|
From: Felipe L. <fel...@ya...> - 2013-10-22 10:32:42
|
I think that you can help me. The output and command line at terminal is: $ nucmer --prefix=8A_8B contigs_copd8A.fasta contigs_copd8B.fasta 1: PREPARING DATA 2,3: RUNNING mummer AND CREATING CLUSTERS # reading input file "8A_8B.ntref" of length 1976286 # construct suffix tree for sequence of length 1976286 # (maximum reference length is 536870908) # (maximum query length is 4294967295) # process 19762 characters per dot #.................................................................................................... # CONSTRUCTIONTIME /usr/bin/mummer 8A_8B.ntref 0.44 # reading input file "/media/Iomega_HDD/snps_copd8/contigs_copd8B.fasta" of length 1900897 # matching query-file "/media/Iomega_HDD/snps_copd8/contigs_copd8B.fasta" # against subject-file "8A_8B.ntref" # COMPLETETIME /usr/bin/mummer 8A_8B.ntref 1.51 # SPACE /usr/bin/mummer 8A_8B.ntref 3.78 4: FINISHING DATA ERROR: Could not parse input from 'Query File'. Please check the filename and format, or file a bug report ERROR: postnuc returned non-zero The error file contains: 20131022|121048| 4492| ERROR: postnuc returned non-zero The .delta file contains: /media/Iomega_HDD/snps_copd8/contigs_copd8A.fasta /media/Iomega_HDD/snps_copd8/contigs_copd8B.fasta NUCMER The .nucmer file >allcontigs /media/Iomega_HDD/snps_copd8/contigs_copd8A.fasta tgcccgccgagccagcgttcgagatggtcgaggaccgcccggtcggcttcgtcgagatcc tcgcgggccgcctctgcggcatagcggaacacctcgcgatcctgcaccgagcgaccgcag ataccgcccagggtcaggtcgcggctggccaggtcggcccgcgccacccgcaaaagaccc tgggcgaggttctccaggtcaccggcgaggcttcccgccaggaccagttggc.... Felipe Lira Spanish National Center of Biotechnology - CNB/ CSIC Microbial Biotechnology Department Fellow of http://obrasocial.lacaixa.es/ Antes de imprimir este mensaje piense bien si es realmente necesario hacerlo. Before you print this e-mail, think well if it is really necessary. |