Re: [Samtools-help] BAM split error on samtools!

SourceForge Headquarters 1320 Columbia Street Suite 310 San Diego, CA 92101 +1 (858) 422-6466

Thanks guys, 

I still have several problems and I must be doing somethings wrong, I'll try to explain what I'm doing and the corresponding outputs here:
1) when opening the samtools executable, on a directory Desktop/SAMTOOLS created for this purpose, it opens a terminal window with the following content:
Last login: Wed Feb 29 11:40:20 on ttys002
chataignier:~ leandro$ /Users/leandro/Desktop/SAMTOOLS/samtools ; exit;

Program: samtools (Tools for alignments in the SAM format)
Version: 0.1.18 (r982:295)

Usage:   samtools <command> [options]

Command: view        SAM<->BAM conversion
         sort        sort alignment file
         mpileup     multi-way pileup
         depth       compute the depth
         faidx       index/extract FASTA
         tview       text alignment viewer
         index       index alignment
         idxstats    BAM index stats (r595 or later)
         fixmate     fix mate information
         flagstat    simple stats
         calmd       recalculate MD/NM tags and '=' bases
         merge       merge sorted alignments
         rmdup       remove PCR duplicates
         reheader    replace BAM header
         cat         concatenate BAMs
         targetcut   cut fosmid regions (for fosmid pool only)
         phase       phase heterozygotes

logout

[Process completed]

and it doesn't allow me to enter other requests. So I've opened a new terminal window and since it doesn't recognize the samtools command, I've created a variable $samtools=/Users/leandro/Desktop/SAMTOOLS/samtools which allows me to work with samtools.

2) then I introduce the command I gave you before: 
$samtools view -bh ftp://ftp-mouse.sanger.ac.uk/current_bams/PWK_PhJ.bam chr11 > chr11.bam

- always the segmentation fault error;
- so like you suggested, I've tried to use 11 instead of chr11, 
it gives: 
[bam_index_load] attempting to download the remote index file.
and surprisingly it starts producing a chr11.bam file and a PWK_PhJ.bam.bai --> this step ends when the file is 3.94Gb, contrarily to the 5,3Gb file found by Michael.
However, when I request to visualize the first and last lines of this bam file, this is what I get:
&?]???????ִ??Ԡ?K??
                 ???%?B[~'8OK?c??F??32m?>?4?mq/fDw?O?T5??p¡Oq???? ??3B??nק>U???W?[Uh4
     ???}i???wyC?
                 (T??G???i??lr6qIz?b?g?;??????0."ueS??5?KI??St?>
                                                                ?=#?E??i\W?@5[?V?պ?A??-?|}U?QVti?9ߥ????:?6?j??Z	???]????5H򳲉?0p?6lg????t{
57????????~?T??F?????+????}ML?f?MS>>???[?

And I guess this is not what I was supposed to get.

3) When I repeat the same thing but this time without the -b, so: 
$samtools view -h ftp://ftp-mouse.sanger.ac.uk/current_bams/PWK_PhJ.bam 11 > chr11.bam  , last time it produced a chr11.bam with 13,85Gb and a normal output

HEADER (extract):
@HD	VN:1.0	GO:none	SO:coordinate
@SQ	SN:1	LN:197195432	AS:NCBIM37	UR:file:/lustre/scratch102/projects/mouse/ref/NCBIM37_um	M5:f05d753079c455c0e57af88eeda24493
@SQ	SN:10	LN:129993255	AS:NCBIM37	UR:file:/lustre/scratch102/projects/mouse/ref/NCBIM37_um	M5:be7e6a13cc6b9da7c1da7b7fc32c5506
@SQ	SN:11	LN:121843856	AS:NCBIM37	UR:file:/lustre/scratch102/projects/mouse/ref/NCBIM37_um	M5:e0099550b3d3943fb9bb7af6fa6952c1
@SQ	SN:12	LN:121257530	AS:NCBIM37	UR:file:/lustre/scratch102/projects/mouse/ref/NCBIM37_um	M5:1f9c11dc6f288f93e9fab56772a36e85

ALIGNMENT (extract):
IL11_3085:6:20:1669:458	99	11	2999992	30	76M	=	3000458542	TCGCCATTACCAAGGTCCTACTTGTATATTTCCCATTTTTCACGTTTTTCACTGTTTCTCGCCATATTCCAAGTCT	BBBBBBBBBABBBBB>BB@@@BBB?9?@B@B@@@@@ABA@@@@>=>@@?;9<<:=@=<@@9:;9:74<9887:05<	MF:i:130	Aq:i:30	UQ:i:55	H0:i:0	H1:i:0	RG:Z:3085_6	NM:i:14MD:Z:0N0N0N0N0N0N0N0N0N0A0A0G13G6A43
IL34_2814:8:1:857:1789	163	11	2999996	55	54M	=	3000152210	CATTACCAAGGTCCTACTTGTATATTTCCCATTTTTCACGTTTTTCACTGTTTC	ABBBBBBCBC677B@BBBBBABBABAABBA?BBABBBBBC7@A>@BA@BBBA@B	MF:i:130	Aq:i:55	UQ:i:66	H0:i:0	H1:i:0	RG:Z:2814_8	NM:i:10	MD:Z:0N0N0N0N0N0A0A0G13G6A25

4) the output for file 'which samtools' is 
which samtools: cannot open `which samtools' (No such file or directory)

Probably these are basic questions and I'm making simple programming errors, but I'd really appreciate if you could suggest some ideas about why this is happening.

Best regards,
Leandro

On 28 févr. 2012, at 10:10, Michael Dondrup wrote:

> Hi,
> 
> I also tested this command on Mac OS (but under Lion) and it works for me:
> Darwin Confucius 11.3.0 Darwin Kernel Version 11.3.0: Thu Jan 12 18:47:41 PST 2012; root:xnu-1699.24.23~1/RELEASE_X86_64 x86_64
> I would try to do a fresh build, did you see any compiler warnings? What your the output of:
> 
> $ samtools
>  Version: 0.1.18 (r982:295) […]
> $ file `which samtools`
>  /opt/local/bin/samtools: Mach-O 64-bit executable x86_64
> 
> What happens if you download that file and then run the command on the local file?
> 
> Best
> Michael
> 
> On Feb 27, 2012, at 7:46 PM, Brent Pedersen wrote:
> 
>> On Mon, Feb 27, 2012 at 10:16 AM, Leandro Batista <lba...@pa...> wrote:
>>> Good Afternoon,
>>> 
>>> I am starting to use samtools to perform whole genome sequence analysis in
>>> mouse. Since mouse strain genome bam files are huge, I want to split them by
>>> chromosomal position. Besides, i'm obtaining the genome alignments from FTP.
>>> For this, I introduce the following command:
>>> 
>>> $samtools view -bh ftp://ftp-mouse.sanger.ac.uk/current_bams/PWK_PhJ.bam
>>> chr11 > chr11.bam
>>> 
>> 
>> Try using just "11" instead of chr11.
>> 
> no, there is data for chr11 seemingly, the resulting bam file for me is 5.3GB.
> 
>>> and it is giving me the following error:
>>> Segmentation fault.
>>> 
>>> Another problem I'm having is with defining a specific region inside
>>> chromosome 11. When I try to use the suggested format:
>>> 'chr11:1,000,000-2,000,000' ; it gives another error:
>>> 
>>> [bam_parse_region] fail to determine the sequence name.
>>> [main_samview] region "chr11:1,000,000-2,000,000" specifies an unknown
>>> reference name. Continue anyway.
>>> 
>> 
>> This is the same problem.
>> 
>> 
>>> Since I'm a beginner in both programming and samtools, I'm having problems
>>> in understanding where the errors come from.  Can you help me dealing with
>>> this?
>>> 
>>> I'm using a iMac with 4Gb RAM
>>> $ uname -a: Darwin chataignier.gfons.pasteur.fr 10.8.0 Darwin Kernel Version
>>> 10.8.0: Tue Jun  7 16:33:36 PDT 2011; root:xnu-1504.15.3~1/RELEASE_I386 i386
>>> 
>>> I'm running the last version of samtools 0.1.18.
>>> 
>>> I really hope you can help me.
>>> 
>>> Best Regards
>>> Leandro Batista
>>> 
>>> 
>>> 
>>> 
>>> ------------------------------------------------------------------------------
>>> Try before you buy = See our experts in action!
>>> The most comprehensive online learning library for Microsoft developers
>>> is just $99.99! Visual Studio, SharePoint, SQL - plus HTML5, CSS3, MVC3,
>>> Metro Style Apps, more. Free future releases when you subscribe now!
>>> http://p.sf.net/sfu/learndevnow-dev2
>>> _______________________________________________
>>> Samtools-help mailing list
>>> Sam...@li...
>>> https://lists.sourceforge.net/lists/listinfo/samtools-help
>>> 
>> 
>> ------------------------------------------------------------------------------
>> Try before you buy = See our experts in action!
>> The most comprehensive online learning library for Microsoft developers
>> is just $99.99! Visual Studio, SharePoint, SQL - plus HTML5, CSS3, MVC3,
>> Metro Style Apps, more. Free future releases when you subscribe now!
>> http://p.sf.net/sfu/learndevnow-dev2
>> _______________________________________________
>> Samtools-help mailing list
>> Sam...@li...
>> https://lists.sourceforge.net/lists/listinfo/samtools-help
> 