=154581

    Currently there is no maintainer for Spin, so bugs are likely to
    go unfixed. I know this is not ideal, but I only have sufficient
    time to keep gap4 and trev up to date (ie the programs used by my
    employers).

    Naturally I am willing to accept external patches and fixes for
    Spin, and I will keep it compiled and distributed for the various
    architectures we build for.

    Sorry I cannot, currently, be of more assistance here.

    James Bonfield

     
  • James Bonfield

    James Bonfield - 2004-05-24
    • priority: 5 --> 1
     
  • James Bonfield

    James Bonfield - 2004-05-24

    Logged In: YES
    user_id=154581

    I decided to quickly check this out anyway, despite my
    previous comment, as Gap4 has the restriction enzyme plot in
    it too. In gap4 this works fine, but in spin I see the issue
    you do.

    The cause is that there are no results. Spin should display
    a blank plot, but instead chooses to remove the plot again.
    The plot does work correct for enzymes that match, so for
    now take the lack of a plot as an indicator that the enzyme
    does not match. Hence I'm reducing the severity on this one
    accordingly.

    James

     

Log in to post a comment.

Get latest updates about Open Source Projects, Conferences and News.

Sign up for the SourceForge newsletter:

JavaScript is required for this form.





No, thanks