Recent changes to special_use_cases

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 16 Oct 2017 13:09:50 -0000

--- v12
+++ v13
@@ -26,6 +26,13 @@
 >gypsy_LTR
 AAAAA
 ~~~~~~
+
+and the following pgd-file may be used
+
+~~~~~
+gypsy=$1
+gypsy_LTR=$2
+~~~~~

 ### define the solo LTR in the header of the pgd file

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 13:48:10 -0000

--- v11
+++ v12
@@ -110,10 +110,10 @@

 ### diverged sequences of a given family

-For example INE-1 is a highly diverged TE family in *Drosophila melanogaster* where individual insertions frequently have more than 10% divergence. https://genomebiology.biomedcentral.com/articles/10.1186/gb-2008-9-2-r39 
+For example Ine-1 is a highly diverged TE family of *Drosophila melanogaster* where individual insertions are frequently diverged by more than 10%  https://genomebiology.biomedcentral.com/articles/10.1186/gb-2008-9-2-r39 

-We recommend to define diverged sequences in the pgd-file like in the following example
+We recommend to define sequences of diverged family members in the pgd-file, as shown in the following example

 ~~~~~
 ine1=$1

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 13:31:14 -0000

--- v10
+++ v11
@@ -108,7 +108,7 @@

 This will generate the gypsy2 family having 10% base substitutions compared to the gypsy family. For more complex patterns of divergence (e.g. involving many indels) we recommend to provide a separate entry for the family in the TE sequence file (e.g. see solo LTR section above).

-### specify diverged insertion sequences of a given family
+### diverged sequences of a given family

 For example INE-1 is a highly diverged TE family in *Drosophila melanogaster* where individual insertions frequently have more than 10% divergence. https://genomebiology.biomedcentral.com/articles/10.1186/gb-2008-9-2-r39

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 13:30:39 -0000

--- v9
+++ v10
@@ -121,7 +121,7 @@
 6 ine1+5% * * * ine1+5% *
 9 * * * * * ine1+5%
 ~~~~~
-**Note** that in this example five different sequences of ine1 have been generated, each having 5% base substitutions from the original ine1. Hence randomly picked pairs of ine1 will have a total divergence of 10% (5% from each insertions).
+**Note** that in this example five different sequences of ine1 have been generated, each having 5% base substitutions from the original ine1. Hence randomly picked pairs of ine1 (irrespective of the insertion position) will have a total divergence of 10% (5% from each insertions).

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 13:29:56 -0000

--- v8
+++ v9
@@ -4,6 +4,7 @@

 # Special use cases
 ## solo-LTRs
+
 For many LTR families, solo LTR insertions have been observed. 
 There are two ways to simulate solo-LTRs

@@ -36,7 +37,7 @@
 AAAAATCTCTCGGTCAAAAA
 ~~~~~~

-we may provide the following header:
+we may provide the following header of the pgd-file:

 ~~~~~
 gypsy=$1
@@ -58,7 +59,7 @@
 AAAAATTTTTCCCCCGGGGG
 ~~~~~

-the following header of a pgd-file may be used to generate multiple 5' truncated copies of the I-element
+we may provide the following header of the pgd-file to generate multiple 5' truncated copies of the I-element

 ~~~~~~
 ielement=$1
@@ -80,22 +81,22 @@
 AACCTTGGGGTTCCAA
 ~~~~~

-the following header of a pgd-file may be used to generate multiple internally truncated copies of the P-element
+we may provide the following header of the pgd-file to generate multiple internally truncated copies of the P-element

 ~~~~~~
 pelement=$1
 deletion1=pelement[7..10]     # yields deletion1="AACCTTTTCCAA"
-deletion2=pelement[5..12]     # yields deletion1="AACCCCAA"
-deletion3=pelement[3..14]     # yields deletion1="AAAA"
+deletion2=pelement[5..12]     # yields deletion2="AACCCCAA"
+deletion3=pelement[3..14]     # yields deletion3="AAAA"
 ~~~~~~

 ## diverged/evolved TE families

-Here two different cases may be distinguished
+We may distinguish multiple different cases

-### specify a novel diverged (sub)family
+### a diverged family

-For example gypsy2 may be assumed to be a diverged (sub)family of gypsy. 
+Lets assume that gypsy2 is a novel family that diverged from the gypsy family. 
 We recommend to define the diverged gypsy2 family in the header of the pgd-file.

 For example:
@@ -105,9 +106,22 @@
 gypsy2=gypsy+10%
 ~~~~~~

-This will generate the gypsy2 family having 10% base substitutions compared to the gypsy family. For more complexly diverged families (e.g. involving many indels) we recommend to provide a separate entry for the family in the TE sequence file (e.g. see solo LTR section above).
+This will generate the gypsy2 family having 10% base substitutions compared to the gypsy family. For more complex patterns of divergence (e.g. involving many indels) we recommend to provide a separate entry for the family in the TE sequence file (e.g. see solo LTR section above).

 ### specify diverged insertion sequences of a given family
+
+For example INE-1 is a highly diverged TE family in *Drosophila melanogaster* where individual insertions frequently have more than 10% divergence. https://genomebiology.biomedcentral.com/articles/10.1186/gb-2008-9-2-r39 
+
+
+We recommend to define diverged sequences in the pgd-file like in the following example
+
+~~~~~
+ine1=$1
+2 ine1+5% ine1+5% * * * *
+6 ine1+5% * * * ine1+5% *
+9 * * * * * ine1+5%
+~~~~~
+**Note** that in this example five different sequences of ine1 have been generated, each having 5% base substitutions from the original ine1. Hence randomly picked pairs of ine1 will have a total divergence of 10% (5% from each insertions).

@@ -121,3 +135,4 @@

+

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 13:14:05 -0000

--- v7
+++ v8
@@ -1,6 +1,6 @@
 [TOC]
 # Introduction 
-This is an advance section. Please make sure that you understand the content of [describing_TE_landscapes] and [describing_TE_sequences] before proceeding to this section. Here we describe how to simulate special use cases that are frequently encountered in genomes such as 5' truncated non-LTRs or solo LTR insertions.
+This is an advanced section. Please make sure that you understand the content of [describing_TE_landscapes] and [describing_TE_sequences] before proceeding to this section. Here we describe how to simulate special use cases that are frequently encountered in genomes such as 5' truncated non-LTRs or solo LTR insertions.

 # Special use cases
 ## solo-LTRs

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 13:11:11 -0000

--- v6
+++ v7
@@ -1,6 +1,8 @@
+[TOC]
 # Introduction 
-This section provides an overview of how to generate some special use cases with SimulaTE such as solo-LTRs, 5' truncated non-LTRs, internal truncated TIRs and diverged/evolved sequences. This section contains rather advanced conted, we recommend to first study the previous two sections: [describing_TE_landscapes] and [describing_TE_sequences].
+This is an advance section. Please make sure that you understand the content of [describing_TE_landscapes] and [describing_TE_sequences] before proceeding to this section. Here we describe how to simulate special use cases that are frequently encountered in genomes such as 5' truncated non-LTRs or solo LTR insertions.

+# Special use cases
 ## solo-LTRs
 For many LTR families, solo LTR insertions have been observed. 
 There are two ways to simulate solo-LTRs

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 13:03:06 -0000

--- v5
+++ v6
@@ -49,14 +49,14 @@
 Many non-LTRs insertions have 5' truncated sequences. 
 We recommend to define different 5' truncated TE in the header of the pgd file.

-For example given the TE sequence file:
+For example given the following TE-sequence file

-~~~~~~
+~~~~~
 >I-element
 AAAAATTTTTCCCCCGGGGG
-~~~~~~
+~~~~~

-you may, for example, provide the following header to generate different 5' truncated copies
+the following header of a pgd-file may be used to generate multiple 5' truncated copies of the I-element

 ~~~~~~
 ielement=$1
@@ -67,6 +67,25 @@

 This code generates three 5' truncated I-element insertions *trunc1*, *trunc2*, *trunc3*.

+## internally truncated TIRs
+
+Many TIR insertions are internally truncated (e.g the KP-element is an internally truncated P-element)
+
+For example given the following TE-sequence file
+
+~~~~~
+>P-element
+AACCTTGGGGTTCCAA
+~~~~~
+
+the following header of a pgd-file may be used to generate multiple internally truncated copies of the P-element
+
+~~~~~~
+pelement=$1
+deletion1=pelement[7..10]     # yields deletion1="AACCTTTTCCAA"
+deletion2=pelement[5..12]     # yields deletion1="AACCCCAA"
+deletion3=pelement[3..14]     # yields deletion1="AAAA"
+~~~~~~

 ## diverged/evolved TE families

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 12:39:33 -0000

--- v4
+++ v5
@@ -41,7 +41,7 @@
 gypsy_LTR=gypsy[6..$]    # yields gypsy_LTR="AAAAA"
 ~~~~~

-The DSL code *gypys[6..$]* simply removes the sequences starting at base 6 (i.e. *TCTCTCGGTCAAAAA* will be removed).
+The DSL code *gypys\[6..$\]* simply removes the sequences starting at base 6 (i.e. *TCTCTCGGTCAAAAA* will be removed).

 ## 5' truncated non-LTRs
@@ -68,6 +68,25 @@
 This code generates three 5' truncated I-element insertions *trunc1*, *trunc2*, *trunc3*.

+## diverged/evolved TE families
+
+Here two different cases may be distinguished
+
+### specify a novel diverged (sub)family
+
+For example gypsy2 may be assumed to be a diverged (sub)family of gypsy. 
+We recommend to define the diverged gypsy2 family in the header of the pgd-file.
+
+For example:
+
+~~~~~~
+gypsy=$1  
+gypsy2=gypsy+10%
+~~~~~~
+
+This will generate the gypsy2 family having 10% base substitutions compared to the gypsy family. For more complexly diverged families (e.g. involving many indels) we recommend to provide a separate entry for the family in the TE sequence file (e.g. see solo LTR section above).
+
+### specify diverged insertion sequences of a given family

@@ -75,3 +94,9 @@

+
+
+
+
+
+

special_use_cases modified by Robert Kofler

Robert Kofler — Mon, 09 Oct 2017 12:30:28 -0000

--- v3
+++ v4
@@ -7,7 +7,7 @@

 ### provide the solo LTR as additional entry in the TE sequence file

-The solo LTR may be provided as an additional entry in the file with the TE sequences.
+The solo LTR may be provided as an additional entry in the TE sequence file.
 For example assuming the TE sequence file:

 ~~~~~~
@@ -45,8 +45,8 @@

 ## 5' truncated non-LTRs
+
 Many non-LTRs insertions have 5' truncated sequences. 
-
 We recommend to define different 5' truncated TE in the header of the pgd file.

 For example given the TE sequence file:
@@ -56,7 +56,7 @@
 AAAAATTTTTCCCCCGGGGG
 ~~~~~~

-you may provide the following header to generate different 5' truncated copies
+you may, for example, provide the following header to generate different 5' truncated copies

 ~~~~~~
 ielement=$1
@@ -64,6 +64,8 @@
 trunc2=ielement[^..10]   # yields trunc2="CCCCCGGGGG"
 trunc3=ielement[^..15]   # yields trunc3="GGGGG"
 ~~~~~~
+
+This code generates three 5' truncated I-element insertions *trunc1*, *trunc2*, *trunc3*.