samtools-help — bug report, feature request, troubleshooting and anything else

[Samtools-help] help with filterSamReads picard tools

[navin r. <rus...@ya...>]

Hi, 

I needed to know if the filterSamreads in picard tools required to store the whole bam file in memory to filter out the reads.

if yes is there a way to ask it to take less memory?

Regards, 
Navin 

Re: [Samtools-help] picard or samtools api to generate MD tag

[Alec W. <al...@br...>]

Hi Yaping,

Picard does not compute MD tag.  

-Alec

On Sep 16, 2013, at 11:48 PM, Yaping Liu <lyp...@gm...> wrote:

> Hi All,
> Does anyone know how to use samtools/picard java API to generate MD tag in sam files? I know in command line of samtools, there is an option:
> samtools calmd or samtools fillmd [-eubrS] <aln.bam> <ref.fasta>
> 
> But I would like to calculate MD inside my java program…
> 
> Thanks very much!!
> 
> Yaping
> 
> ---
> Yaping Liu
> 
> PhD candidate 
> 	in
> USC Epigenome Center
> 
> University of Southern California
> 
> lyp...@gm...
> 
> 
> 
> 
> 
> ------------------------------------------------------------------------------
> LIMITED TIME SALE - Full Year of Microsoft Training For Just $49.99!
> 1,500+ hours of tutorials including VisualStudio 2012, Windows 8, SharePoint
> 2013, SQL 2012, MVC 4, more. BEST VALUE: New Multi-Library Power Pack includes
> Mobile, Cloud, Java, and UX Design. Lowest price ever! Ends 9/20/13. 
> http://pubads.g.doubleclick.net/gampad/clk?id=58041151&iu=/4140/ostg.clktrk_______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help

Re: [Samtools-help] consensus sequences

[<mao...@gm...>]

Hi Colin,
Many thanks for your suggestions in this case. Now i used Bioperl (SimpleAlign) to generate the consensus sequences without IUPAC based on the gene alignments. 

Best wishes,

Mao

From: Colin Hercus 
Sent: Tuesday, September 17, 2013 4:28 AM
To: mao...@gm... 
Cc: samtools 
Subject: Re: [Samtools-help] consensus sequences

Hi Xiuguang, 


Read mappers vary in their handling of IUPAC ambiguous codes, many do not handle them as IUPAC codes but rather substitute a non-ambiguous nucleotide code in their place when building the index structure. This can result in a mismatch when aligning a read that might otherwise have matched the ambiguous code. I don't have details on all the mappers but I do know that novoalign understands the IUPAC codes and maps reads appropriately.


Kind Regards,
Colin

Colin Hercus,
Novocraft Technologies Sdn Bhd
C-23A-05, 3 Two Square, Jalan 19/1, Section 19, 
46300 Petaling Jaya, Selangor Darul Ehsan, Malaysia
Tel: +6016 2482 668   Fax: +603 7960 0540
www.novocraft.com 






On 15 September 2013 00:04, <mao...@gm...> wrote:

  Hi all,
  when we perform SNPs calling, if the reference sequence is the consensus sequence which may contain  IUPAC nucleotide ambiguity codes (MRW...), does it affect the following reads mapping and SNPs calling?  Does not anybody have any suggestions in this case?

  Thanks in advance.


  Best wishes,

  Xiuguang Mao

  ------------------------------------------------------------------------------
  LIMITED TIME SALE - Full Year of Microsoft Training For Just $49.99!
  1,500+ hours of tutorials including VisualStudio 2012, Windows 8, SharePoint
  2013, SQL 2012, MVC 4, more. BEST VALUE: New Multi-Library Power Pack includes
  Mobile, Cloud, Java, and UX Design. Lowest price ever! Ends 9/22/13.
  http://pubads.g.doubleclick.net/gampad/clk?id=64545871&iu=/4140/ostg.clktrk
  _______________________________________________
  Samtools-help mailing list
  Sam...@li...
  https://lists.sourceforge.net/lists/listinfo/samtools-help

[Samtools-help] picard or samtools api to generate MD tag

[Yaping L. <lyp...@gm...>]

Hi All,
Does anyone know how to use samtools/picard java API to generate MD tag in sam files? I know in command line of samtools, there is an option:
samtools calmd or samtools fillmd [-eubrS] <aln.bam> <ref.fasta>

But I would like to calculate MD inside my java program…

Thanks very much!!

Yaping

---
Yaping Liu

PhD candidate 
	in
USC Epigenome Center

University of Southern California

lyp...@gm...

Re: [Samtools-help] consensus sequences

[Colin H. <co...@no...>]

Hi Xiuguang,

Read mappers vary in their handling of IUPAC ambiguous codes, many do not
handle them as IUPAC codes but rather substitute a non-ambiguous nucleotide
code in their place when building the index structure. This can result in a
mismatch when aligning a read that might otherwise have matched the
ambiguous code. I don't have details on all the mappers but I do know that
novoalign understands the IUPAC codes and maps reads appropriately.

Kind Regards,
Colin

Colin Hercus,
*Novocraft Technologies Sdn Bhd* <http://www.novocraft.com/>
C-23A-05, 3 Two Square, Jalan 19/1, Section 19,
46300 Petaling Jaya, Selangor Darul Ehsan, Malaysia
Tel: +6016 2482 668   Fax: +603 7960 0540
www.novocraft.com




On 15 September 2013 00:04, <mao...@gm...> wrote:

>   Hi all,
> when we perform SNPs calling, if the reference sequence is the consensus
> sequence which may contain  IUPAC nucleotide ambiguity codes<http://www.chick.manchester.ac.uk/SiteSeer/IUPAC_codes.html>(MRW...), does it affect the following reads mapping and SNPs calling?
> Does not anybody have any suggestions in this case?
>
> Thanks in advance.
>
>
> Best wishes,
>
> Xiuguang Mao
>
>
> ------------------------------------------------------------------------------
> LIMITED TIME SALE - Full Year of Microsoft Training For Just $49.99!
> 1,500+ hours of tutorials including VisualStudio 2012, Windows 8,
> SharePoint
> 2013, SQL 2012, MVC 4, more. BEST VALUE: New Multi-Library Power Pack
> includes
> Mobile, Cloud, Java, and UX Design. Lowest price ever! Ends 9/22/13.
> http://pubads.g.doubleclick.net/gampad/clk?id=64545871&iu=/4140/ostg.clktrk
> _______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help
>
>

[Samtools-help] 回复： 回复： Questions about SAMtools

[崔. <xia...@fo...>]

Hi, all,


Thank you for your kind help, and my problem has been solved. 


Best,


Xiaolong




------------------ 原始邮件 ------------------
发件人: "Colin Hercus";<co...@no...>;
发送时间: 2013年9月13日(星期五) 中午11:30
收件人: "崔晓龙"<xia...@fo...>; 
抄送: "samtools-help"<sam...@li...>; 
主题: Re: [Samtools-help] 回复： Questions about SAMtools



Hi Xiaolong,
This line is missing the readname  from the start of the line. Check it against the previous line, each SAM record should start with a readname followed by tab then the flag attribute.
 

Kind Regards, Colin






On 13 September 2013 11:03, 崔晓龙 <xia...@fo...> wrote:
 The line is something like this (not exactly the line 49709458 but a line from another .sam file with same problem):
 89      chr18   78021091        50      90M     *       0       0       AACAAACTTCTTGGCTGGGTTTGAACCTTAAAGCCCTGCCACTGTCACCAGACACTGCTTTGGTTTTGTCATTTATTGTGGTAAAATCAG    ?9@A;->;56A9A?.1DC:HHE@E@IEIGJIGGFJJIFIJIJIEGDFGBIHFIJJJJJIJJIJIJIJIFJJGJJGIGGFHHFFFFFFCC@    AS:i:-23        XM:i:4  XO:i:0  XG:i:0  MD:Z:27A10T13T24C12     NM:i:4  NH:i:1
 <EF2...@14...>
Thanks!


Xiaolong
 




------------------ 原始邮件 ------------------
 发件人: "Heng Li";<lh...@sa...>;
发送时间: 2013年9月12日(星期四) 晚上10:46
收件人: "崔晓龙"<xia...@fo...>; 
 抄送: "samtools-help"<sam...@li...>; 
主题: Re: [Samtools-help] Questions about SAMtools
 


What does the line 49709458 look like?

Heng

On Sep 11, 2013, at 9:56 AM, 崔晓龙 <xia...@fo...> wrote:
 
Hi, all,
 
 I'm writting for your help. Now I encounter a question about SAMtools when I tried to convert .sam file into .bam file:
  
 $ samtools view -h accepted_hits.bam > zz.sam
  $ samtools view -bS zz.sam > zz.bam 
 [samopen] SAM header is present: 22 sequences.
  [sam_read1] reference '11004978' is recognized as '*'.
  Parse warning at line 49709458: mapped sequence without CIGAR
 Parse error at line 49709458: sequence and quality are inconsistent
  Aborted
 
 The accepted_hits.bam is generated from TopHat for RNA-seq reads. That is really confusing and I have searched SEQanswers but didn't find any answers. So, I'm looking forward to your reply. Thanks in advance!
 
Best wishes,
  
Xiaolong
 ------------------------------------------------------------------------------
How ServiceNow helps IT people transform IT departments:
1. Consolidate legacy IT systems to a single system of record for IT
2. Standardize and globalize service processes across IT
 3. Implement zero-touch automation to replace manual, redundant tasks
http://pubads.g.doubleclick.net/gampad/clk?id=51271111&iu=/4140/ostg.clktrk_______________________________________________
 Samtools-help mailing list
Sam...@li...
https://lists.sourceforge.net/lists/listinfo/samtools-help
 


 
= --   The Wellcome Trust Sanger Institute is operated by Genome Rese= arch   Limited, a charity registered in England with number 1021457 and a =  company registered in England with number 2742969, whose registered   = office is 215 Euston Road, London, NW1 2BE.  
=

------------------------------------------------------------------------------
 How ServiceNow helps IT people transform IT departments:
 1. Consolidate legacy IT systems to a single system of record for IT
 2. Standardize and globalize service processes across IT
 3. Implement zero-touch automation to replace manual, redundant tasks
 http://pubads.g.doubleclick.net/gampad/clk?id=51271111&iu=/4140/ostg.clktrk
_______________________________________________
 Samtools-help mailing list
 Sam...@li...
 https://lists.sourceforge.net/lists/listinfo/samtools-help

[Samtools-help] consensus sequences

[<mao...@gm...>]

Hi all,
when we perform SNPs calling, if the reference sequence is the consensus sequence which may contain  IUPAC nucleotide ambiguity codes (MRW...), does it affect the following reads mapping and SNPs calling?  Does not anybody have any suggestions in this case?

Thanks in advance.


Best wishes,

Xiuguang Mao

Re: [Samtools-help] 回复： Questions about SAMtools

[Colin H. <co...@no...>]

Hi Xiaolong,

This line is missing the readname  from the start of the line. Check it
against the previous line, each SAM record should start with a readname
followed by tab then the flag attribute.

Kind Regards, Colin


On 13 September 2013 11:03, 崔晓龙 <xia...@fo...> wrote:

> The line is something like this (not exactly the line 49709458 but a line
> from another .sam file with same problem):
> 89      chr18   78021091        50      90M     *       0       0
> AACAAACTTCTTGGCTGGGTTTGAACCTTAAAGCCCTGCCACTGTCACCAGACACTGCTTTGGTTTTGTCATTTATTGTGGTAAAATCAG
>    ?9@A;->;56A9A?.1DC:HHE@E
> @IEIGJIGGFJJIFIJIJIEGDFGBIHFIJJJJJIJJIJIJIJIFJJGJJGIGGFHHFFFFFFCC@
>  AS:i:-23        XM:i:4  XO:i:0  XG:i:0  MD:Z:27A10T13T24C12     NM:i:4
>  NH:i:1
> <EF2996C4@14D**82B7B.3C7132**52.jpg <EF2...@14...>>
> Thanks!
>
> Xiaolong
>
>
>
> ------------------ 原始邮件 ------------------
> *发件人:* "Heng Li";<lh...@sa...>;
> *发送时间:* 2013年9月12日(星期四) 晚上10:46
> *收件人:* "崔晓龙"<xia...@fo...>; **
> *抄送:* "samtools-help"<sam...@li...>; **
> *主题:* Re: [Samtools-help] Questions about SAMtools
>
> What does the line 49709458 look like?
>
> Heng
>
> On Sep 11, 2013, at 9:56 AM, 崔晓龙 <xia...@fo...> wrote:
>
> Hi, all,
>
> I'm writting for your help. Now I encounter a question about SAMtools when
> I tried to convert .sam file into .bam file:
>
>  $ samtools view -h accepted_hits.bam > zz.sam
>  $ samtools view -bS zz.sam > zz.bam
>  [samopen] SAM header is present: 22 sequences.
>  [sam_read1] reference '11004978' is recognized as '*'.
>  Parse warning at line 49709458: mapped sequence without CIGAR
>  Parse error at line 49709458: sequence and quality are inconsistent
>  Aborted
>
> The accepted_hits.bam is generated from TopHat for RNA-seq reads. That is
> really confusing and I have searched SEQanswers but didn't find any
> answers. So, I'm looking forward to your reply. Thanks in advance!
>
> Best wishes,
>
> Xiaolong
>
> ------------------------------------------------------------------------------
> How ServiceNow helps IT people transform IT departments:
> 1. Consolidate legacy IT systems to a single system of record for IT
> 2. Standardize and globalize service processes across IT
> 3. Implement zero-touch automation to replace manual, redundant tasks
>
> http://pubads.g.doubleclick.net/gampad/clk?id=51271111&iu=/4140/ostg.clktrk_______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help
>
>
>
> = -- The Wellcome Trust Sanger Institute is operated by Genome Rese= arch
> Limited, a charity registered in England with number 1021457 and a =
> company registered in England with number 2742969, whose registered =
> office is 215 Euston Road, London, NW1 2BE.
> =
>
>
> ------------------------------------------------------------------------------
> How ServiceNow helps IT people transform IT departments:
> 1. Consolidate legacy IT systems to a single system of record for IT
> 2. Standardize and globalize service processes across IT
> 3. Implement zero-touch automation to replace manual, redundant tasks
> http://pubads.g.doubleclick.net/gampad/clk?id=51271111&iu=/4140/ostg.clktrk
> _______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help
>
>

[Samtools-help] 回复： Questions about SAMtools

[崔. <xia...@fo...>]

The line is something like this (not exactly the line 49709458 but a line from another .sam file with same problem):
89      chr18   78021091        50      90M     *       0       0       AACAAACTTCTTGGCTGGGTTTGAACCTTAAAGCCCTGCCACTGTCACCAGACACTGCTTTGGTTTTGTCATTTATTGTGGTAAAATCAG    ?9@A;->;56A9A?.1DC:HHE@E@IEIGJIGGFJJIFIJIJIEGDFGBIHFIJJJJJIJJIJIJIJIFJJGJJGIGGFHHFFFFFFCC@    AS:i:-23        XM:i:4  XO:i:0  XG:i:0  MD:Z:27A10T13T24C12     NM:i:4  NH:i:1
<EF2...@14...>
Thanks!


Xiaolong





------------------ 原始邮件 ------------------
发件人: "Heng Li";<lh...@sa...>;
发送时间: 2013年9月12日(星期四) 晚上10:46
收件人: "崔晓龙"<xia...@fo...>; 
抄送: "samtools-help"<sam...@li...>; 
主题: Re: [Samtools-help] Questions about SAMtools



What does the line 49709458 look like?

Heng

On Sep 11, 2013, at 9:56 AM, 崔晓龙 <xia...@fo...> wrote:

Hi, all,
 
I'm writting for your help. Now I encounter a question about SAMtools when I tried to convert .sam file into .bam file:
 
 $ samtools view -h accepted_hits.bam > zz.sam
 $ samtools view -bS zz.sam > zz.bam 
 [samopen] SAM header is present: 22 sequences.
 [sam_read1] reference '11004978' is recognized as '*'.
 Parse warning at line 49709458: mapped sequence without CIGAR
 Parse error at line 49709458: sequence and quality are inconsistent
 Aborted
 
The accepted_hits.bam is generated from TopHat for RNA-seq reads. That is really confusing and I have searched SEQanswers but didn't find any answers. So, I'm looking forward to your reply. Thanks in advance!

Best wishes,
 
Xiaolong
------------------------------------------------------------------------------
How ServiceNow helps IT people transform IT departments:
1. Consolidate legacy IT systems to a single system of record for IT
2. Standardize and globalize service processes across IT
3. Implement zero-touch automation to replace manual, redundant tasks
http://pubads.g.doubleclick.net/gampad/clk?id=51271111&iu=/4140/ostg.clktrk_______________________________________________
Samtools-help mailing list
Sam...@li...
https://lists.sourceforge.net/lists/listinfo/samtools-help



 
= --   The Wellcome Trust Sanger Institute is operated by Genome Rese= arch   Limited, a charity registered in England with number 1021457 and a =  company registered in England with number 2742969, whose registered   = office is 215 Euston Road, London, NW1 2BE.  
=

Re: [Samtools-help] Questions about SAMtools

[Heng Li <lh...@sa...>]

What does the line 49709458 look like?

Heng

On Sep 11, 2013, at 9:56 AM, 崔晓龙 <xia...@fo...> wrote:

> Hi, all,
>  
> I'm writting for your help. Now I encounter a question about SAMtools when I tried to convert .sam file into .bam file:
>  
>  $ samtools view -h accepted_hits.bam > zz.sam
>  $ samtools view -bS zz.sam > zz.bam 
>  [samopen] SAM header is present: 22 sequences.
>  [sam_read1] reference '11004978' is recognized as '*'.
>  Parse warning at line 49709458: mapped sequence without CIGAR
>  Parse error at line 49709458: sequence and quality are inconsistent
>  Aborted
>  
> The accepted_hits.bam is generated from TopHat for RNA-seq reads. That is really confusing and I have searched SEQanswers but didn't find any answers. So, I'm looking forward to your reply. Thanks in advance!
> 
> Best wishes,
>  
> Xiaolong
> ------------------------------------------------------------------------------
> How ServiceNow helps IT people transform IT departments:
> 1. Consolidate legacy IT systems to a single system of record for IT
> 2. Standardize and globalize service processes across IT
> 3. Implement zero-touch automation to replace manual, redundant tasks
> http://pubads.g.doubleclick.net/gampad/clk?id=51271111&iu=/4140/ostg.clktrk_______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Rese
arch 
 Limited, a charity registered in England with number 1021457 and a 

 company registered in England with number 2742969, whose registered 
 
office is 215 Euston Road, London, NW1 2BE. 

Re: [Samtools-help] program access optional fields

[Daofeng Li <li...@gm...>]

Thank you very much, Heng.

It helps a lot :)

Best,

Daofeng


On Wed, Sep 11, 2013 at 11:19 AM, Heng Li <lh...@sa...> wrote:

> Samtools APIs are changing. With the current version, you can get the
> pointer to a tag with:
>
> uint8_t *bam_aux_get(const bam1_t *b, const char tag[2]);
>
> The return value includes the typing byte. You can use, for
> example, bam_aux2i() to get an integer value.
>
> Heng
>
> On Sep 11, 2013, at 11:39 AM, Daofeng Li <li...@gm...> wrote:
>
> Dear Samtools list,
>
> I am wondering how could I access the optional fields in SAM/BAM from a C
> code?
> I am thinking I could access alignment from bam1_core_t structure, right?
>
> Thanks for any response in advance.
>
> Daofeng
> ------------------------------------------------------------------------------
> How ServiceNow helps IT people transform IT departments:
> 1. Consolidate legacy IT systems to a single system of record for IT
> 2. Standardize and globalize service processes across IT
> 3. Implement zero-touch automation to replace manual, redundant tasks
>
> http://pubads.g.doubleclick.net/gampad/clk?id=51271111&iu=/4140/ostg.clktrk_______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help
>
>
>
> -- The Wellcome Trust Sanger Institute is operated by Genome Research
> Limited, a charity registered in England with number 1021457 and a company
> registered in England with number 2742969, whose registered office is 215
> Euston Road, London, NW1 2BE.
>

Re: [Samtools-help] program access optional fields

[Heng Li <lh...@sa...>]

Samtools APIs are changing. With the current version, you can get the pointer to a tag with:

uint8_t *bam_aux_get(const bam1_t *b, const char tag[2]);

The return value includes the typing byte. You can use, for example, bam_aux2i() to get an integer value.

Heng

On Sep 11, 2013, at 11:39 AM, Daofeng Li <li...@gm...> wrote:

> Dear Samtools list,
> 
> I am wondering how could I access the optional fields in SAM/BAM from a C code?
> I am thinking I could access alignment from bam1_core_t structure, right?
> 
> Thanks for any response in advance.
> 
> Daofeng
> ------------------------------------------------------------------------------
> How ServiceNow helps IT people transform IT departments:
> 1. Consolidate legacy IT systems to a single system of record for IT
> 2. Standardize and globalize service processes across IT
> 3. Implement zero-touch automation to replace manual, redundant tasks
> http://pubads.g.doubleclick.net/gampad/clk?id=51271111&iu=/4140/ostg.clktrk_______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help




-- 
 The Wellcome Trust Sanger Institute is operated by Genome Rese
arch 
 Limited, a charity registered in England with number 1021457 and a 

 company registered in England with number 2742969, whose registered 
 
office is 215 Euston Road, London, NW1 2BE. 

[Samtools-help] program access optional fields

[Daofeng Li <li...@gm...>]

Dear Samtools list,

I am wondering how could I access the optional fields in SAM/BAM from a C
code?
I am thinking I could access alignment from bam1_core_t structure, right?

Thanks for any response in advance.

Daofeng

[Samtools-help] Questions about SAMtools

[崔. <xia...@fo...>]

Hi, all,
 
I'm writting for your help. Now I encounter a question about SAMtools when I tried to convert .sam file into .bam file:
 
 $ samtools view -h accepted_hits.bam > zz.sam
 $ samtools view -bS zz.sam > zz.bam 
 [samopen] SAM header is present: 22 sequences.
 [sam_read1] reference '11004978' is recognized as '*'.
 Parse warning at line 49709458: mapped sequence without CIGAR
 Parse error at line 49709458: sequence and quality are inconsistent
 Aborted
 
The accepted_hits.bam is generated from TopHat for RNA-seq reads. That is really confusing and I have searched SEQanswers but didn't find any answers. So, I'm looking forward to your reply. Thanks in advance!

Best wishes,
 
Xiaolong

[Samtools-help] Fwd: Top posts this week on Google+

[Alec W. <al...@br...>]

How do I stop Google+ from sending these messages to me?  I clicked on the link at the bottom of the message to change my email prefs, and was brought to a page that is essentially blank.

Thanks, Alec

Begin forwarded message:

> From: "Google+" <nor...@pl...>
> Subject: Top posts this week on Google+
> Date: September 10, 2013 8:28:57 PM EDT
> To: al...@br...
> Reply-To: "Google+" <nor...@pl...>
> 
> 	View What's Hot
> Top posts this week on Google+
> Hot on Google+	View
> 	
> James Liranzo
> Shared publicly
> 
> 
> 2229584250
> Hot on Google+	View
> 	
> Paige Keaton
> Shared publicly
> The view inside of a guitar. #musicmonday  
> 
> 
> 3568593285
> Hot on Google+	View
> 	
> Paulo Lopes
> Shared publicly
> Meanwhile in Africa... lets jump!
> 
> 
> 31712444
> Hot on Google+	View
> 	
> Paul Drinnon
> Shared publicly
> I thought this only happened in cartoons. 
> 
> 
> 664265153
> Hot on Google+	View
> 	
> Philosoraptor
> Shared publicly
> 
> 
> 32521148324
> This notification was sent to al...@br.... Don't want occasional updates about Google+ activity and friend suggestions? Change what email Google+ sends you.
> Google Inc., 1600 Amphitheatre Pkwy, Mountain View, CA 94043 USA

Re: [Samtools-help] Different mismatch counting methodologies in SAMTools and Picard

[Mikkel S. <mik...@gm...>]

Hey Alec,
Thank you for the answer!
I agree with your conclusion, though perhaps the method for counting NM is
something that should be formalised for the BAM/SAM specification, even if
just to say that both of these options (as well as other options?) are
acceptable.

You are correct in assuming that this is not high priority, though I would
of course appreciate seeing that option implemented at some point, as we do
rely on the NM tag at times.

Best regards,
 Mikkel



On Mon, Sep 9, 2013 at 5:31 PM, Alec Wysoker <al...@br...>wrote:

> Hi Mikkel,
>
> We discussed this and concluded that one could argue that either behavior
> was the correct one.  What we'd like to do is add an option to
> ValidateSamFile to compute NM using the samtools algorithm.  I can't
> promise when I'll get around to doing this, though, because it doesn't
> sound like high priority.
>
> -Alec
>
> On Aug 30, 2013, at 2:31 PM, Mikkel Schubert <mik...@gm...> wrote:
>
> > Dear SAMTools and Picard developers,
> > I've run into an issue where Picard ValidateSamFile.jar will sometimes
> raise an INVALID_TAG_NM error for records that have been processed with the
> SAMTools "calmd" command. The cause of this appears to be that SAMTools
> counts it as a mismatch when an "N" is found in both the reference and in
> the query sequence, whereas Picard counts these pairs as matches, leading
> to a "wrong" NM value during validation.
> >
> > I would greatly appreciate it if some consensus could be reached on how
> the NM tag is to be calculated, as it would allow me to take advantage of
> this validation feature in ValidateSamFile.jar without having to curate for
> false positives.
> >
> > Best regards,
> >  Mikkel Schubert
> >
> ------------------------------------------------------------------------------
> > Learn the latest--Visual Studio 2012, SharePoint 2013, SQL 2012, more!
> > Discover the easy way to master current and previous Microsoft
> technologies
> > and advance your career. Get an incredible 1,500+ hours of step-by-step
> > tutorial videos with LearnDevNow. Subscribe today and save!
> >
> http://pubads.g.doubleclick.net/gampad/clk?id=58040911&iu=/4140/ostg.clktrk_______________________________________________
> > Samtools-help mailing list
> > Sam...@li...
> > https://lists.sourceforge.net/lists/listinfo/samtools-help
>
>

Re: [Samtools-help] too many open files with 32 threads IlluminaBasecallsConverter, ok with 16 (not the FAQ issue)

[Alec W. <al...@br...>]

Hi Brad,

Some of the files are read via memory mapping.  Java doesn't allow memory mapped files to be closed via a close() method, but rather via garbage collection.  (This is to avoid a security problem.)  As a result, the number of file handles required isn't entirely predictable but rather depends on the whim of the garbage collector.  IlluminaBasecallsToFastq explicitly calls the garbage collector periodically to mitigate this problem, but if you still have the problem the only solutions are to reduce the number of threads or increase the number of file handles.  On our standard Linux configuration we allow 128K open files.

-Alec

On Sep 6, 2013, at 3:23 PM, "Langhorst, Brad" <Lan...@ne...> wrote:

> When I attempt to split a paired end run by barcode like this:
> 
> [Fri Sep 06 14:17:23 EDT 2013] net.sf.picard.illumina.IlluminaBasecallsToFastq BASECALLS_DIR=/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/Data/Intensities/BaseCalls LANE=1 RUN_BARCODE=A49YA READ_STRUCTURE=101T6B101T MULTIPLEX_PARAMS=/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/multiplex_params.txt NUM_PROCESSORS=32 MAX_RECORDS_IN_RAM=10000000    ADAPTERS_TO_CHECK=[INDEXED, DUAL_INDEXED, NEXTERA_V2, FLUIDIGM] APPLY_EAMSS_FILTER=true FORCE_GC=true MAX_READS_IN_RAM_PER_TILE=1200000 MINIMUM_QUALITY=2 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 CREATE_INDEX=false CREATE_MD5_FILE=false
> 
> i see
> 
> Exception in thread "pool-1-thread-26" net.sf.picard.PicardException: File not found: (/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/Data/Intensities/BaseCalls/L001/C148.1/s_1_2112.bcl)
> at net.sf.picard.illumina.parser.readers.BclReader.<init>(BclReader.java:109)
> at net.sf.picard.illumina.parser.BclParser$1.<init>(BclParser.java:79)
> at net.sf.picard.illumina.parser.BclParser.makeCycleFileParser(BclParser.java:77)
> at net.sf.picard.illumina.parser.PerTilePerCycleParser.seekToTile(PerTilePerCycleParser.java:121)
> at net.sf.picard.illumina.parser.PerTilePerCycleParser.initialize(PerTilePerCycleParser.java:76)
> at net.sf.picard.illumina.parser.BclParser.<init>(BclParser.java:60)
> at net.sf.picard.illumina.parser.IlluminaDataProviderFactory.makeParser(IlluminaDataProviderFactory.java:313)
> at net.sf.picard.illumina.parser.IlluminaDataProviderFactory.makeDataProvider(IlluminaDataProviderFactory.java:203)
> at net.sf.picard.illumina.IlluminaBasecallsConverter$TileReader.process(IlluminaBasecallsConverter.java:468)
> at net.sf.picard.illumina.IlluminaBasecallsConverter$TileReadAggregator$2.run(IlluminaBasecallsConverter.java:569)
> at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1146)
> at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
> at java.lang.Thread.run(Thread.java:679)
> Caused by: java.io.FileNotFoundException: /mnt/ngstemp/users/Data For Brad/130827_M01193_0153_000000000-A49YA/Data/Intensities/BaseCalls/L001/C148.1/s_1_2112.bcl (Too many open files)
> at java.io.FileInputStream.open(Native Method)
> at java.io.FileInputStream.<init>(FileInputStream.java:137)
> at net.sf.picard.illumina.parser.readers.BclReader.<init>(BclReader.java:106)
> ... 12 more
> 
> 
> i've increased # open files from 1024 to 4096 with a ulimit -n 4096 command but that does not change anything.
> 
> if i run with 16 cpus it's fine.
>  net.sf.picard.illumina.IlluminaBasecallsToFastq BASECALLS_DIR=/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/Data/Intensities/BaseCalls LANE=1 RUN_BARCODE=A49YA READ_STRUCTURE=101T6B101T MULTIPLEX_PARAMS=/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/multiplex_params.txt NUM_PROCESSORS=16 MAX_RECORDS_IN_RAM=10000000    ADAPTERS_TO_CHECK=[INDEXED, DUAL_INDEXED, NEXTERA_V2, FLUIDIGM] APPLY_EAMSS_FILTER=true FORCE_GC=true MAX_READS_IN_RAM_PER_TILE=1200000 MINIMUM_QUALITY=2 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 CREATE_INDEX=false CREATE_MD5_FILE=false
> 
> 
> Any suggestions?
> 
> 
> Brad
> --
> Bradley W. Langhorst, Ph.D.
> Applications and Product Development Scientist
> 
> ------------------------------------------------------------------------------
> Learn the latest--Visual Studio 2012, SharePoint 2013, SQL 2012, more!
> Discover the easy way to master current and previous Microsoft technologies
> and advance your career. Get an incredible 1,500+ hours of step-by-step
> tutorial videos with LearnDevNow. Subscribe today and save!
> http://pubads.g.doubleclick.net/gampad/clk?id=58041391&iu=/4140/ostg.clktrk_______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help

Re: [Samtools-help] Different mismatch counting methodologies in SAMTools and Picard

[Alec W. <al...@br...>]

Hi Mikkel,

We discussed this and concluded that one could argue that either behavior was the correct one.  What we'd like to do is add an option to ValidateSamFile to compute NM using the samtools algorithm.  I can't promise when I'll get around to doing this, though, because it doesn't sound like high priority.

-Alec

On Aug 30, 2013, at 2:31 PM, Mikkel Schubert <mik...@gm...> wrote:

> Dear SAMTools and Picard developers,
> I've run into an issue where Picard ValidateSamFile.jar will sometimes raise an INVALID_TAG_NM error for records that have been processed with the SAMTools "calmd" command. The cause of this appears to be that SAMTools counts it as a mismatch when an "N" is found in both the reference and in the query sequence, whereas Picard counts these pairs as matches, leading to a "wrong" NM value during validation.
> 
> I would greatly appreciate it if some consensus could be reached on how the NM tag is to be calculated, as it would allow me to take advantage of this validation feature in ValidateSamFile.jar without having to curate for false positives.
> 
> Best regards,
>  Mikkel Schubert
> ------------------------------------------------------------------------------
> Learn the latest--Visual Studio 2012, SharePoint 2013, SQL 2012, more!
> Discover the easy way to master current and previous Microsoft technologies
> and advance your career. Get an incredible 1,500+ hours of step-by-step
> tutorial videos with LearnDevNow. Subscribe today and save!
> http://pubads.g.doubleclick.net/gampad/clk?id=58040911&iu=/4140/ostg.clktrk_______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help

[Samtools-help] Picard release 1.98

[Alec W. <al...@br...>]

Picard release 1.98
9 September 2013

- MarkDuplicates and EstimateLibraryComplexity: In usage message, clarify that optimization is done instead of applying default regex.  Clarify that read name regex must match entire read name.

- AddOrReplaceReadGroups.java: added predicted insert size option.

- ProcessExecutor.java: Add methods for executing a command, interleaving stdout and stderr, and return exit status in addition to command output.


-Alec

Re: [Samtools-help] SAM header 'SO:unknown' fails

[Alec W. <al...@br...>]

Hi Julian,

I guess 'unknown' was added at some point and I didn't notice it.

Does anyone know if there is any substantive difference between 'unknown' and 'unsorted'?

Thanks, Alec

On Aug 31, 2013, at 3:50 AM, Julian Gehring <jul...@em...> wrote:

> Hi,
> 
> Can Picard's 'MergeSamFiles' handle a BAM header that specifies 'SO' as 
> 'unknown'?  This is valid in the current SAM specs 
> (http://samtools.sourceforge.net/SAM1.pdf), but seems to break Picard:
> 
> [Sat Aug 31 08:46:13 BST 2013] net.sf.picard.sam.MergeSamFiles 
> INPUT=[out.bam] OUTPUT=out-sort.bam CREATE_INDEX=true 
> SORT_ORDER=coordinate ASSUME_SORTED=false 
> MERGE_SEQUENCE_DICTIONARIES=false USE_THREADING=false VERBOSITY=INFO 
> QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 
> MAX_RECORDS_IN_RAM=500000 CREATE_MD5_FILE=false
> [Sat Aug 31 08:46:13 BST 2013] Executing as jge...@eb... 
> on Linux 2.6.32-358.14.1.el6.x86_64 amd64; OpenJDK 64-Bit Server VM 
> 1.6.0_24-b24; Picard version: 1.97(1540)
> [Sat Aug 31 08:46:14 BST 2013] net.sf.picard.sam.MergeSamFiles done. 
> Elapsed time: 0.01 minutes.
> Runtime.totalMemory()=1138294784
> To get help, see http://picard.sourceforge.net/index.shtml#GettingHelp
> Exception in thread "main" java.lang.IllegalArgumentException: No enum 
> const class net.sf.samtools.SAMFileHeader$SortOrder.unknown
> 	at java.lang.Enum.valueOf(Enum.java:214)
> 	at net.sf.samtools.SAMFileHeader$SortOrder.valueOf(SAMFileHeader.java:58)
> 	at net.sf.samtools.SAMFileHeader.getSortOrder(SAMFileHeader.java:239)
> 	at net.sf.picard.sam.MergeSamFiles.doWork(MergeSamFiles.java:109)
> 	at 
> net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
> 	at net.sf.picard.sam.MergeSamFiles.main(MergeSamFiles.java:79)
> 
> This results from a header line: "@HD	VN:1.0	SO:unknown".  Changing the 
> header to "@HD	VN:1.0	SO:unsorted" fixes the problem.
> 
> Best wishes
> Julian
> 
> ------------------------------------------------------------------------------
> Learn the latest--Visual Studio 2012, SharePoint 2013, SQL 2012, more!
> Discover the easy way to master current and previous Microsoft technologies
> and advance your career. Get an incredible 1,500+ hours of step-by-step
> tutorial videos with LearnDevNow. Subscribe today and save!
> http://pubads.g.doubleclick.net/gampad/clk?id=58040911&iu=/4140/ostg.clktrk
> _______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help

[Samtools-help] too many open files with 32 threads IlluminaBasecallsConverter, ok with 16 (not the FAQ issue)

[Langhorst, B. <Lan...@ne...>]

When I attempt to split a paired end run by barcode like this:

[Fri Sep 06 14:17:23 EDT 2013] net.sf.picard.illumina.IlluminaBasecallsToFastq BASECALLS_DIR=/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/Data/Intensities/BaseCalls LANE=1 RUN_BARCODE=A49YA READ_STRUCTURE=101T6B101T MULTIPLEX_PARAMS=/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/multiplex_params.txt NUM_PROCESSORS=32 MAX_RECORDS_IN_RAM=10000000    ADAPTERS_TO_CHECK=[INDEXED, DUAL_INDEXED, NEXTERA_V2, FLUIDIGM] APPLY_EAMSS_FILTER=true FORCE_GC=true MAX_READS_IN_RAM_PER_TILE=1200000 MINIMUM_QUALITY=2 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 CREATE_INDEX=false CREATE_MD5_FILE=false

i see

Exception in thread "pool-1-thread-26" net.sf.picard.PicardException: File not found: (/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/Data/Intensities/BaseCalls/L001/C148.1/s_1_2112.bcl)
at net.sf.picard.illumina.parser.readers.BclReader.<init>(BclReader.java:109)
at net.sf.picard.illumina.parser.BclParser$1.<init>(BclParser.java:79)
at net.sf.picard.illumina.parser.BclParser.makeCycleFileParser(BclParser.java:77)
at net.sf.picard.illumina.parser.PerTilePerCycleParser.seekToTile(PerTilePerCycleParser.java:121)
at net.sf.picard.illumina.parser.PerTilePerCycleParser.initialize(PerTilePerCycleParser.java:76)
at net.sf.picard.illumina.parser.BclParser.<init>(BclParser.java:60)
at net.sf.picard.illumina.parser.IlluminaDataProviderFactory.makeParser(IlluminaDataProviderFactory.java:313)
at net.sf.picard.illumina.parser.IlluminaDataProviderFactory.makeDataProvider(IlluminaDataProviderFactory.java:203)
at net.sf.picard.illumina.IlluminaBasecallsConverter$TileReader.process(IlluminaBasecallsConverter.java:468)
at net.sf.picard.illumina.IlluminaBasecallsConverter$TileReadAggregator$2.run(IlluminaBasecallsConverter.java:569)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1146)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
at java.lang.Thread.run(Thread.java:679)
Caused by: java.io.FileNotFoundException: /mnt/ngstemp/users/Data For Brad/130827_M01193_0153_000000000-A49YA/Data/Intensities/BaseCalls/L001/C148.1/s_1_2112.bcl (Too many open files)
at java.io.FileInputStream.open(Native Method)
at java.io.FileInputStream.<init>(FileInputStream.java:137)
at net.sf.picard.illumina.parser.readers.BclReader.<init>(BclReader.java:106)
... 12 more


i've increased # open files from 1024 to 4096 with a ulimit -n 4096 command but that does not change anything.

if i run with 16 cpus it's fine.
 net.sf.picard.illumina.IlluminaBasecallsToFastq BASECALLS_DIR=/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/Data/Intensities/BaseCalls LANE=1 RUN_BARCODE=A49YA READ_STRUCTURE=101T6B101T MULTIPLEX_PARAMS=/mnt/ngstemp/130827_M01193_0153_000000000-A49YA/multiplex_params.txt NUM_PROCESSORS=16 MAX_RECORDS_IN_RAM=10000000    ADAPTERS_TO_CHECK=[INDEXED, DUAL_INDEXED, NEXTERA_V2, FLUIDIGM] APPLY_EAMSS_FILTER=true FORCE_GC=true MAX_READS_IN_RAM_PER_TILE=1200000 MINIMUM_QUALITY=2 VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 CREATE_INDEX=false CREATE_MD5_FILE=false


Any suggestions?


Brad
--
Bradley W. Langhorst, Ph.D.
Applications and Product Development Scientist

Re: [Samtools-help] bgzf buffering

[Davide C. <cit...@hs...>]

Hi John, 

On Sep 6, 2013, at 1:07 PM, John Marshall <jm...@sa...> wrote:

> Sadly it doesn't appear to make much of a performance difference on our Lustre installation [1], but I'd be very interested to hear what effect it has for you on GPFS.
> 
>   John
> 
> [1] which is actually quite impressive: apparently the Lustre kernel modules are plugged into the Linux kernel buffering systems better than one might expect.

I'm quite interested in this, as we have a Lustre FS and BAM I/O is painfully slow. Did you make tests also changing tuning lustre parameters?

d

/*
Davide Cittaro, PhD

Coordinator of Bioinformatics Core
Center for Translational Genomics and Bioinformatics
Ospedale San Raffaele
Via Olgettina 58
20132 Milano
Italy

Office: +39 02 26439211
Mail: cit...@hs...
Skype: daweonline
*/

Re: [Samtools-help] bgzf buffering

[Louis L. <lou...@ma...>]

As soon as it's in samtools I'll try it out. I benched my changes with a
big bam and sort.

It made a big difference.

What size blocks does your File system have? We have 4MB blocks. Going
away from the typical 4km 16k, 32k helps a lot.

Louis

On 13-09-06 07:07 AM, John Marshall wrote:
> On 28 Aug 2013, at 11:58, Louis Letourneau wrote:
>> Wow, this is perfect. In my case just turning KNET off and falling back
>> to fread + setvbuf made a drastic change since optimal blocks are 4MB.
> [...]
>>
>> Looking forward to your commit.
> 
> I've now pushed the changes to read/write BAM files via this buffering code to the io branch in https://github.com/samtools/htslib and am in the process of merging it to develop; SAM etc files to follow.  Sadly it doesn't appear to make much of a performance difference on our Lustre installation [1], but I'd be very interested to hear what effect it has for you on GPFS.
> 
>     John
> 
> [1] which is actually quite impressive: apparently the Lustre kernel modules are plugged into the Linux kernel buffering systems better than one might expect.
> 

Re: [Samtools-help] bgzf buffering

[John M. <jm...@sa...>]

On 28 Aug 2013, at 11:58, Louis Letourneau wrote:
> Wow, this is perfect. In my case just turning KNET off and falling back
> to fread + setvbuf made a drastic change since optimal blocks are 4MB.
[...]
> 
> Looking forward to your commit.

I've now pushed the changes to read/write BAM files via this buffering code to the io branch in https://github.com/samtools/htslib and am in the process of merging it to develop; SAM etc files to follow.  Sadly it doesn't appear to make much of a performance difference on our Lustre installation [1], but I'd be very interested to hear what effect it has for you on GPFS.

    John

[1] which is actually quite impressive: apparently the Lustre kernel modules are plugged into the Linux kernel buffering systems better than one might expect.

-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE. 

Re: [Samtools-help] Using Tabix in Java

[Louis L. <lou...@ma...>]

Tribble has been integrated into picard since
Picard release 1.84
14 January 2013

and the tabix reader there works great. I used it in some projects.

hope this helps.

Louis

On 9/5/2013 6:59 PM, Oliver Ruebenacker wrote:
> 
>      Hello Heng,
> 
> 
> On Thu, Sep 5, 2013 at 5:43 PM, Heng Li <lh...@sa...
> <mailto:lh...@sa...>> wrote:
> 
>     I think IGV/GATK has an improved version of TabixReader.java. I do
>     not know for sure, though. You also need sam.jar from Picard for the
>     BGZF support.
> 
> 
>   What do IGV, GATK and BGZF mean? Thanks!
> 
>      Best,
>      Oliver
>  
> 
> 
>     Heng
> 
>     On Sep 5, 2013, at 5:42 PM, Oliver Ruebenacker <cu...@gm...
>     <mailto:cu...@gm...>> wrote:
> 
>>
>>          Hello Heng,
>>
>>       Thanks for the quick response! Glad to hear there is a pure Java
>>     solution.
>>
>>       You mean there are better alternatives to TabixReader.java?
>>
>>       There is an unsatisfied import
>>     net.sf.samtools.util.BlockCompressedInputStream, where do we get
>>     that from? Picard project?
>>
>>       Thanks!
>>
>>          Best,
>>          Oliver
>>
>>
>>
>>     On Thu, Sep 5, 2013 at 5:34 PM, Heng Li <lh...@sa...
>>     <mailto:lh...@sa...>> wrote:
>>
>>         It is a port, not a wrapper. I believe there are better ports
>>         based on this TabixReader.java.
>>
>>         Heng
>>
>>         On Sep 5, 2013, at 5:24 PM, Oliver Ruebenacker
>>         <cu...@gm... <mailto:cu...@gm...>> wrote:
>>
>>>
>>>              Hello,
>>>
>>>           We want to use Tabix in Java. It comes with a file
>>>         TabixReader.java. Is this a port or wrapper?
>>>
>>>           Thanks!
>>>
>>>              Best,
>>>              Oliver
>>>
>>>         -- 
>>>         Oliver Ruebenacker
>>>         IT Project Lead at PanGenX (http://www.pangenx.com
>>>         <http://www.pangenx.com/>)
>>>         Be always grateful, but never satisfied.
>>>         ------------------------------------------------------------------------------
>>>         Learn the latest--Visual Studio 2012, SharePoint 2013, SQL
>>>         2012, more!
>>>         Discover the easy way to master current and previous
>>>         Microsoft technologies
>>>         and advance your career. Get an incredible 1,500+ hours of
>>>         step-by-step
>>>         tutorial videos with LearnDevNow. Subscribe today and save!
>>>         http://pubads.g.doubleclick.net/gampad/clk?id=58041391&iu=/4140/ostg.clktrk_______________________________________________
>>>         Samtools-help mailing list
>>>         Sam...@li...
>>>         <mailto:Sam...@li...>
>>>         https://lists.sourceforge.net/lists/listinfo/samtools-help
>>
>>
>>         -- The Wellcome Trust Sanger Institute is operated by Genome
>>         Research Limited, a charity registered in England with number
>>         1021457 and a company registered in England with number
>>         2742969, whose registered office is 215 Euston Road, London,
>>         NW1 2BE.
>>
>>
>>
>>
>>     -- 
>>     Oliver Ruebenacker
>>     IT Project Lead at PanGenX (http://www.pangenx.com
>>     <http://www.pangenx.com/>)
>>     Be always grateful, but never satisfied.
> 
> 
>     -- The Wellcome Trust Sanger Institute is operated by Genome
>     Research Limited, a charity registered in England with number
>     1021457 and a company registered in England with number 2742969,
>     whose registered office is 215 Euston Road, London, NW1 2BE.
> 
> 
> 
> 
> -- 
> Oliver Ruebenacker
> IT Project Lead at PanGenX (http://www.pangenx.com)
> Be always grateful, but never satisfied.
> 
> 
> ------------------------------------------------------------------------------
> Learn the latest--Visual Studio 2012, SharePoint 2013, SQL 2012, more!
> Discover the easy way to master current and previous Microsoft technologies
> and advance your career. Get an incredible 1,500+ hours of step-by-step
> tutorial videos with LearnDevNow. Subscribe today and save!
> http://pubads.g.doubleclick.net/gampad/clk?id=58041391&iu=/4140/ostg.clktrk
> 
> 
> 
> _______________________________________________
> Samtools-help mailing list
> Sam...@li...
> https://lists.sourceforge.net/lists/listinfo/samtools-help
>