[Psidev-pi-dev] Translation table

[Jones, A. <And...@li...>]

Hi all,

I've made an update to the schema to try out a spec for translation table and committed to SVN. There is an example under schema_usecase_examples\working20June.

It differs slightly from David's proposal in two ways:

1) I have not included any model for a custom translation table. My opinion is that this would be overkill in the schema, and it would be better to create an external reference e.g. to a web page (as a CV ref) if someone invents a new translation table. Any opinions?
2) I have not included translation frame on Sequence, since the translation frame is a property of the result, not of the sequence itself. I decided to follow the same pattern as for searches of protein sequences databases, as follows:

<!-- Standard DNA sequence entry -->
<pf:Sequence identifier="EST_1" length="251" sequence="ATATAGCAGCTAGCTGTAGCTAGCTAGCTACGTACGATCGATCGTACGTACGTAGCTACGATCGTAGTAGTATACGATCGGCGCTAGCTATCGCTACGATCGGCTATCGATCGTC"/>	  
  
<!-- Standard peptide entry --> 
    <Peptide identifier="peptide_1_1" sequenceMass="1341.72522" sequenceLength="12">
      <peptideSequence>DAGTISGLNVLR</peptideSequence>
    </Peptide>

<!-- Standard SpectrumIdentificationItem -->
        <SpectrumIdentificationResult identifier="ident_pep_1_1">
          <SpectrumIdentificationItem identifier="1_1"  calculatedMassToCharge="670.86261" chargeState="2" experimentalMassToCharge="671.9" Peptide_ref="peptide_1_1">
            <pf:cvParam accession="PI:99999" name="mascot_ions_score"   cvRef="PSI-PI" value="62.72" />
            <pf:cvParam accession="PI:99999" name="mascot_expect_value" cvRef="PSI-PI" value="0.00273766445377971" />
            <pf:cvParam accession="PI:99999" name="mascot_rank"         cvRef="PSI-PI" value="1" />
          </SpectrumIdentificationItem>
          <SpectrumElement spectrumID="dp210198c                      21-Jan-98 DERIVED SPECTRUM    #9" SpectraData_ref="IF1"/>
        </SpectrumIdentificationResult>


<!-- Translation table specified in the search protocol -->
      <DatabaseTranslationFrames frames="1,2,3,4,5,6">
			<TranslationTable identifier="Table_1">
				<pf:cvParam accession="transl_table=2" name="The Vertebrate Mitochondrial Code" value="" cvRef="NCBI">
					</pf:cvParam>
			</TranslationTable>
</DatabaseTranslationFrames>


<!-- Then a new element (subclass of PeptideEvidence) under ProteinDetectionHypothesis
        <ProteinAmbiguityGroup identifier="hit_1" >
          <ProteinDetectionHypothesis identifier="prot_1" Sequence_ref = "EST_1">
           
	 	<TranslatedPeptideEvidence start="160" end="171" SpectrumIdentificationItem_ref="1_1" post="K" pre="I" frame = "3" 			TranslationTable_ref="Table_1" />
          </ProteinDetectionHypothesis>


Does this make sense?


I haven't yet added anything to the schema for cleavage enzyme (Issue 30), I think this needs more discussion on the list. Simon H makes a good point about nomenclature. I think we should try get people on the call next week to work through the options...?

Cheers
Andy