Menu
▾
▴
psidev-pi-dev — General Development List for Proteomics Informatics
You can subscribe to this list here.
| 2006 |
Jan
|
Feb
|
Mar
|
Apr
|
May
|
Jun
(1) |
Jul
(5) |
Aug
(4) |
Sep
(4) |
Oct
(10) |
Nov
(1) |
Dec
(1) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2007 |
Jan
|
Feb
|
Mar
(2) |
Apr
|
May
|
Jun
|
Jul
(4) |
Aug
|
Sep
|
Oct
(1) |
Nov
|
Dec
|
| 2008 |
Jan
|
Feb
(2) |
Mar
(2) |
Apr
(8) |
May
(40) |
Jun
(30) |
Jul
(61) |
Aug
(21) |
Sep
(12) |
Oct
(56) |
Nov
(99) |
Dec
(83) |
| 2009 |
Jan
(3) |
Feb
(9) |
Mar
(1) |
Apr
(5) |
May
(88) |
Jun
(43) |
Jul
(60) |
Aug
(54) |
Sep
(4) |
Oct
(18) |
Nov
(9) |
Dec
(5) |
| 2010 |
Jan
|
Feb
(3) |
Mar
(1) |
Apr
(8) |
May
(10) |
Jun
(8) |
Jul
(10) |
Aug
(18) |
Sep
(11) |
Oct
(19) |
Nov
(14) |
Dec
(26) |
| 2011 |
Jan
(27) |
Feb
(38) |
Mar
(50) |
Apr
(128) |
May
(54) |
Jun
(116) |
Jul
(79) |
Aug
(163) |
Sep
(21) |
Oct
(14) |
Nov
(19) |
Dec
(9) |
| 2012 |
Jan
(7) |
Feb
(34) |
Mar
(34) |
Apr
(50) |
May
(70) |
Jun
(23) |
Jul
(8) |
Aug
(24) |
Sep
(35) |
Oct
(40) |
Nov
(276) |
Dec
(34) |
| 2013 |
Jan
(25) |
Feb
(23) |
Mar
(12) |
Apr
(59) |
May
(31) |
Jun
(11) |
Jul
(21) |
Aug
(7) |
Sep
(18) |
Oct
(11) |
Nov
(12) |
Dec
(18) |
| 2014 |
Jan
(37) |
Feb
(22) |
Mar
(9) |
Apr
(10) |
May
(38) |
Jun
(20) |
Jul
(15) |
Aug
(4) |
Sep
(4) |
Oct
(3) |
Nov
(8) |
Dec
(5) |
| 2015 |
Jan
(13) |
Feb
(34) |
Mar
(27) |
Apr
(5) |
May
(12) |
Jun
(10) |
Jul
(12) |
Aug
(3) |
Sep
(1) |
Oct
(13) |
Nov
|
Dec
(6) |
| 2016 |
Jan
(1) |
Feb
(1) |
Mar
(17) |
Apr
(139) |
May
(120) |
Jun
(90) |
Jul
(10) |
Aug
|
Sep
|
Oct
(11) |
Nov
(6) |
Dec
(2) |
| 2017 |
Jan
(24) |
Feb
(8) |
Mar
(7) |
Apr
(2) |
May
(5) |
Jun
(11) |
Jul
(5) |
Aug
(9) |
Sep
(6) |
Oct
(4) |
Nov
(2) |
Dec
(4) |
| 2018 |
Jan
(7) |
Feb
|
Mar
(4) |
Apr
(6) |
May
(10) |
Jun
(6) |
Jul
(7) |
Aug
|
Sep
(7) |
Oct
(5) |
Nov
(3) |
Dec
(3) |
| 2019 |
Jan
(3) |
Feb
|
Mar
(4) |
Apr
(3) |
May
(2) |
Jun
(6) |
Jul
(3) |
Aug
(2) |
Sep
|
Oct
(2) |
Nov
(12) |
Dec
(1) |
| 2020 |
Jan
(3) |
Feb
(1) |
Mar
(2) |
Apr
|
May
|
Jun
|
Jul
|
Aug
(1) |
Sep
|
Oct
(1) |
Nov
|
Dec
|
| 2021 |
Jan
|
Feb
|
Mar
|
Apr
(3) |
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
|
|
From: Pierre-Alain B. <pie...@is...> - 2008-06-27 15:15:35
|
format-version: 1.0 date: 23:04:2008 10:40 saved-by: pab auto-generated-by: OBO-Edit 1.101 default-namespace: PSI-DB remark: When appropriate the definition and synonyms of a term are reported exactly as in the chapter 12 of IUPAC orange book. See http://www.iupac.org/projects/2003/2003-056-2-500.html. [Term] id: DB:0000001 name: Common Sequence Database Format Controlled Vocabulary def: "Common Sequence Database Format Controlled Vocabulary." [PSI:DB] [Term] id: DB:0000002 name: File Header Section def: "Common Sequence Database Format File Header Section." [PSI:DB] is_a: DB:0000001 ! CV root term [Term] id: DB:0000003 name: Individual Sequence Entry Section def: "Common Sequence Database Format Individual Entry Section." [PSI:DB] is_a: DB:0000001 ! CV root term [Term] id: DB:0000004 name: DbName def: "Sequence Database Name." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000005 name: Prefix def: "Sequence Database Prefix." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000006 name: DbDescription def: "Sequence Database Short description." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000007 name: Decoy def: "Speciofies whether the Sequence Database is a Decoy." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000008 name: DbSource def: "Source of the database file." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000009 name: DbVersion def: "Database version (release date) according to database provider." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000010 name: DbDate def: "Database date (release or file date of the source) according to database provider." [PSI:DB] is_a: DB:0000002 ! File Header Section term is: obsolete [Term] id: DB:0000011 name: NumberOfEntries def: "Number of sequence entries in the database." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000012 name: Conversion def: "Description of the conversion from original format to this current one." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000013 name: SequenceType def: "Molecular type of the sequences." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000014 name: SpecificKey def: "Db specific information (not included in the current list of allowed keys)." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0000015 name: SpecificValue def: "DB specific values for a defined key." [PSI:DB] is_a: DB:0000002 ! File Header Section term [Term] id: DB:0001001 name: DbUniqueId def: "Sequence Database unique indentifier." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001002 name: PName def: "Protein Name, description." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001003 name: NcbiTaxId def: "NCBI taxonomy identifier." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001004 name: TaxName def: "Taxonomy name (latin or common name)." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001005 name: GName def: "Gene name." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001006 name: Length def: "Sequence length." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001007 name: SV def: "Sequence version." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001008 name: EV def: "Entry version." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001009 name: PE def: "Protein Evidence; A UniprotKB code." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001010 name: Processed def: "Processed Molecule." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001011 name: Variant def: "Sequence variation (substitution, insertion, deletion)." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001012 name: ModResPsi def: "Modified residue with PSI-MOD identifier." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001013 name: ModRes def: "Modified residue without PSI-MOD identifier." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term [Term] id: DB:0001014 name: AltAC def: "Alternative Accession Code." [PSI:DB] is_a: DB:0000003 ! Individual Entry Section term |
|
From: Pierre-Alain B. <pie...@is...> - 2008-06-27 15:12:54
|
good to me too (a few comments below) David Creasy wrote: > OK by me. > > Jones, Andy wrote: >> >> So how about include length as an attribute and then let all other >> things go in the CV (pI, mass, etc.)? >> >> >> >> >> >> >> >> *From:* Jones, Andy >> *Sent:* 27 June 2008 14:54 >> *To:* 'David Creasy' >> *Subject:* RE: [Psidev-pi-dev] Representing Sequences >> >> >> >> id and name are standard for all elements that inherit from FuGE >> identifiable – this is perhaps a separate discussion as to whether >> the optional name attribute should be there. >> >> >> >> I agree that length may be useful – is this just an integer value >> with no unit? >> >> Yes, I think so. >> >> I’m less sure about pI and mass since mass at least can be calculated >> very simply >> >> Only if you have the sequence... (we have residue masses in the file). >> ... everyone uses the same algorithm for the pI... >> >> >> >> >> >> , and pI values (in my opinion) are pretty inaccurate and fairly >> meaningless >> >> Scandalous! (I happen to agree, but now some people will never speak >> to either of us ever again). >> >> The main problem with mass and pI is that these are 'irrelevant' if >> the sequence is nuleic acid rather than residues. >> Why not just allow CV there? We can share the same CV as the PEFF >> format, which includes, taxonomy, sequence type, gene ID, and lots of >> wonderful other things? >> good. Therefore things like pI, mass, etc should be added in the PEFF CV? (as they might be representing a sequence entry information?) Pierre-Alain >> >> >> >> – unless someone can convince me otherwise? >> >> Cheers >> >> Andy >> >> >> >> >> >> *From:* David Creasy [mailto:dc...@ma...] >> *Sent:* 27 June 2008 14:51 >> *To:* Jones, Andy >> *Cc:* psi...@li... >> <mailto:psi...@li...> >> *Subject:* Re: [Psidev-pi-dev] Representing Sequences >> >> >> >> Hi Andy, >> >> length may be useful, because some people won't want to output the >> actual sequence for space reasons. The other things we wanted to add >> before were pI and mass. >> Why do we want name? Is this for, say, a description line? >> (Also, identifier -> id?) >> >> David >> >> Jones, Andy wrote: >> >> Hi all, >> >> >> >> It was decided on the call that we would like to flag that Sequences >> in the ConceptualMoleculeCollection should have a Boolean attribute >> to capture if they are decoy sequences. At the moment we are using >> the FuGE:Sequence element. I don’t really want to add another >> attribute to this (it’s less problematic cutting down FuGE than >> adding new things), so I’m wondering if we should define our own >> Sequence type in AnalysisXML. This would also allow us to choose >> exactly the relevant attributes. At the moment, Sequence can have all >> of the following: >> >> >> >> <pf:Sequence isCircular="true" >> sequence="String" length="0" isApproximateLength="true" >> SequenceAnnotationSet_ref="String" start="0" end="0" >> identifier="String" name="String"> >> >> >> >> Several of these attributes were created to represent concepts that >> probably will never be required or implemented in AnalysisXML. How >> about the following: >> >> >> >> <DBSequence identifier = “” name = “” isDecoy = “true”> >> >> <seq>MCTMG...</seq> >> >> <pf:DatabaseReference Database_ref="" >> accession="Rev_IPI00013808.1"/> >> >> </DBSequence> >> >> >> >> Are any of the other attributes on Sequence actually required? I’ll >> post a new version of the schema with other changes WRT to >> PeptideEvidence shortly, >> >> Cheers >> >> Andy >> >> >> >> >> >> >> >> >> >> >> >> >> >> >> >> ------------------------------------------------------------------------ >> >> >> >> >> >> >> >> >> >> ------------------------------------------------------------------------- >> Check out the new SourceForge.net Marketplace. >> It's the best place to buy or sell services for >> just about anything Open Source. >> http://sourceforge.net/services/buy/index.php >> >> >> >> >> ------------------------------------------------------------------------ >> >> >> >> >> >> >> >> >> >> _______________________________________________ >> Psidev-pi-dev mailing list >> Psi...@li... <mailto:Psi...@li...> >> https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev >> >> >> >> >> -- >> David Creasy >> Matrix Science >> 64 Baker Street >> London W1U 7GB, UK >> Tel: +44 (0)20 7486 1050 >> Fax: +44 (0)20 7224 1344 >> >> dc...@ma... <mailto:dc...@ma...> >> http://www.matrixscience.com >> >> Matrix Science Ltd. is registered in England and Wales >> Company number 3533898 >> >> ------------------------------------------------------------------------ >> >> >> >> >> ------------------------------------------------------------------------- >> Check out the new SourceForge.net Marketplace. >> It's the best place to buy or sell services for >> just about anything Open Source. >> http://sourceforge.net/services/buy/index.php >> >> ------------------------------------------------------------------------ >> >> >> >> >> _______________________________________________ >> Psidev-pi-dev mailing list >> Psi...@li... <mailto:Psi...@li...> >> https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev >> >> >> >> >> -- >> David Creasy >> Matrix Science >> 64 Baker Street >> London W1U 7GB, UK >> Tel: +44 (0)20 7486 1050 >> Fax: +44 (0)20 7224 1344 >> >> dc...@ma... <mailto:dc...@ma...> >> http://www.matrixscience.com >> >> Matrix Science Ltd. is registered in England and Wales >> Company number 3533898 >> ------------------------------------------------------------------------ >> >> ------------------------------------------------------------------------- >> Check out the new SourceForge.net Marketplace. >> It's the best place to buy or sell services for >> just about anything Open Source. >> http://sourceforge.net/services/buy/index.php >> ------------------------------------------------------------------------ >> >> _______________________________________________ >> Psidev-pi-dev mailing list >> Psi...@li... >> https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev >> > > -- > David Creasy > Matrix Science > 64 Baker Street > London W1U 7GB, UK > Tel: +44 (0)20 7486 1050 > Fax: +44 (0)20 7224 1344 > > dc...@ma... > http://www.matrixscience.com > > Matrix Science Ltd. is registered in England and Wales > Company number 3533898 > ------------------------------------------------------------------------ > > ------------------------------------------------------------------------- > Check out the new SourceForge.net Marketplace. > It's the best place to buy or sell services for > just about anything Open Source. > http://sourceforge.net/services/buy/index.php > ------------------------------------------------------------------------ > > _______________________________________________ > Psidev-pi-dev mailing list > Psi...@li... > https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev > |
|
From: Angel P. <an...@ma...> - 2008-06-27 14:58:25
|
my 2¢ : You need to be able to extend this to all molecule types, or am I missing the point of this thread, and you mean that this would be a suclass of the conceptual molecule element? Second, and this is is tangentially related, but are decoy sequences really a problem we should be putting our effort into? Is it in our domain to encode semantic information about a sequence, and possibly relating reported sequences as part of our schema? On a personal level I could care less if "isDecoy" is an attribute or not, but the temptation then would be for folks to encode the same accession for two different sequences, effectively making the primary key of the sequence object (accession, isDecoy) Do we want to go there? On Fri, Jun 27, 2008 at 10:21 AM, Jones, Andy <And...@li...> wrote: > So how about include length as an attribute and then let all other things > go in the CV (pI, mass, etc.)? > > > > > > > > *From:* Jones, Andy > *Sent:* 27 June 2008 14:54 > *To:* 'David Creasy' > *Subject:* RE: [Psidev-pi-dev] Representing Sequences > > > > id and name are standard for all elements that inherit from FuGE > identifiable – this is perhaps a separate discussion as to whether the > optional name attribute should be there. > > > > I agree that length may be useful – is this just an integer value with no > unit? > > Yes, I think so. > > I'm less sure about pI and mass since mass at least can be calculated > very simply > > Only if you have the sequence... (we have residue masses in the file). > > > > > > , and pI values (in my opinion) are pretty inaccurate and fairly > meaningless > > Scandalous! (I happen to agree, but now some people will never speak to > either of us ever again). > > The main problem with mass and pI is that these are 'irrelevant' if the > sequence is nuleic acid rather than residues. > Why not just allow CV there? We can share the same CV as the PEFF format, > which includes, taxonomy, sequence type, gene ID, and lots of wonderful > other things? > > > > – unless someone can convince me otherwise? > > Cheers > > Andy > > > > > > *From:* David Creasy [mailto:dc...@ma...<dc...@ma...>] > > *Sent:* 27 June 2008 14:51 > *To:* Jones, Andy > *Cc:* psi...@li... > *Subject:* Re: [Psidev-pi-dev] Representing Sequences > > > > Hi Andy, > > length may be useful, because some people won't want to output the actual > sequence for space reasons. The other things we wanted to add before were pI > and mass. > Why do we want name? Is this for, say, a description line? > (Also, identifier -> id?) > > David > > Jones, Andy wrote: > > Hi all, > > > > It was decided on the call that we would like to flag that Sequences in the > ConceptualMoleculeCollection should have a Boolean attribute to capture if > they are decoy sequences. At the moment we are using the FuGE:Sequence > element. I don't really want to add another attribute to this (it's less > problematic cutting down FuGE than adding new things), so I'm wondering if > we should define our own Sequence type in AnalysisXML. This would also allow > us to choose exactly the relevant attributes. At the moment, Sequence can > have all of the following: > > > > <pf:Sequence isCircular="true" sequence="String"length > ="0" isApproximateLength="true" SequenceAnnotationSet_ref="String" start=" > 0" end="0" identifier="String" name="String"> > > > > Several of these attributes were created to represent concepts that > probably will never be required or implemented in AnalysisXML. How about the > following: > > > > <DBSequence identifier = "" name = "" isDecoy = "true"> > > <seq>MCTMG...</seq> > > <pf:DatabaseReference Database_ref="" accession="Rev_ > IPI00013808.1"/> > > </DBSequence> > > > > Are any of the other attributes on Sequence actually required? I'll post a > new version of the schema with other changes WRT to PeptideEvidence shortly, > > Cheers > > Andy > > > > > > > > > > > > > > > > > > > > ------------------------------ > > > > > > > > > > > > > > > ------------------------------------------------------------------------- > > Check out the new SourceForge.net Marketplace. > > It's the best place to buy or sell services for > > just about anything Open Source. > > http://sourceforge.net/services/buy/index.php > > > > > > > > > > ------------------------------ > > > > > > > > > > > > > > > _______________________________________________ > > Psidev-pi-dev mailing list > > Psi...@li... > > https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev > > > > > > -- > > David Creasy > > Matrix Science > > 64 Baker Street > > London W1U 7GB, UK > > Tel: +44 (0)20 7486 1050 > > Fax: +44 (0)20 7224 1344 > > > > dc...@ma... > > http://www.matrixscience.com > > > > Matrix Science Ltd. is registered in England and Wales > > Company number 3533898 > > > > ------------------------------ > > > > > ------------------------------------------------------------------------- > > Check out the new SourceForge.net Marketplace. > > It's the best place to buy or sell services for > > just about anything Open Source. > > http://sourceforge.net/services/buy/index.php > > > > ------------------------------ > > > > > > _______________________________________________ > > Psidev-pi-dev mailing list > > Psi...@li... > > https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev > > > > > > -- > > David Creasy > > Matrix Science > > 64 Baker Street > > London W1U 7GB, UK > > Tel: +44 (0)20 7486 1050 > > Fax: +44 (0)20 7224 1344 > > > > dc...@ma... > > http://www.matrixscience.com > > > > Matrix Science Ltd. is registered in England and Wales > > Company number 3533898 > > > ------------------------------------------------------------------------- > Check out the new SourceForge.net Marketplace. > It's the best place to buy or sell services for > just about anything Open Source. > http://sourceforge.net/services/buy/index.php > _______________________________________________ > Psidev-pi-dev mailing list > Psi...@li... > https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev > > -- Angel Pizarro Director, ITMAT Bioinformatics Facility 806 Biological Research Building 421 Curie Blvd. Philadelphia, PA 19104-6160 215-573-3736 |
|
From: David C. <dc...@ma...> - 2008-06-27 14:45:50
|
<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN">
<html>
<head>
<meta content="text/html;charset=windows-1252"
http-equiv="Content-Type">
<title></title>
</head>
<body bgcolor="#ffffff" text="#000000">
OK by me.<br>
<br>
Jones, Andy wrote:
<blockquote
cite="mid:08D...@EV..."
type="cite">
<meta http-equiv="Content-Type" content="text/html; ">
<meta name="Generator" content="Microsoft Word 12 (filtered medium)">
<!--[if !mso]>
<style>
v\:* {behavior:url(#default#VML);}
o\:* {behavior:url(#default#VML);}
w\:* {behavior:url(#default#VML);}
.shape {behavior:url(#default#VML);}
</style>
<![endif]-->
<style>
<!--
/* Font Definitions */
@font-face
{font-family:Calibri;
panose-1:2 15 5 2 2 2 4 3 2 4;}
@font-face
{font-family:Tahoma;
panose-1:2 11 6 4 3 5 4 4 2 4;}
@font-face
{font-family:Consolas;
panose-1:2 11 6 9 2 2 4 3 2 4;}
/* Style Definitions */
p.MsoNormal, li.MsoNormal, div.MsoNormal
{margin:0cm;
margin-bottom:.0001pt;
font-size:11.0pt;
font-family:"Calibri","sans-serif";
color:black;}
a:link, span.MsoHyperlink
{mso-style-priority:99;
color:blue;
text-decoration:underline;}
a:visited, span.MsoHyperlinkFollowed
{mso-style-priority:99;
color:purple;
text-decoration:underline;}
pre
{mso-style-priority:99;
mso-style-link:"HTML Preformatted Char";
margin:0cm;
margin-bottom:.0001pt;
font-size:10.0pt;
font-family:"Courier New";
color:black;}
span.HTMLPreformattedChar
{mso-style-name:"HTML Preformatted Char";
mso-style-priority:99;
mso-style-link:"HTML Preformatted";
font-family:Consolas;
color:black;}
span.EmailStyle19
{mso-style-type:personal;
font-family:"Calibri","sans-serif";
color:windowtext;}
span.EmailStyle20
{mso-style-type:personal;
font-family:"Calibri","sans-serif";
color:#1F497D;}
span.EmailStyle21
{mso-style-type:personal;
font-family:"Calibri","sans-serif";
color:#1F497D;}
span.EmailStyle22
{mso-style-type:personal-reply;
font-family:"Calibri","sans-serif";
color:#1F497D;}
.MsoChpDefault
{mso-style-type:export-only;
font-size:10.0pt;}
@page Section1
{size:612.0pt 792.0pt;
margin:72.0pt 72.0pt 72.0pt 72.0pt;}
div.Section1
{page:Section1;}
-->
</style><!--[if gte mso 9]><xml>
<o:shapedefaults v:ext="edit" spidmax="1026" />
</xml><![endif]--><!--[if gte mso 9]><xml>
<o:shapelayout v:ext="edit">
<o:idmap v:ext="edit" data="1" />
</o:shapelayout></xml><![endif]-->
<div class="Section1">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">So how
about include length as
an attribute and then let all other things go in the CV (pI, mass,
etc.)?<o:p></o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"><o:p> </o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"><o:p> </o:p></span></p>
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"> </span><o:p></o:p></p>
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<div>
<div
style="border-style: solid none none; border-color: -moz-use-text-color; border-width: 1pt medium medium; padding: 3pt 0cm 0cm;">
<p class="MsoNormal"><b><span
style="font-size: 10pt; font-family: "Tahoma","sans-serif"; color: windowtext;"
lang="EN-US">From:</span></b><span
style="font-size: 10pt; font-family: "Tahoma","sans-serif"; color: windowtext;"
lang="EN-US">
Jones, Andy <br>
<b>Sent:</b> 27 June 2008 14:54<br>
<b>To:</b> 'David Creasy'<br>
<b>Subject:</b> RE: [Psidev-pi-dev] Representing Sequences</span><o:p></o:p></p>
</div>
</div>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">id and
name are standard for all
elements that inherit from FuGE identifiable – this is perhaps a
separate
discussion as to whether the optional name attribute should be there.</span><o:p></o:p></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"> </span><o:p></o:p></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">I agree
that length may be
useful – is this just an integer value with no unit? </span><o:p></o:p></p>
</div>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif";">Yes,
I think so.<br>
<br>
<o:p></o:p></span></p>
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">I’m less
sure about pI and mass
since mass at least can be calculated very simply</span><o:p></o:p></p>
</div>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif";">Only
if you have the sequence... (we have residue masses in the file).</span><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: rgb(31, 73, 125);"><o:p></o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"><o:p> </o:p></span></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif";"><o:p> </o:p></span></p>
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">, and pI
values (in my opinion)
are pretty inaccurate and fairly meaningless </span><o:p></o:p></p>
</div>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif";">Scandalous!
(I happen to agree, but now some people will never speak to either of
us ever
again).<br>
<br>
The main problem with mass and pI is that these are 'irrelevant' if the
sequence is nuleic acid rather than residues.<br>
Why not just allow CV there? We can share the same CV as the PEFF
format, which
includes, taxonomy, sequence type, gene ID, and lots of wonderful other
things?<br>
<br>
<br>
<br>
<o:p></o:p></span></p>
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">– unless
someone can convince me
otherwise?</span><o:p></o:p></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">Cheers</span><o:p></o:p></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">Andy</span><o:p></o:p></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"> </span><o:p></o:p></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"> </span><o:p></o:p></p>
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<div>
<div
style="border-style: solid none none; border-color: -moz-use-text-color; border-width: 1pt medium medium; padding: 3pt 0cm 0cm;">
<p class="MsoNormal"><b><span
style="font-size: 10pt; font-family: "Tahoma","sans-serif"; color: windowtext;"
lang="EN-US">From:</span></b><span
style="font-size: 10pt; font-family: "Tahoma","sans-serif"; color: windowtext;"
lang="EN-US">
David Creasy [<a moz-do-not-send="true"
href="mailto:dc...@ma...">mailto:dc...@ma...</a>]
<br>
<b>Sent:</b> 27 June 2008 14:51<br>
<b>To:</b> Jones, Andy<br>
<b>Cc:</b> <a moz-do-not-send="true"
href="mailto:psi...@li...">psi...@li...</a><br>
<b>Subject:</b> Re: [Psidev-pi-dev] Representing Sequences</span><o:p></o:p></p>
</div>
</div>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal">Hi Andy,<br>
<br>
length may be useful, because some people won't want to output the
actual
sequence for space reasons. The other things we wanted to add before
were pI
and mass. <br>
Why do we want name? Is this for, say, a description line?<br>
(Also, identifier -> id?)<br>
<br>
David<br>
<br>
Jones, Andy wrote: <o:p></o:p></p>
<p class="MsoNormal">Hi all,<o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal">It was decided on the call that we would like to
flag that
Sequences in the ConceptualMoleculeCollection should have a Boolean
attribute
to capture if they are decoy sequences. At the moment we are using the
FuGE:Sequence element. I don’t really want to add another attribute to
this (it’s
less problematic cutting down FuGE than adding new things), so I’m
wondering if
we should define our own Sequence type in AnalysisXML. This would also
allow us
to choose exactly the relevant attributes. At the moment, Sequence can
have all
of the following:<o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: maroon; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">pf:Sequence</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
isCircular</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">true</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
sequence</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
length</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
isApproximateLength</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">true</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
SequenceAnnotationSet_ref</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
start</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
end</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
identifier</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
name</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"></span><o:p></o:p></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"> </span><o:p></o:p></p>
<p class="MsoNormal">Several of these attributes were created to
represent
concepts that probably will never be required or implemented in
AnalysisXML.
How about the following:<o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"><DBSequence identifier = “” name = “” isDecoy
= “true”><o:p></o:p></p>
<p class="MsoNormal">
<seq>MCTMG...</seq><o:p></o:p></p>
<p class="MsoNormal">
<span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: maroon; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">pf:DatabaseReference</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
Database_ref</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">=""</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
accession</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="Rev_</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">IPI00013808.1</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"/></span><o:p></o:p></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"></DBSequence></span><o:p></o:p></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"> </span><o:p></o:p></p>
<p class="MsoNormal">Are any of the other attributes on Sequence
actually
required? I’ll post a new version of the schema with other changes WRT
to
PeptideEvidence shortly,<o:p></o:p></p>
<p class="MsoNormal">Cheers<o:p></o:p></p>
<p class="MsoNormal">Andy<o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<pre> <o:p></o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;">
<hr align="center" size="4" width="90%">
</pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre> <o:p></o:p></pre>
<pre>-------------------------------------------------------------------------<o:p></o:p></pre>
<pre>Check out the new SourceForge.net Marketplace.<o:p></o:p></pre>
<pre>It's the best place to buy or sell services for<o:p></o:p></pre>
<pre>just about anything Open Source.<o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="http://sourceforge.net/services/buy/index.php">http://sourceforge.net/services/buy/index.php</a><o:p></o:p></pre>
<pre> <o:p></o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;">
<hr align="center" size="4" width="90%">
</pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre style="text-align: center;"> <o:p></o:p></pre>
<pre> <o:p></o:p></pre>
<pre>_______________________________________________<o:p></o:p></pre>
<pre>Psidev-pi-dev mailing list<o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="mailto:Psi...@li...">Psi...@li...</a><o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev">https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev</a><o:p></o:p></pre>
<pre> <o:p></o:p></pre>
<p class="MsoNormal" style="margin-bottom: 12pt;"><span
style="font-size: 12pt; font-family: "Times New Roman","serif";"> </span><o:p></o:p></p>
<pre>-- <o:p></o:p></pre>
<pre>David Creasy<o:p></o:p></pre>
<pre>Matrix Science<o:p></o:p></pre>
<pre>64 Baker Street<o:p></o:p></pre>
<pre>London W1U 7GB, UK<o:p></o:p></pre>
<pre>Tel: +44 (0)20 7486 1050<o:p></o:p></pre>
<pre>Fax: +44 (0)20 7224 1344<o:p></o:p></pre>
<pre> <o:p></o:p></pre>
<pre><a moz-do-not-send="true" href="mailto:dc...@ma...">dc...@ma...</a><o:p></o:p></pre>
<pre><a moz-do-not-send="true" href="http://www.matrixscience.com">http://www.matrixscience.com</a><o:p></o:p></pre>
<pre> <o:p></o:p></pre>
<pre>Matrix Science Ltd. is registered in England and Wales<o:p></o:p></pre>
<pre>Company number 3533898<o:p></o:p></pre>
</div>
</div>
<pre><o:p> </o:p></pre>
<pre style="text-align: center;">
<hr align="center" size="4" width="90%">
</pre>
<pre><o:p> </o:p></pre>
<pre>-------------------------------------------------------------------------<o:p></o:p></pre>
<pre>Check out the new SourceForge.net Marketplace.<o:p></o:p></pre>
<pre>It's the best place to buy or sell services for<o:p></o:p></pre>
<pre>just about anything Open Source.<o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="http://sourceforge.net/services/buy/index.php">http://sourceforge.net/services/buy/index.php</a><o:p></o:p></pre>
<pre><o:p> </o:p></pre>
<pre style="text-align: center;">
<hr align="center" size="4" width="90%">
</pre>
<pre><o:p> </o:p></pre>
<pre>_______________________________________________<o:p></o:p></pre>
<pre>Psidev-pi-dev mailing list<o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="mailto:Psi...@li...">Psi...@li...</a><o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev">https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev</a><o:p></o:p></pre>
<pre> <o:p></o:p></pre>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif";"><br>
<br>
<o:p></o:p></span></p>
<pre>-- <o:p></o:p></pre>
<pre>David Creasy<o:p></o:p></pre>
<pre>Matrix Science<o:p></o:p></pre>
<pre>64 Baker Street<o:p></o:p></pre>
<pre>London W1U 7GB, UK<o:p></o:p></pre>
<pre>Tel: +44 (0)20 7486 1050<o:p></o:p></pre>
<pre>Fax: +44 (0)20 7224 1344<o:p></o:p></pre>
<pre><o:p> </o:p></pre>
<pre><a moz-do-not-send="true" href="mailto:dc...@ma...">dc...@ma...</a><o:p></o:p></pre>
<pre><a moz-do-not-send="true" href="http://www.matrixscience.com">http://www.matrixscience.com</a><o:p></o:p></pre>
<pre><o:p> </o:p></pre>
<pre>Matrix Science Ltd. is registered in England and Wales<o:p></o:p></pre>
<pre>Company number 3533898<o:p></o:p></pre>
</div>
</div>
<pre wrap="">
<hr size="4" width="90%">
-------------------------------------------------------------------------
Check out the new SourceForge.net Marketplace.
It's the best place to buy or sell services for
just about anything Open Source.
<a class="moz-txt-link-freetext" href="http://sourceforge.net/services/buy/index.php">http://sourceforge.net/services/buy/index.php</a></pre>
<pre wrap="">
<hr size="4" width="90%">
_______________________________________________
Psidev-pi-dev mailing list
<a class="moz-txt-link-abbreviated" href="mailto:Psi...@li...">Psi...@li...</a>
<a class="moz-txt-link-freetext" href="https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev">https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev</a>
</pre>
</blockquote>
<br>
<pre class="moz-signature" cols="72">--
David Creasy
Matrix Science
64 Baker Street
London W1U 7GB, UK
Tel: +44 (0)20 7486 1050
Fax: +44 (0)20 7224 1344
<a class="moz-txt-link-abbreviated" href="mailto:dc...@ma...">dc...@ma...</a>
<a class="moz-txt-link-freetext" href="http://www.matrixscience.com">http://www.matrixscience.com</a>
Matrix Science Ltd. is registered in England and Wales
Company number 3533898</pre>
</body>
</html>
|
|
From: Jones, A. <And...@li...> - 2008-06-27 14:21:41
|
So how about include length as an attribute and then let all other things go in the CV (pI, mass, etc.)?
From: Jones, Andy
Sent: 27 June 2008 14:54
To: 'David Creasy'
Subject: RE: [Psidev-pi-dev] Representing Sequences
id and name are standard for all elements that inherit from FuGE identifiable – this is perhaps a separate discussion as to whether the optional name attribute should be there.
I agree that length may be useful – is this just an integer value with no unit?
Yes, I think so.
I’m less sure about pI and mass since mass at least can be calculated very simply
Only if you have the sequence... (we have residue masses in the file).
, and pI values (in my opinion) are pretty inaccurate and fairly meaningless
Scandalous! (I happen to agree, but now some people will never speak to either of us ever again).
The main problem with mass and pI is that these are 'irrelevant' if the sequence is nuleic acid rather than residues.
Why not just allow CV there? We can share the same CV as the PEFF format, which includes, taxonomy, sequence type, gene ID, and lots of wonderful other things?
– unless someone can convince me otherwise?
Cheers
Andy
From: David Creasy [mailto:dc...@ma...]
Sent: 27 June 2008 14:51
To: Jones, Andy
Cc: psi...@li...
Subject: Re: [Psidev-pi-dev] Representing Sequences
Hi Andy,
length may be useful, because some people won't want to output the actual sequence for space reasons. The other things we wanted to add before were pI and mass.
Why do we want name? Is this for, say, a description line?
(Also, identifier -> id?)
David
Jones, Andy wrote:
Hi all,
It was decided on the call that we would like to flag that Sequences in the ConceptualMoleculeCollection should have a Boolean attribute to capture if they are decoy sequences. At the moment we are using the FuGE:Sequence element. I don’t really want to add another attribute to this (it’s less problematic cutting down FuGE than adding new things), so I’m wondering if we should define our own Sequence type in AnalysisXML. This would also allow us to choose exactly the relevant attributes. At the moment, Sequence can have all of the following:
<pf:Sequence isCircular="true" sequence="String" length="0" isApproximateLength="true" SequenceAnnotationSet_ref="String" start="0" end="0" identifier="String" name="String">
Several of these attributes were created to represent concepts that probably will never be required or implemented in AnalysisXML. How about the following:
<DBSequence identifier = “” name = “” isDecoy = “true”>
<seq>MCTMG...</seq>
<pf:DatabaseReference Database_ref="" accession="Rev_IPI00013808.1"/>
</DBSequence>
Are any of the other attributes on Sequence actually required? I’ll post a new version of the schema with other changes WRT to PeptideEvidence shortly,
Cheers
Andy
________________________________
-------------------------------------------------------------------------
Check out the new SourceForge.net Marketplace.
It's the best place to buy or sell services for
just about anything Open Source.
http://sourceforge.net/services/buy/index.php
________________________________
_______________________________________________
Psidev-pi-dev mailing list
Psi...@li...
https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev
--
David Creasy
Matrix Science
64 Baker Street
London W1U 7GB, UK
Tel: +44 (0)20 7486 1050
Fax: +44 (0)20 7224 1344
dc...@ma...
http://www.matrixscience.com
Matrix Science Ltd. is registered in England and Wales
Company number 3533898
________________________________
-------------------------------------------------------------------------
Check out the new SourceForge.net Marketplace.
It's the best place to buy or sell services for
just about anything Open Source.
http://sourceforge.net/services/buy/index.php
________________________________
_______________________________________________
Psidev-pi-dev mailing list
Psi...@li...
https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev
--
David Creasy
Matrix Science
64 Baker Street
London W1U 7GB, UK
Tel: +44 (0)20 7486 1050
Fax: +44 (0)20 7224 1344
dc...@ma...
http://www.matrixscience.com
Matrix Science Ltd. is registered in England and Wales
Company number 3533898
|
|
From: David C. <dc...@ma...> - 2008-06-27 14:12:26
|
<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN">
<html>
<head>
<meta content="text/html;charset=windows-1252"
http-equiv="Content-Type">
</head>
<body bgcolor="#ffffff" text="#000000">
<br>
Jones, Andy wrote:
<blockquote
cite="mid:08D...@EV..."
type="cite">
<meta http-equiv="Content-Type" content="text/html; ">
<meta name="Generator" content="Microsoft Word 12 (filtered medium)">
<!--[if !mso]>
<style>
v\:* {behavior:url(#default#VML);}
o\:* {behavior:url(#default#VML);}
w\:* {behavior:url(#default#VML);}
.shape {behavior:url(#default#VML);}
</style>
<![endif]-->
<style>
<!--
/* Font Definitions */
@font-face
{font-family:Calibri;
panose-1:2 15 5 2 2 2 4 3 2 4;}
@font-face
{font-family:Tahoma;
panose-1:2 11 6 4 3 5 4 4 2 4;}
@font-face
{font-family:Consolas;
panose-1:2 11 6 9 2 2 4 3 2 4;}
/* Style Definitions */
p.MsoNormal, li.MsoNormal, div.MsoNormal
{margin:0cm;
margin-bottom:.0001pt;
font-size:11.0pt;
font-family:"Calibri","sans-serif";
color:black;}
a:link, span.MsoHyperlink
{mso-style-priority:99;
color:blue;
text-decoration:underline;}
a:visited, span.MsoHyperlinkFollowed
{mso-style-priority:99;
color:purple;
text-decoration:underline;}
pre
{mso-style-priority:99;
mso-style-link:"HTML Preformatted Char";
margin:0cm;
margin-bottom:.0001pt;
font-size:10.0pt;
font-family:"Courier New";
color:black;}
span.HTMLPreformattedChar
{mso-style-name:"HTML Preformatted Char";
mso-style-priority:99;
mso-style-link:"HTML Preformatted";
font-family:Consolas;
color:black;}
span.EmailStyle19
{mso-style-type:personal;
font-family:"Calibri","sans-serif";
color:windowtext;}
span.EmailStyle20
{mso-style-type:personal;
font-family:"Calibri","sans-serif";
color:#1F497D;}
span.EmailStyle21
{mso-style-type:personal-reply;
font-family:"Calibri","sans-serif";
color:#1F497D;}
.MsoChpDefault
{mso-style-type:export-only;
font-size:10.0pt;}
@page Section1
{size:612.0pt 792.0pt;
margin:72.0pt 72.0pt 72.0pt 72.0pt;}
div.Section1
{page:Section1;}
-->
</style><!--[if gte mso 9]><xml>
<o:shapedefaults v:ext="edit" spidmax="1026" />
</xml><![endif]--><!--[if gte mso 9]><xml>
<o:shapelayout v:ext="edit">
<o:idmap v:ext="edit" data="1" />
</o:shapelayout></xml><![endif]-->
<div class="Section1">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">Sorry
meant to send to the list<o:p></o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"><o:p> </o:p></span></p>
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<div>
<div
style="border-style: solid none none; border-color: rgb(181, 196, 223) -moz-use-text-color -moz-use-text-color; border-width: 1pt medium medium; padding: 3pt 0cm 0cm;">
<p class="MsoNormal"><b><span
style="font-size: 10pt; font-family: "Tahoma","sans-serif"; color: windowtext;"
lang="EN-US">From:</span></b><span
style="font-size: 10pt; font-family: "Tahoma","sans-serif"; color: windowtext;"
lang="EN-US">
Jones, Andy <br>
<b>Sent:</b> 27 June 2008 14:54<br>
<b>To:</b> 'David Creasy'<br>
<b>Subject:</b> RE: [Psidev-pi-dev] Representing Sequences<o:p></o:p></span></p>
</div>
</div>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">id and
name are standard for all
elements that inherit from FuGE identifiable – this is perhaps a
separate
discussion as to whether the optional name attribute should be there.<o:p></o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"><o:p> </o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">I agree
that length may be
useful – is this just an integer value with no unit? </span></p>
</div>
</div>
</blockquote>
Yes, I think so.<br>
<blockquote
cite="mid:08D...@EV..."
type="cite">
<div class="Section1">
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">I’m less
sure about pI and
mass since mass at least can be calculated very simply</span></p>
</div>
</div>
</blockquote>
Only if you have the sequence... (we have residue masses in the file).<br>
<blockquote
cite="mid:08D...@EV..."
type="cite">
<div class="Section1">
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">, and pI
values (in my
opinion) are pretty inaccurate and fairly meaningless </span></p>
</div>
</div>
</blockquote>
Scandalous! (I happen to agree, but now some people will never speak to
either of us ever again).<br>
<br>
The main problem with mass and pI is that these are 'irrelevant' if the
sequence is nuleic acid rather than residues.<br>
Why not just allow CV there? We can share the same CV as the PEFF
format, which includes, taxonomy, sequence type, gene ID, and lots of
wonderful other things?<br>
<br>
<br>
<blockquote
cite="mid:08D...@EV..."
type="cite">
<div class="Section1">
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">– unless
someone can
convince me otherwise?<o:p></o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">Cheers<o:p></o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);">Andy<o:p></o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"><o:p> </o:p></span></p>
<p class="MsoNormal"><span style="color: rgb(31, 73, 125);"><o:p> </o:p></span></p>
<div
style="border-style: none none none solid; border-color: -moz-use-text-color -moz-use-text-color -moz-use-text-color blue; border-width: medium medium medium 1.5pt; padding: 0cm 0cm 0cm 4pt;">
<div>
<div
style="border-style: solid none none; border-color: rgb(181, 196, 223) -moz-use-text-color -moz-use-text-color; border-width: 1pt medium medium; padding: 3pt 0cm 0cm;">
<p class="MsoNormal"><b><span
style="font-size: 10pt; font-family: "Tahoma","sans-serif"; color: windowtext;"
lang="EN-US">From:</span></b><span
style="font-size: 10pt; font-family: "Tahoma","sans-serif"; color: windowtext;"
lang="EN-US">
David Creasy [<a class="moz-txt-link-freetext" href="mailto:dc...@ma...">mailto:dc...@ma...</a>] <br>
<b>Sent:</b> 27 June 2008 14:51<br>
<b>To:</b> Jones, Andy<br>
<b>Cc:</b> <a class="moz-txt-link-abbreviated" href="mailto:psi...@li...">psi...@li...</a><br>
<b>Subject:</b> Re: [Psidev-pi-dev] Representing Sequences<o:p></o:p></span></p>
</div>
</div>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal">Hi Andy,<br>
<br>
length may be useful, because some people won't want to output the
actual
sequence for space reasons. The other things we wanted to add before
were pI
and mass. <br>
Why do we want name? Is this for, say, a description line?<br>
(Also, identifier -> id?)<br>
<br>
David<br>
<br>
Jones, Andy wrote: <o:p></o:p></p>
<p class="MsoNormal">Hi all,<o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal">It was decided on the call that we would like to
flag that
Sequences in the ConceptualMoleculeCollection should have a Boolean
attribute
to capture if they are decoy sequences. At the moment we are using the
FuGE:Sequence element. I don’t really want to add another attribute to
this
(it’s less problematic cutting down FuGE than adding new things), so
I’m
wondering if we should define our own Sequence type in AnalysisXML.
This would
also allow us to choose exactly the relevant attributes. At the moment,
Sequence can have all of the following:<o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: maroon; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">pf:Sequence</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
isCircular</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">true</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
sequence</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
length</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
isApproximateLength</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">true</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
SequenceAnnotationSet_ref</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
start</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
end</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
identifier</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
name</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"></span><o:p></o:p></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"> </span><o:p></o:p></p>
<p class="MsoNormal">Several of these attributes were created to
represent
concepts that probably will never be required or implemented in
AnalysisXML.
How about the following:<o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"><DBSequence identifier = “” name = “” isDecoy
=
“true”><o:p></o:p></p>
<p class="MsoNormal">
<seq>MCTMG...</seq><o:p></o:p></p>
<p class="MsoNormal">
<span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: maroon; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">pf:DatabaseReference</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
Database_ref</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">=""</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
accession</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="Rev_</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">IPI00013808.1</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"/></span><o:p></o:p></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"></DBSequence></span><o:p></o:p></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"> </span><o:p></o:p></p>
<p class="MsoNormal">Are any of the other attributes on Sequence
actually
required? I’ll post a new version of the schema with other changes WRT
to
PeptideEvidence shortly,<o:p></o:p></p>
<p class="MsoNormal">Cheers<o:p></o:p></p>
<p class="MsoNormal">Andy<o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<p class="MsoNormal"> <o:p></o:p></p>
<pre><o:p> </o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;">
<hr align="center" size="4" width="90%">
</pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre><o:p> </o:p></pre>
<pre>-------------------------------------------------------------------------<o:p></o:p></pre>
<pre>Check out the new SourceForge.net Marketplace.<o:p></o:p></pre>
<pre>It's the best place to buy or sell services for<o:p></o:p></pre>
<pre>just about anything Open Source.<o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="http://sourceforge.net/services/buy/index.php">http://sourceforge.net/services/buy/index.php</a><o:p></o:p></pre>
<pre><o:p> </o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;">
<hr align="center" size="4" width="90%">
</pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre style="text-align: center;"><o:p> </o:p></pre>
<pre><o:p> </o:p></pre>
<pre>_______________________________________________<o:p></o:p></pre>
<pre>Psidev-pi-dev mailing list<o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="mailto:Psi...@li...">Psi...@li...</a><o:p></o:p></pre>
<pre><a moz-do-not-send="true"
href="https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev">https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev</a><o:p></o:p></pre>
<pre> <o:p></o:p></pre>
<p class="MsoNormal" style="margin-bottom: 12pt;"><span
style="font-size: 12pt; font-family: "Times New Roman","serif";"><o:p> </o:p></span></p>
<pre>-- <o:p></o:p></pre>
<pre>David Creasy<o:p></o:p></pre>
<pre>Matrix Science<o:p></o:p></pre>
<pre>64 Baker Street<o:p></o:p></pre>
<pre>London W1U 7GB, UK<o:p></o:p></pre>
<pre>Tel: +44 (0)20 7486 1050<o:p></o:p></pre>
<pre>Fax: +44 (0)20 7224 1344<o:p></o:p></pre>
<pre><o:p> </o:p></pre>
<pre><a moz-do-not-send="true" href="mailto:dc...@ma...">dc...@ma...</a><o:p></o:p></pre>
<pre><a moz-do-not-send="true" href="http://www.matrixscience.com">http://www.matrixscience.com</a><o:p></o:p></pre>
<pre><o:p> </o:p></pre>
<pre>Matrix Science Ltd. is registered in England and Wales<o:p></o:p></pre>
<pre>Company number 3533898<o:p></o:p></pre>
</div>
</div>
</div>
<pre wrap="">
<hr size="4" width="90%">
-------------------------------------------------------------------------
Check out the new SourceForge.net Marketplace.
It's the best place to buy or sell services for
just about anything Open Source.
<a class="moz-txt-link-freetext" href="http://sourceforge.net/services/buy/index.php">http://sourceforge.net/services/buy/index.php</a></pre>
<pre wrap="">
<hr size="4" width="90%">
_______________________________________________
Psidev-pi-dev mailing list
<a class="moz-txt-link-abbreviated" href="mailto:Psi...@li...">Psi...@li...</a>
<a class="moz-txt-link-freetext" href="https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev">https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev</a>
</pre>
</blockquote>
<br>
<pre class="moz-signature" cols="72">--
David Creasy
Matrix Science
64 Baker Street
London W1U 7GB, UK
Tel: +44 (0)20 7486 1050
Fax: +44 (0)20 7224 1344
<a class="moz-txt-link-abbreviated" href="mailto:dc...@ma...">dc...@ma...</a>
<a class="moz-txt-link-freetext" href="http://www.matrixscience.com">http://www.matrixscience.com</a>
Matrix Science Ltd. is registered in England and Wales
Company number 3533898</pre>
</body>
</html>
|
|
From: Phil J. @ E. <pj...@eb...> - 2008-06-27 13:58:09
|
Hi, The suggested solution looks good. The main issue will be the need for some very clear and accessible documentation of how to use the format in this context. I know this is self evident, however the identification of proteins is particularly prone to misuse. For example, for a UniProt protein entry there is: a protein accession (e.g. Q12345) ... which may have a version number (e.g. Q12345.1) ... and / or a splice variant number (e.g. Q12345-1 a protein ID (e.g. A4_HUMAN) a human-readable description line. So it needs to be clear, probably with examples for all the major protein sequence databases, how this should be encoded using the suggested format. The 'name' attribute is potentially most open to abuse, as this could reasonably be interpreted as being either the protein ID or the description line (in the UniProt example). best regards, Phil. 2008/6/27 Jones, Andy <And...@li...>: > Hi all, > > > > It was decided on the call that we would like to flag that Sequences in the > ConceptualMoleculeCollection should have a Boolean attribute to capture if > they are decoy sequences. At the moment we are using the FuGE:Sequence > element. I don't really want to add another attribute to this (it's less > problematic cutting down FuGE than adding new things), so I'm wondering if > we should define our own Sequence type in AnalysisXML. This would also allow > us to choose exactly the relevant attributes. At the moment, Sequence can > have all of the following: > > > > <pf:Sequence isCircular="true" sequence="String"length > ="0" isApproximateLength="true" SequenceAnnotationSet_ref="String" start=" > 0" end="0" identifier="String" name="String"> > > > > Several of these attributes were created to represent concepts that > probably will never be required or implemented in AnalysisXML. How about the > following: > > > > <DBSequence identifier = "" name = "" isDecoy = "true"> > > <seq>MCTMG...</seq> > > <pf:DatabaseReference Database_ref="" accession="Rev_ > IPI00013808.1"/> > > </DBSequence> > > > > Are any of the other attributes on Sequence actually required? I'll post a > new version of the schema with other changes WRT to PeptideEvidence shortly, > > Cheers > > Andy > > > > > > > > > > > > ------------------------------------------------------------------------- > Check out the new SourceForge.net Marketplace. > It's the best place to buy or sell services for > just about anything Open Source. > http://sourceforge.net/services/buy/index.php > _______________________________________________ > Psidev-pi-dev mailing list > Psi...@li... > https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev > > -- Phil Jones Senior Software Engineer PRIDE Project Team PANDA Group, EMBL-EBI Wellcome Trust Genome Campus Hinxton, Cambridge, CB10 1SD UK. Work phone: +44 1223 492610 Skype: philip-jones |
|
From: Jones, A. <And...@li...> - 2008-06-27 13:54:43
|
Sorry meant to send to the list
From: Jones, Andy
Sent: 27 June 2008 14:54
To: 'David Creasy'
Subject: RE: [Psidev-pi-dev] Representing Sequences
id and name are standard for all elements that inherit from FuGE identifiable – this is perhaps a separate discussion as to whether the optional name attribute should be there.
I agree that length may be useful – is this just an integer value with no unit? I’m less sure about pI and mass since mass at least can be calculated very simply, and pI values (in my opinion) are pretty inaccurate and fairly meaningless – unless someone can convince me otherwise?
Cheers
Andy
From: David Creasy [mailto:dc...@ma...]
Sent: 27 June 2008 14:51
To: Jones, Andy
Cc: psi...@li...
Subject: Re: [Psidev-pi-dev] Representing Sequences
Hi Andy,
length may be useful, because some people won't want to output the actual sequence for space reasons. The other things we wanted to add before were pI and mass.
Why do we want name? Is this for, say, a description line?
(Also, identifier -> id?)
David
Jones, Andy wrote:
Hi all,
It was decided on the call that we would like to flag that Sequences in the ConceptualMoleculeCollection should have a Boolean attribute to capture if they are decoy sequences. At the moment we are using the FuGE:Sequence element. I don’t really want to add another attribute to this (it’s less problematic cutting down FuGE than adding new things), so I’m wondering if we should define our own Sequence type in AnalysisXML. This would also allow us to choose exactly the relevant attributes. At the moment, Sequence can have all of the following:
<pf:Sequence isCircular="true" sequence="String" length="0" isApproximateLength="true" SequenceAnnotationSet_ref="String" start="0" end="0" identifier="String" name="String">
Several of these attributes were created to represent concepts that probably will never be required or implemented in AnalysisXML. How about the following:
<DBSequence identifier = “” name = “” isDecoy = “true”>
<seq>MCTMG...</seq>
<pf:DatabaseReference Database_ref="" accession="Rev_IPI00013808.1"/>
</DBSequence>
Are any of the other attributes on Sequence actually required? I’ll post a new version of the schema with other changes WRT to PeptideEvidence shortly,
Cheers
Andy
________________________________
-------------------------------------------------------------------------
Check out the new SourceForge.net Marketplace.
It's the best place to buy or sell services for
just about anything Open Source.
http://sourceforge.net/services/buy/index.php
________________________________
_______________________________________________
Psidev-pi-dev mailing list
Psi...@li...
https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev
--
David Creasy
Matrix Science
64 Baker Street
London W1U 7GB, UK
Tel: +44 (0)20 7486 1050
Fax: +44 (0)20 7224 1344
dc...@ma...
http://www.matrixscience.com
Matrix Science Ltd. is registered in England and Wales
Company number 3533898
|
|
From: David C. <dc...@ma...> - 2008-06-27 13:50:41
|
<!DOCTYPE html PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN">
<html>
<head>
<meta content="text/html;charset=ISO-8859-1" http-equiv="Content-Type">
<title></title>
</head>
<body bgcolor="#ffffff" text="#000000">
Hi Andy,<br>
<br>
length may be useful, because some people won't want to output the
actual sequence for space reasons. The other things we wanted to add
before were pI and mass. <br>
Why do we want name? Is this for, say, a description line?<br>
(Also, identifier -> id?)<br>
<br>
David<br>
<br>
Jones, Andy wrote:
<blockquote
cite="mid:08D...@EV..."
type="cite">
<meta http-equiv="Content-Type" content="text/html; ">
<meta name="Generator" content="Microsoft Word 12 (filtered medium)">
<style>
<!--
/* Font Definitions */
@font-face
{font-family:Calibri;
panose-1:2 15 5 2 2 2 4 3 2 4;}
/* Style Definitions */
p.MsoNormal, li.MsoNormal, div.MsoNormal
{margin:0cm;
margin-bottom:.0001pt;
font-size:11.0pt;
font-family:"Calibri","sans-serif";}
a:link, span.MsoHyperlink
{mso-style-priority:99;
color:blue;
text-decoration:underline;}
a:visited, span.MsoHyperlinkFollowed
{mso-style-priority:99;
color:purple;
text-decoration:underline;}
span.EmailStyle17
{mso-style-type:personal-compose;
font-family:"Calibri","sans-serif";
color:windowtext;}
.MsoChpDefault
{mso-style-type:export-only;}
@page Section1
{size:612.0pt 792.0pt;
margin:72.0pt 72.0pt 72.0pt 72.0pt;}
div.Section1
{page:Section1;}
-->
</style>
<!--[if gte mso 9]><xml>
<o:shapedefaults v:ext="edit" spidmax="1026" />
</xml><![endif]--><!--[if gte mso 9]><xml>
<o:shapelayout v:ext="edit">
<o:idmap v:ext="edit" data="1" />
</o:shapelayout></xml><![endif]-->
<div class="Section1">
<p class="MsoNormal">Hi all,<o:p></o:p></p>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal">It was decided on the call that we would like to
flag that
Sequences in the ConceptualMoleculeCollection should have a Boolean
attribute to
capture if they are decoy sequences. At the moment we are using the
FuGE:Sequence element. I don’t really want to add another attribute to
this (it’s less problematic cutting down FuGE than adding new things),
so
I’m wondering if we should define our own Sequence type in AnalysisXML.
This would also allow us to choose exactly the relevant attributes. At
the
moment, Sequence can have all of the following:<o:p></o:p></p>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal"><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: maroon; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">pf:Sequence</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
isCircular</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">true</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
sequence</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
length</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
isApproximateLength</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">true</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
SequenceAnnotationSet_ref</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
start</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
end</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">0</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
identifier</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
name</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">String</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"></span><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"><o:p></o:p></span></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"><o:p> </o:p></span></p>
<p class="MsoNormal">Several of these attributes were created to
represent
concepts that probably will never be required or implemented in
AnalysisXML. How
about the following:<o:p></o:p></p>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal"><DBSequence identifier = “” name = “”
isDecoy = “true”><o:p></o:p></p>
<p class="MsoNormal"> <seq>MCTMG...</seq><o:p></o:p></p>
<p class="MsoNormal"> <span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;"><</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: maroon; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">pf:DatabaseReference</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
Database_ref</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">=""</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: red; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">
accession</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">="Rev_</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: black; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">IPI00013808.1</span><span
style="background: white none repeat scroll 0%; font-size: 12pt; font-family: "Times New Roman","serif"; color: blue; -moz-background-clip: -moz-initial; -moz-background-origin: -moz-initial; -moz-background-inline-policy: -moz-initial;">"/></span><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"><o:p></o:p></span></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"></DBSequence><o:p></o:p></span></p>
<p class="MsoNormal"><span
style="font-size: 12pt; font-family: "Times New Roman","serif"; color: blue;"><o:p> </o:p></span></p>
<p class="MsoNormal">Are any of the other attributes on Sequence
actually
required? I’ll post a new version of the schema with other changes WRT
to
PeptideEvidence shortly,<o:p></o:p></p>
<p class="MsoNormal">Cheers<o:p></o:p></p>
<p class="MsoNormal">Andy<o:p></o:p></p>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal"><o:p> </o:p></p>
<p class="MsoNormal"><o:p> </o:p></p>
</div>
<pre wrap="">
<hr size="4" width="90%">
-------------------------------------------------------------------------
Check out the new SourceForge.net Marketplace.
It's the best place to buy or sell services for
just about anything Open Source.
<a class="moz-txt-link-freetext" href="http://sourceforge.net/services/buy/index.php">http://sourceforge.net/services/buy/index.php</a></pre>
<pre wrap="">
<hr size="4" width="90%">
_______________________________________________
Psidev-pi-dev mailing list
<a class="moz-txt-link-abbreviated" href="mailto:Psi...@li...">Psi...@li...</a>
<a class="moz-txt-link-freetext" href="https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev">https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev</a>
</pre>
</blockquote>
<br>
<pre class="moz-signature" cols="72">--
David Creasy
Matrix Science
64 Baker Street
London W1U 7GB, UK
Tel: +44 (0)20 7486 1050
Fax: +44 (0)20 7224 1344
<a class="moz-txt-link-abbreviated" href="mailto:dc...@ma...">dc...@ma...</a>
<a class="moz-txt-link-freetext" href="http://www.matrixscience.com">http://www.matrixscience.com</a>
Matrix Science Ltd. is registered in England and Wales
Company number 3533898</pre>
</body>
</html>
|
|
From: Jones, A. <And...@li...> - 2008-06-27 13:37:55
|
Hi all,
It was decided on the call that we would like to flag that Sequences in the ConceptualMoleculeCollection should have a Boolean attribute to capture if they are decoy sequences. At the moment we are using the FuGE:Sequence element. I don't really want to add another attribute to this (it's less problematic cutting down FuGE than adding new things), so I'm wondering if we should define our own Sequence type in AnalysisXML. This would also allow us to choose exactly the relevant attributes. At the moment, Sequence can have all of the following:
<pf:Sequence isCircular="true" sequence="String" length="0" isApproximateLength="true" SequenceAnnotationSet_ref="String" start="0" end="0" identifier="String" name="String">
Several of these attributes were created to represent concepts that probably will never be required or implemented in AnalysisXML. How about the following:
<DBSequence identifier = "" name = "" isDecoy = "true">
<seq>MCTMG...</seq>
<pf:DatabaseReference Database_ref="" accession="Rev_IPI00013808.1"/>
</DBSequence>
Are any of the other attributes on Sequence actually required? I'll post a new version of the schema with other changes WRT to PeptideEvidence shortly,
Cheers
Andy
|
|
From: Pierre-Alain B. <pie...@is...> - 2008-06-27 07:54:02
|
Hi all, my 2cents there: David Creasy wrote: > Hi Jenny, > > Jennifer Siepen wrote: > >> Hi, >> >> I am in the process of trying to put together an example instance >> document for OMSSA and have a few questions. To make things more >> complicated I have gone for an example where I run the search on a >> concatenated forward/reverse database. >> > Nothing like jumping in at the deep end! > Definitely welcome in the game! > >> At the moment I have all the >> results in the analysisXML file i.e. in the ConceptualMoleculeCollection >> I am listing all proteins and peptides identified including the reverse >> sequences. I am unsure if (a) I am supposed to be listing all results >> and (b) if all results are supposed to be listed how I mark the reverse >> ones as decoy or does it not matter? >> > In some ways it doesn't matter, because they are just lists of > proteins/peptides. > > However, you might like to look at Martin's example which contains > results from Mascot and Sequest, and model forward/reverse on this: > > http://code.google.com/p/psi-pi/source/browse/trunk/examples/schema_usecase_examples/working12June/MPC_use_case_working12June.axml > > (See also: http://code.google.com/p/psi-pi/issues/detail?id=32) > For the proteins, if the reverse entries don't have different > accessions, you could use a different Database_ref. > For the peptides, to make it more human readable, you could encode > 'Reverse' into the id? > Maybe we can think already of the way the PEFF format (new proposed PSI common database format) deals with it: each entry has a DBprefix followed by a ":" and the accession number. In one DB file, you can concatenate as many DBs as you want. A forward and a reverse entry might have different prefixes,and the UniqueDBIdentifiers would look like sp:P00721 sp_rev:P00721 > >> I am also listing all results (forward and reverse) in DataCollection. >> > I'd recommend two sets of results: > <SpectrumIdentificationList id="OMSSA_forward"> > ... > > <SpectrumIdentificationList id="OMSSA_reverse"> > ... > > Why not, but is that a problem if a spectrum interpretation is both in fw and in rev ? does it have to be duplicated? > >> The next step for me would be to calculate false discovery rates based >> upon the OMSSA results and select 'good' peptides, I am not sure where >> these results would be reported? >> > And nor am I yet. One issue is that this is a 'dynamic' sort of thing. > For a particular cutoff expect value (or some rule), you might get x > hits from the forward database, and y hits from the reverse database. > For a different cutoff expect value, you would get x' and y' results. > AnalysisXML is (currently) expected to report for just one 'cutoff' - > i.e. a consumer of the analysisXML document couldn't recalculate the > value. So, the proteins reported (from the forward / and reverse > database) are the list for the cutoff decided by the producer of the > file. We will discuss this in a conference call > > If the search params set the cutoffs, you can calculate a single value. If you calculate the FDR as post processing, it would look like an additional analysis, therefore formally a new Analysis. But I believe you could set more than one Analysis set of params and generate the AnalysisXML from the end result. >> A quick question relates to the 'PeptideEvidence'. One of the attributes >> is "pre" as in the previous flanking sequence. If my peptide is the >> N-terminal peptide what would pre be? pre="" or pre="-"? or does it not >> matter? >> > We just need to decide and document - maybe at the conference call later > today. > > >> Finally the database searched was a custom database, is there anywhere >> to report how a database was generated? >> > Possibly outside the scope of AnalysisXML. > Don't we have a source information for the searched database? Cheers, Pierre-Alain > >> Sometimes we also search >> peptide databases i.e. the database would have the same number of >> 'protein' entries as the original but there would only be one peptide >> per protein would I be able to report how many peptides are in the >> underlying database searched - would it be a cvParam? >> > This was something we discussed briefly on 2008-05-15: > http://www.psidev.info/index.php?q=node/325 > > We need the number of residues and sequences, although we don't > currently have a record of the number of peptides in the database. > Discussion of how to specify databases at: > > http://code.google.com/p/psi-pi/issues/detail?id=31 > > So, maybe you could add some notes there? > > > David > > >> Thanks, >> >> Jenny >> >> ------------------------------------------------------------------------- >> Check out the new SourceForge.net Marketplace. >> It's the best place to buy or sell services for >> just about anything Open Source. >> http://sourceforge.net/services/buy/index.php >> _______________________________________________ >> Psidev-pi-dev mailing list >> Psi...@li... >> https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev >> > > |
|
From: David C. <dc...@ma...> - 2008-06-26 14:07:21
|
Hi Jenny, Jennifer Siepen wrote: > Hi, > > I am in the process of trying to put together an example instance > document for OMSSA and have a few questions. To make things more > complicated I have gone for an example where I run the search on a > concatenated forward/reverse database. Nothing like jumping in at the deep end! > At the moment I have all the > results in the analysisXML file i.e. in the ConceptualMoleculeCollection > I am listing all proteins and peptides identified including the reverse > sequences. I am unsure if (a) I am supposed to be listing all results > and (b) if all results are supposed to be listed how I mark the reverse > ones as decoy or does it not matter? In some ways it doesn't matter, because they are just lists of proteins/peptides. However, you might like to look at Martin's example which contains results from Mascot and Sequest, and model forward/reverse on this: http://code.google.com/p/psi-pi/source/browse/trunk/examples/schema_usecase_examples/working12June/MPC_use_case_working12June.axml (See also: http://code.google.com/p/psi-pi/issues/detail?id=32) For the proteins, if the reverse entries don't have different accessions, you could use a different Database_ref. For the peptides, to make it more human readable, you could encode 'Reverse' into the id? > > I am also listing all results (forward and reverse) in DataCollection. I'd recommend two sets of results: <SpectrumIdentificationList id="OMSSA_forward"> ... <SpectrumIdentificationList id="OMSSA_reverse"> ... > The next step for me would be to calculate false discovery rates based > upon the OMSSA results and select 'good' peptides, I am not sure where > these results would be reported? And nor am I yet. One issue is that this is a 'dynamic' sort of thing. For a particular cutoff expect value (or some rule), you might get x hits from the forward database, and y hits from the reverse database. For a different cutoff expect value, you would get x' and y' results. AnalysisXML is (currently) expected to report for just one 'cutoff' - i.e. a consumer of the analysisXML document couldn't recalculate the value. So, the proteins reported (from the forward / and reverse database) are the list for the cutoff decided by the producer of the file. We will discuss this in a conference call > > A quick question relates to the 'PeptideEvidence'. One of the attributes > is "pre" as in the previous flanking sequence. If my peptide is the > N-terminal peptide what would pre be? pre="" or pre="-"? or does it not > matter? We just need to decide and document - maybe at the conference call later today. > > Finally the database searched was a custom database, is there anywhere > to report how a database was generated? Possibly outside the scope of AnalysisXML. > Sometimes we also search > peptide databases i.e. the database would have the same number of > 'protein' entries as the original but there would only be one peptide > per protein would I be able to report how many peptides are in the > underlying database searched - would it be a cvParam? This was something we discussed briefly on 2008-05-15: http://www.psidev.info/index.php?q=node/325 We need the number of residues and sequences, although we don't currently have a record of the number of peptides in the database. Discussion of how to specify databases at: http://code.google.com/p/psi-pi/issues/detail?id=31 So, maybe you could add some notes there? David > > Thanks, > > Jenny > > ------------------------------------------------------------------------- > Check out the new SourceForge.net Marketplace. > It's the best place to buy or sell services for > just about anything Open Source. > http://sourceforge.net/services/buy/index.php > _______________________________________________ > Psidev-pi-dev mailing list > Psi...@li... > https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev -- David Creasy Matrix Science 64 Baker Street London W1U 7GB, UK Tel: +44 (0)20 7486 1050 Fax: +44 (0)20 7224 1344 dc...@ma... http://www.matrixscience.com Matrix Science Ltd. is registered in England and Wales Company number 3533898 |
|
From: Jennifer S. <jen...@ma...> - 2008-06-26 12:28:00
|
Hi, I am in the process of trying to put together an example instance document for OMSSA and have a few questions. To make things more complicated I have gone for an example where I run the search on a concatenated forward/reverse database. At the moment I have all the results in the analysisXML file i.e. in the ConceptualMoleculeCollection I am listing all proteins and peptides identified including the reverse sequences. I am unsure if (a) I am supposed to be listing all results and (b) if all results are supposed to be listed how I mark the reverse ones as decoy or does it not matter? I am also listing all results (forward and reverse) in DataCollection. The next step for me would be to calculate false discovery rates based upon the OMSSA results and select 'good' peptides, I am not sure where these results would be reported? A quick question relates to the 'PeptideEvidence'. One of the attributes is "pre" as in the previous flanking sequence. If my peptide is the N-terminal peptide what would pre be? pre="" or pre="-"? or does it not matter? Finally the database searched was a custom database, is there anywhere to report how a database was generated? Sometimes we also search peptide databases i.e. the database would have the same number of 'protein' entries as the original but there would only be one peptide per protein would I be able to report how many peptides are in the underlying database searched - would it be a cvParam? Thanks, Jenny |
|
From: David C. <dc...@ma...> - 2008-06-25 18:11:29
|
Hi everyone, There will be an AnalysisXML working group conference call tomorrow (Thursday) at: http://www.timeanddate.com/worldclock/fixedtime.html?day=26&month=6&year=2008&hour=16&min=0&sec=0&p1=136 Minutes from the last meeting: http://www.psidev.info/index.php?q=node/348 Latest instance documents at: Agenda: 1. Volunteers for reviewing specific parts of the current example instance docs... http://code.google.com/p/psi-pi/source/browse/trunk/examples/schema_usecase_examples/working12June/MPC_use_case_working12June.axml http://code.google.com/p/psi-pi/source/browse/trunk/examples/schema_usecase_examples/working20June/F001350.xml 2. Need somewhere to put notes for the final documentation. (Or we'll forget...) 3. Enzyme specification. http://code.google.com/p/psi-pi/issues/detail?id=30 4. Some aesthetic/syntax inconsistencies with mzML http://code.google.com/p/psi-pi/issues/detail?id=29 5. Issue 24 - see emails on list. http://code.google.com/p/psi-pi/issues/detail?id=24 Dial in details: + Germany: 08001012079 + Switzerland: 0800000860 + UK: 08081095644 + USA: 1-866-314-3683 + Generic international: +44 2083222500 (UK number) access code: 297427 -- David Creasy Matrix Science 64 Baker Street London W1U 7GB, UK Tel: +44 (0)20 7486 1050 Fax: +44 (0)20 7224 1344 dc...@ma... http://www.matrixscience.com Matrix Science Ltd. is registered in England and Wales Company number 3533898 |
|
From: David C. <dc...@ma...> - 2008-06-24 14:48:14
|
Andy, Angel, Martin etc... I've addressed comments 1 and 2 in: http://code.google.com/p/psi-pi/issues/detail?id=13 (and agree that Sequence_ref should be mandatory) 1 minor issue: <ProteinDetermination identifier="xxx" ProteinDetectionResultList_ref="results_from_Mascot" > The name of the _ref attribute should now be: ProteinDetectionList_ref Question: In ProteinDetermination, there is: <SpectrumIdentificationList_ref identifier="SIL_1"/> The SpectrumIdentificationList_ref isn't an attribute of ProteinDetermination because there could be more than one SpectrumIdentificationList? Assuming this is the case, then the identifier (SIL_1 in my example) is the reference? So somewhere else there will be: <SpectrumIdentificationList identifier="SIL_1" ... or have I misunderstood? And, (losing my memory again), I've forgotten what SpectraData is supposed to be for. Cheers, David |
|
From: David C. <dc...@ma...> - 2008-06-24 10:33:39
|
Hi Andy, Jones, Andy wrote: > Hi all, > > I've made an update to the schema to try out a spec for translation table and committed to SVN. There is an example under schema_usecase_examples\working20June. Brilliant, thanks. > > It differs slightly from David's proposal in two ways: > > 1) I have not included any model for a custom translation table. My opinion is that this would be overkill in the schema, and it would be better to create an external reference e.g. to a web page (as a CV ref) if someone invents a new translation table. Any opinions? I think this is fine. > 2) I have not included translation frame on Sequence, since the translation frame is a property of the result, not of the sequence itself. That's also fine - in fact this is what I asked for. (Translation frame as a property of the result, but translation table as a property of the sequence). Ah, I see now that you want both as a property of the result. That's also fine by me, and probably clearer (although slightly more verbose). > I decided to follow the same pattern as for searches of protein sequences databases, as follows: > > <!-- Standard DNA sequence entry --> > <pf:Sequence identifier="EST_1" length="251" sequence="ATATAGCAGCTAGCTGTAGCTAGCTAGCTACGTACGATCGATCGTACGTACGTAGCTACGATCGTAGTAGTATACGATCGGCGCTAGCTATCGCTACGATCGGCTATCGATCGTC"/> > > <!-- Standard peptide entry --> > <Peptide identifier="peptide_1_1" sequenceMass="1341.72522" sequenceLength="12"> > <peptideSequence>DAGTISGLNVLR</peptideSequence> > </Peptide> > > <!-- Standard SpectrumIdentificationItem --> > <SpectrumIdentificationResult identifier="ident_pep_1_1"> > <SpectrumIdentificationItem identifier="1_1" calculatedMassToCharge="670.86261" chargeState="2" experimentalMassToCharge="671.9" Peptide_ref="peptide_1_1"> > <pf:cvParam accession="PI:99999" name="mascot_ions_score" cvRef="PSI-PI" value="62.72" /> > <pf:cvParam accession="PI:99999" name="mascot_expect_value" cvRef="PSI-PI" value="0.00273766445377971" /> > <pf:cvParam accession="PI:99999" name="mascot_rank" cvRef="PSI-PI" value="1" /> > </SpectrumIdentificationItem> > <SpectrumElement spectrumID="dp210198c 21-Jan-98 DERIVED SPECTRUM #9" SpectraData_ref="IF1"/> > </SpectrumIdentificationResult> > > > <!-- Translation table specified in the search protocol --> > <DatabaseTranslationFrames frames="1,2,3,4,5,6"> > <TranslationTable identifier="Table_1"> > <pf:cvParam accession="transl_table=2" name="The Vertebrate Mitochondrial Code" value="" cvRef="NCBI"> Why not <pf:cvParam accession="transl_table" name="The Vertebrate Mitochondrial Code" value="2" cvRef="NCBI"> ?? > </pf:cvParam> > </TranslationTable> > </DatabaseTranslationFrames> > > > <!-- Then a new element (subclass of PeptideEvidence) under ProteinDetectionHypothesis > <ProteinAmbiguityGroup identifier="hit_1" > > <ProteinDetectionHypothesis identifier="prot_1" Sequence_ref = "EST_1"> > > <TranslatedPeptideEvidence start="160" end="171" SpectrumIdentificationItem_ref="1_1" post="K" pre="I" frame = "3" TranslationTable_ref="Table_1" /> > </ProteinDetectionHypothesis> > > > Does this make sense? Yes. But it makes it harder for a parser to have to look for TranslatedPeptideEvidence and PeptideEvidence? Why not just add optional attributes to PeptideEvidence? > > > I haven't yet added anything to the schema for cleavage enzyme (Issue 30), I think this needs more discussion on the list. Simon H makes a good point about nomenclature. I think we should try get people on the call next week to work through the options...? Sounds good, David > > Cheers > Andy > > > > > > ------------------------------------------------------------------------- > Check out the new SourceForge.net Marketplace. > It's the best place to buy or sell services for > just about anything Open Source. > http://sourceforge.net/services/buy/index.php > _______________________________________________ > Psidev-pi-dev mailing list > Psi...@li... > https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev -- David Creasy Matrix Science 64 Baker Street London W1U 7GB, UK Tel: +44 (0)20 7486 1050 Fax: +44 (0)20 7224 1344 dc...@ma... http://www.matrixscience.com Matrix Science Ltd. is registered in England and Wales Company number 3533898 |
|
From: Jones, A. <And...@li...> - 2008-06-20 10:40:11
|
Hi all,
I've made an update to the schema to try out a spec for translation table and committed to SVN. There is an example under schema_usecase_examples\working20June.
It differs slightly from David's proposal in two ways:
1) I have not included any model for a custom translation table. My opinion is that this would be overkill in the schema, and it would be better to create an external reference e.g. to a web page (as a CV ref) if someone invents a new translation table. Any opinions?
2) I have not included translation frame on Sequence, since the translation frame is a property of the result, not of the sequence itself. I decided to follow the same pattern as for searches of protein sequences databases, as follows:
<!-- Standard DNA sequence entry -->
<pf:Sequence identifier="EST_1" length="251" sequence="ATATAGCAGCTAGCTGTAGCTAGCTAGCTACGTACGATCGATCGTACGTACGTAGCTACGATCGTAGTAGTATACGATCGGCGCTAGCTATCGCTACGATCGGCTATCGATCGTC"/>
<!-- Standard peptide entry -->
<Peptide identifier="peptide_1_1" sequenceMass="1341.72522" sequenceLength="12">
<peptideSequence>DAGTISGLNVLR</peptideSequence>
</Peptide>
<!-- Standard SpectrumIdentificationItem -->
<SpectrumIdentificationResult identifier="ident_pep_1_1">
<SpectrumIdentificationItem identifier="1_1" calculatedMassToCharge="670.86261" chargeState="2" experimentalMassToCharge="671.9" Peptide_ref="peptide_1_1">
<pf:cvParam accession="PI:99999" name="mascot_ions_score" cvRef="PSI-PI" value="62.72" />
<pf:cvParam accession="PI:99999" name="mascot_expect_value" cvRef="PSI-PI" value="0.00273766445377971" />
<pf:cvParam accession="PI:99999" name="mascot_rank" cvRef="PSI-PI" value="1" />
</SpectrumIdentificationItem>
<SpectrumElement spectrumID="dp210198c 21-Jan-98 DERIVED SPECTRUM #9" SpectraData_ref="IF1"/>
</SpectrumIdentificationResult>
<!-- Translation table specified in the search protocol -->
<DatabaseTranslationFrames frames="1,2,3,4,5,6">
<TranslationTable identifier="Table_1">
<pf:cvParam accession="transl_table=2" name="The Vertebrate Mitochondrial Code" value="" cvRef="NCBI">
</pf:cvParam>
</TranslationTable>
</DatabaseTranslationFrames>
<!-- Then a new element (subclass of PeptideEvidence) under ProteinDetectionHypothesis
<ProteinAmbiguityGroup identifier="hit_1" >
<ProteinDetectionHypothesis identifier="prot_1" Sequence_ref = "EST_1">
<TranslatedPeptideEvidence start="160" end="171" SpectrumIdentificationItem_ref="1_1" post="K" pre="I" frame = "3" TranslationTable_ref="Table_1" />
</ProteinDetectionHypothesis>
Does this make sense?
I haven't yet added anything to the schema for cleavage enzyme (Issue 30), I think this needs more discussion on the list. Simon H makes a good point about nomenclature. I think we should try get people on the call next week to work through the options...?
Cheers
Andy
|
|
From: Phil J. @ E. <pj...@eb...> - 2008-06-19 08:27:55
|
See: http://code.google.com/p/psi-pi/issues/detail?id=31 best regards, Phil. -- Phil Jones Senior Software Engineer PRIDE Project Team PANDA Group, EMBL-EBI Wellcome Trust Genome Campus Hinxton, Cambridge, CB10 1SD UK. Work phone: +44 1223 492610 Skype: philip-jones |
|
From: Matthew C. <mat...@va...> - 2008-06-18 22:12:20
|
Hi all, The prediction and matching rules in database search engines are arbitrarily complex algorithms and it is quite intractable to come up with a file-scope way to specify the algorithm. Thinking again about result-scope specification of the predicted and matched ions, it seems possible to come up with an optimized format (minimizing markup bloat). Is there value in annotating the predicted but missed ions, or is it only desirable to annotate the matched ions? Also, is there an established format for specifying the composition of peptide fragments (accounting for losses, radicals, and charge)? There was some suggestion on the last call of referring to a script which could run the algorithm. I think that's a reasonable approach if the algorithms are put in the CV and there is a version parameter when they are referenced by a results file. I would also hope that we maintain a link to the script in the CV definition. Possibly, the version would have to be part of the term itself, or there could be some convention where the script provides a version parameter? Given these nasty versioning issues, the result-scope approach starts to look better... -Matt |
|
From: Martin E. <mar...@ru...> - 2008-06-18 13:47:02
|
Hi everyone, There will be an analysisXML working group conference call tomorrow (Thursday) at: http://www.timeanddate.com/worldclock/fi xedtime.html?day=19&month=6&year=2008&ho ur=16&min=0&sec=0&p1=136 Minutes of last conf call: http://www.psidev.info/index.php?q=node/ 345 Agenda: 1. Davids instance doc (http://code.google.com/p/psi-pi/source/ browse/trunk/examples/schema_usecase_exa mples/working6June/F001350.xml), with respect to: 2. Issues 12 and 30: translation table and enzyme 3. Vote on open issues, where possible 4. What you want Bye Martin Eisenacher + Germany: 08001012079 + Switzerland: 0800000860 + UK: 08081095644 + USA: 1-866-314-3683 + Generic international: +44 2083222500 (UK number) access code: 297427 -- Dr. Martin Eisenacher Bioinformatik Medizinisches Proteom-Center (MPC) Ruhr-Universität Bochum Tel.: +49 / 234 / 32 - 29288 Fax: +49 / 234 / 32 - 14554 http://www.medizinisches-proteom-center. de/ |
|
From: David C. <dc...@ma...> - 2008-06-16 14:32:51
|
Hi everyone, There were no other nominations for editor of the Proteomics Informatics group, so we are pleased to announce that Martin has been accepted for the position. I've updated the local group structure chart here: http://www.psidev.info/index.php?q=node/105#group_structure The main psi organisation chart here: http://psidev.info/index.php?q=node/202 will be updated soon. David David Creasy wrote: > Hi all, > > We have a requirement for an editor for the Proteomics Informatics > group. The editor is responsible for checking that the documentation > etc. is suitable and sufficient to be put through the PSI document > process. There has been one nomination for this: Martin Eisenacher > > If anybody else would like to be considered for the role, please contact > me off list by end of Wednesday 4th June. (dc...@ma...) > > > Org chart is here: > http://psidev.info/index.php?q=node/202 > > Thanks, > > David > -- David Creasy Matrix Science 64 Baker Street London W1U 7GB, UK Tel: +44 (0)20 7486 1050 Fax: +44 (0)20 7224 1344 dc...@ma... http://www.matrixscience.com Matrix Science Ltd. is registered in England and Wales Company number 3533898 |
|
From: David C. <dc...@ma...> - 2008-06-11 17:28:08
|
Hi everyone, There will be an AnalysisXML working group conference call tomorrow (Thursday) at: http://www.timeanddate.com/worldclock/fixedtime.html?day=12&month=6&year=2008&hour=16&min=0&sec=0&p1=136 I see from last weeks minutes: Need to set up a *clear agenda for next week*. If there are items that have been investigated, and are in the issues list: http://code.google.com/p/psi-pi/issues/list and that need agreement/discussion, please let me know or add to the agenda yourself: http://www.psidev.info/index.php?q=node/340 + Germany: 08001012079 + Switzerland: 0800000860 + UK: 08081095644 + USA: 1-866-314-3683 + Generic international: +44 2083222500 (UK number) access code: 297427 -- David Creasy Matrix Science 64 Baker Street London W1U 7GB, UK Tel: +44 (0)20 7486 1050 Fax: +44 (0)20 7224 1344 dc...@ma... http://www.matrixscience.com Matrix Science Ltd. is registered in England and Wales Company number 3533898 |
|
From: Jones, A. <And...@li...> - 2008-06-06 14:57:30
|
And if Phil wants to send round a suggestion for fragment ions, I'll add this to the schema on Monday > -----Original Message----- > From: psi...@li... [mailto:psidev-pi-dev- > bo...@li...] On Behalf Of Jones, Andy > Sent: 06 June 2008 15:57 > To: psi...@li... > Subject: [Psidev-pi-dev] Updated schema > > Hi all, > > I've made a few edits to the schema as discussed on the call, and tidied up the > SVN, so the main working version is the only file in the schema directory. > > Changes: > - Altered cardinality of AnalysisCollection and AnalysisProtocolCollection to > 1, since I think it should not be possible to create a file without any protocols or > protocol applications (as least if there is a protocol application there must be a > protocol). Let me know if anyone disagrees and I'll change it back > - Removed PolypeptideValuePropertyType and ValuePropertyType, > Intensity, RetentionTime (think these were left over in the schema and not > required) > - Put the AnalysisXML complexType first in the schema to make it easier to > find. > - Worked thru schema and put in PropertyValue (value + unit + > unitAccession) references instead of cvParam where sensible... > - Added the option for userParam or cvParam by adding an abstract > ParamType (changed over most of the references to ParamType, although I may > have missed a few) > - Made TranslationTable cardinality 1, as suggested by Martin’s email > > One minor problem. On the call we discussed using XSD style inheritance for > cvParam, where an entity e.g. SearchType uses the cvParamType complexType. > Unfortunately, this does not work with also using the other style of inheritance > where you can give the option of a userParam or cvParam by giving a reference to > an abstract superclass e.g. ParamType. > > So... we either go back to the old style of having e.g. > > <SearchType> > <cvParam ...> > > > Or we ditch the option of having cvParam or userParam as an option, and only > user cvParam. We could for example make cvRef and accession optional, so a > userParam is just a cvParam without the reference. I can give examples if I haven't > explained this clearly enough. > > Cheers > Andy > > > > > > > > > > ------------------------------------------------------------------------- > Check out the new SourceForge.net Marketplace. > It's the best place to buy or sell services for > just about anything Open Source. > http://sourceforge.net/services/buy/index.php > _______________________________________________ > Psidev-pi-dev mailing list > Psi...@li... > https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev |
|
From: Jones, A. <And...@li...> - 2008-06-06 14:56:30
|
Hi all, I've made a few edits to the schema as discussed on the call, and tidied up the SVN, so the main working version is the only file in the schema directory. Changes: - Altered cardinality of AnalysisCollection and AnalysisProtocolCollection to 1, since I think it should not be possible to create a file without any protocols or protocol applications (as least if there is a protocol application there must be a protocol). Let me know if anyone disagrees and I'll change it back - Removed PolypeptideValuePropertyType and ValuePropertyType, Intensity, RetentionTime (think these were left over in the schema and not required) - Put the AnalysisXML complexType first in the schema to make it easier to find. - Worked thru schema and put in PropertyValue (value + unit + unitAccession) references instead of cvParam where sensible... - Added the option for userParam or cvParam by adding an abstract ParamType (changed over most of the references to ParamType, although I may have missed a few) - Made TranslationTable cardinality 1, as suggested by Martin’s email One minor problem. On the call we discussed using XSD style inheritance for cvParam, where an entity e.g. SearchType uses the cvParamType complexType. Unfortunately, this does not work with also using the other style of inheritance where you can give the option of a userParam or cvParam by giving a reference to an abstract superclass e.g. ParamType. So... we either go back to the old style of having e.g. <SearchType> <cvParam ...> Or we ditch the option of having cvParam or userParam as an option, and only user cvParam. We could for example make cvRef and accession optional, so a userParam is just a cvParam without the reference. I can give examples if I haven't explained this clearly enough. Cheers Andy |
|
From: Martin E. <mar...@ru...> - 2008-06-05 11:03:54
|
Hi everyone, there will be an AnalysisXML working group conference call today (Thursday) at 4 PM UK time: http://www.timeanddate.com/worldclock/fi xedtime.html?day=5&month=6&year=2008&hou r=16&min=0&sec=0&p1=136 Minutes of last meeting at: http://psidev.info/index.php?q=node/332 Agenda: 1. Review minutes of last meeting and newest schema 2. Discuss cleavage agent settings and Continue with review of the Excel spreadsheet to decide what needs to be attributes and what needs to be CV. The spreadsheet: http://code.google.com/p/psi-pi/source/b rowse/trunk/cv/ 3. if time: go through issues list http://code.google.com/p/psi-pi/issues/l ist Best regards Martin + Germany: 08001012079 + Switzerland: 0800000860 + UK: 08081095644 + USA: 1-866-314-3683 + Generic international: +44 2083222500 (UK number) access code: 297427 |
42 messages has been excluded from this view by a project administrator.
