Re: [Psidev-pi-dev] Translation table

[David C. <dc...@ma...>]

Hi Andy,

Jones, Andy wrote:
> Hi all,
> 
> I've made an update to the schema to try out a spec for translation table and committed to SVN. There is an example under schema_usecase_examples\working20June.
Brilliant, thanks.

> 
> It differs slightly from David's proposal in two ways:
> 
> 1) I have not included any model for a custom translation table. My opinion is that this would be overkill in the schema, and it would be better to create an external reference e.g. to a web page (as a CV ref) if someone invents a new translation table. Any opinions?
I think this is fine.

> 2) I have not included translation frame on Sequence, since the translation frame is a property of the result, not of the sequence itself. 
That's also fine - in fact this is what I asked for. (Translation frame 
as a property of the result, but translation table as a property of the 
sequence).
Ah, I see now that you want both as a property of the result. That's 
also fine by me, and probably clearer (although slightly more verbose).

> I decided to follow the same pattern as for searches of protein sequences databases, as follows:
> 
> <!-- Standard DNA sequence entry -->
> <pf:Sequence identifier="EST_1" length="251" sequence="ATATAGCAGCTAGCTGTAGCTAGCTAGCTACGTACGATCGATCGTACGTACGTAGCTACGATCGTAGTAGTATACGATCGGCGCTAGCTATCGCTACGATCGGCTATCGATCGTC"/>	  
>   
> <!-- Standard peptide entry --> 
>     <Peptide identifier="peptide_1_1" sequenceMass="1341.72522" sequenceLength="12">
>       <peptideSequence>DAGTISGLNVLR</peptideSequence>
>     </Peptide>
> 
> <!-- Standard SpectrumIdentificationItem -->
>         <SpectrumIdentificationResult identifier="ident_pep_1_1">
>           <SpectrumIdentificationItem identifier="1_1"  calculatedMassToCharge="670.86261" chargeState="2" experimentalMassToCharge="671.9" Peptide_ref="peptide_1_1">
>             <pf:cvParam accession="PI:99999" name="mascot_ions_score"   cvRef="PSI-PI" value="62.72" />
>             <pf:cvParam accession="PI:99999" name="mascot_expect_value" cvRef="PSI-PI" value="0.00273766445377971" />
>             <pf:cvParam accession="PI:99999" name="mascot_rank"         cvRef="PSI-PI" value="1" />
>           </SpectrumIdentificationItem>
>           <SpectrumElement spectrumID="dp210198c                      21-Jan-98 DERIVED SPECTRUM    #9" SpectraData_ref="IF1"/>
>         </SpectrumIdentificationResult>
> 
> 
> <!-- Translation table specified in the search protocol -->
>       <DatabaseTranslationFrames frames="1,2,3,4,5,6">
> 			<TranslationTable identifier="Table_1">
> 				<pf:cvParam accession="transl_table=2" name="The Vertebrate Mitochondrial Code" value="" cvRef="NCBI">
Why not
<pf:cvParam accession="transl_table" name="The Vertebrate Mitochondrial 
Code" value="2" cvRef="NCBI">
??

> 					</pf:cvParam>
> 			</TranslationTable>
> </DatabaseTranslationFrames>
> 
> 
> <!-- Then a new element (subclass of PeptideEvidence) under ProteinDetectionHypothesis
>         <ProteinAmbiguityGroup identifier="hit_1" >
>           <ProteinDetectionHypothesis identifier="prot_1" Sequence_ref = "EST_1">
>            
> 	 	<TranslatedPeptideEvidence start="160" end="171" SpectrumIdentificationItem_ref="1_1" post="K" pre="I" frame = "3" 			TranslationTable_ref="Table_1" />
>           </ProteinDetectionHypothesis>
> 
> 
> Does this make sense?
Yes. But it makes it harder for a parser to have to look for 
TranslatedPeptideEvidence and PeptideEvidence?
Why not just add optional attributes to PeptideEvidence?

> 
> 
> I haven't yet added anything to the schema for cleavage enzyme (Issue 30), I think this needs more discussion on the list. Simon H makes a good point about nomenclature. I think we should try get people on the call next week to work through the options...?
Sounds good,

David
> 
> Cheers
> Andy
>   
> 
> 
> 
> 
> -------------------------------------------------------------------------
> Check out the new SourceForge.net Marketplace.
> It's the best place to buy or sell services for
> just about anything Open Source.
> http://sourceforge.net/services/buy/index.php
> _______________________________________________
> Psidev-pi-dev mailing list
> Psi...@li...
> https://lists.sourceforge.net/lists/listinfo/psidev-pi-dev

-- 
David Creasy
Matrix Science
64 Baker Street
London W1U 7GB, UK
Tel: +44 (0)20 7486 1050
Fax: +44 (0)20 7224 1344

dc...@ma...
http://www.matrixscience.com

Matrix Science Ltd. is registered in England and Wales
Company number 3533898