Recent changes to Home

WikiPage Home modified by Mark_HIlls

Mark_HIlls — Thu, 25 Oct 2012 20:50:57 -0000

--- v5
+++ v6
@@ -2,8 +2,8 @@
 
 #Publication:
 
-**Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells.**
-Conomos D, Stutz1 MD, Hills M, Neumann AA, Bryan TM, Reddel RR, Pickett1 HA.
+**Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells:**
+Conomos D, Stutz MD, Hills M, Neumann AA, Bryan TM, Reddel RR, Pickett HA.
 *The Journal of Cell Biology* (2012)

WikiPage Home modified by Mark_HIlls

Mark_HIlls — Thu, 25 Oct 2012 20:50:27 -0000

--- v4
+++ v5
@@ -57,12 +57,4 @@
 #Author Contact Information:
 
 If you have any questions or comments, or you identify bugs in the code, please contact:
-Mark Hills (mhills@bccrc.ca) 
-Welcome to your wiki!
-
-This is the default page, edit it as you see fit. To add a new page simply reference it within brackets, e.g.: [SamplePage].
-
-The wiki uses [Markdown](/p/motifcounter/wiki/markdown_syntax/) syntax.
-
-[[project_admins]]
-[[download_button]]
+Mark Hills (mhills@bccrc.ca)

WikiPage Home modified by Mark_HIlls

Mark_HIlls — Thu, 25 Oct 2012 20:49:51 -0000

--- v3
+++ v4
@@ -2,19 +2,28 @@
 
 #Publication:
 
-**Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells**
-Conomos D, Stutz1 MD, Hills M, Neumann AA, Bryan TM, Reddel RR, Pickett1 HA
-*The Journal of Cell Biology*
+**Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells.**
+Conomos D, Stutz1 MD, Hills M, Neumann AA, Bryan TM, Reddel RR, Pickett1 HA.
+*The Journal of Cell Biology* (2012)
 
 
 #Dependencies:
 
-   1. Requires samtools set in PATH (REF: Li H. et al. Bioinformatics, 25:2078-9)
+   1. Requires samtools set in PATH (REF: Li H. *et al.* Bioinformatics, 25:2078-9)
    2. Will not execute if BAM header is absent
    3. Expects a 6nt index within bam file name, otherwise will use whole file as identifier
    4. Large files may require >12 Gb RAM to pull out paired ends from motifs
 
 #Introduction:
+
+This program is designed to rapidly pull out reads conatining a specific motif.  Some uses for this code include;
+
+1. Counting the portion of the reads that have a particular nuclear element (SIN, LINE etc.) within a library
+2. Pulling out paired end reads from an element that has transposed to identify the integration site
+3. Counting the number of variant repeats in a minisatellite
+4. Looking for particular DNA binding motifs in ChIP-Seq data
+
+In all cases, the motif to be searched for has to be known prior to the search.  Running the program will initiate a prompt asking for the motif to search for.  Degenerate nucleotides are recognized according to the IUPAC conventions, such that R=G/A, Y=C/T, M=A/C, K=G/T, W=A/T, S=G/C, B=C/G/T, D=A/G/T, H=A/C/T, V=A/C/G, N=A/C/G/T.  In addition, the program will automatically search for motifs in both the oreintation typed, and in the reverse complement unless the -r option is used to prevent reverse complement analysis. 
 
 #Usage:
 
@@ -29,7 +38,7 @@
 -v          Verbose output
 -h          Prints help page
 
-#Example
+#Worked Example:
 
 To look for telomere repeats (TTAGGG) in your data, assume you need 6 TTAGGG, TCAGGG or TGAGGG repeats, and that they can feature anywhere in your read (i.e. they do not need to be consecutive).  Program will work on all files present in the specifies directory.
 
@@ -45,7 +54,10 @@
 -> Please input number of repeats:  6
 ~~~~~~
 
+#Author Contact Information:
 
+If you have any questions or comments, or you identify bugs in the code, please contact:
+Mark Hills (mhills@bccrc.ca) 
 Welcome to your wiki!
 
 This is the default page, edit it as you see fit. To add a new page simply reference it within brackets, e.g.: [SamplePage].

WikiPage Home modified by Mark_HIlls

Mark_HIlls — Thu, 25 Oct 2012 20:30:15 -0000

--- v2
+++ v3
@@ -1,24 +1,22 @@
-**motif_counter - Analysis Tool for Motif-Parsing in High Throughput Sequencing**
+#**motif_counter - Analysis Tool for Motif-Parsing in High Throughput Sequencing**
 
-**Publication:**
+#Publication:
 
-Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells
-
+**Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells**
 Conomos D, Stutz1 MD, Hills M, Neumann AA, Bryan TM, Reddel RR, Pickett1 HA
-
-*The Journal of Cell Biology* 
+*The Journal of Cell Biology*
 
 
-**Dependencies:**
+#Dependencies:
 
    1. Requires samtools set in PATH (REF: Li H. et al. Bioinformatics, 25:2078-9)
    2. Will not execute if BAM header is absent
    3. Expects a 6nt index within bam file name, otherwise will use whole file as identifier
    4. Large files may require >12 Gb RAM to pull out paired ends from motifs
 
-**Introduction:**
+#Introduction:
 
-**Usage:**
+#Usage:
 
 -i          PATH Specifies the input folder (default is current folder)
 -o          STR Output file name (default 'Pattern_Counter')
@@ -31,7 +29,7 @@
 -v          Verbose output
 -h          Prints help page
 
-**Example**
+#Example
 
 To look for telomere repeats (TTAGGG) in your data, assume you need 6 TTAGGG, TCAGGG or TGAGGG repeats, and that they can feature anywhere in your read (i.e. they do not need to be consecutive).  Program will work on all files present in the specifies directory.

WikiPage Home modified by Mark_HIlls

Mark_HIlls — Thu, 25 Oct 2012 18:43:33 -0000

--- v1
+++ v2
@@ -1,3 +1,53 @@
+**motif_counter - Analysis Tool for Motif-Parsing in High Throughput Sequencing**
+
+**Publication:**
+
+Variant repeats are interspersed throughout the telomeres and recruit nuclear receptors in ALT cells
+
+Conomos D, Stutz1 MD, Hills M, Neumann AA, Bryan TM, Reddel RR, Pickett1 HA
+
+*The Journal of Cell Biology* 
+
+
+**Dependencies:**
+
+   1. Requires samtools set in PATH (REF: Li H. et al. Bioinformatics, 25:2078-9)
+   2. Will not execute if BAM header is absent
+   3. Expects a 6nt index within bam file name, otherwise will use whole file as identifier
+   4. Large files may require >12 Gb RAM to pull out paired ends from motifs
+
+**Introduction:**
+
+**Usage:**
+
+-i          PATH Specifies the input folder (default is current folder)
+-o          STR Output file name (default 'Pattern_Counter')
+-p          Creates file with corresponding pair end reads from motif reads
+-q INT      Minimum mapping quality score for read counts (default 20)
+-Q INT      Minimum mapping quality score for finding repeats (default 0)
+-r          Suppress reverse complement analysis
+-s          Creates folder if motif-only bam files (required for -p)
+-u          Uncoupled repeat analysis
+-v          Verbose output
+-h          Prints help page
+
+**Example**
+
+To look for telomere repeats (TTAGGG) in your data, assume you need 6 TTAGGG, TCAGGG or TGAGGG repeats, and that they can feature anywhere in your read (i.e. they do not need to be consecutive).  Program will work on all files present in the specifies directory.
+
+-s will generate bam files containing all reads that have 6 telomeres
+-u will look for 6 instances of a telomere throughout the read; without this option, it will look for consecutive sequences (i.e. TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG).
+-p will pull out all paired end reads to the telomere reads (eg. if user needed to look for telomere-adjacent sequences, can use telomere read to 'fish' paired-end, specific read.
+-v gives verbose output
+
+~~~~~~
+$ sh motif_counter.sh -s -u -p -v
+
+-> Please input sequence motif to search:  TBAGGG
+-> Please input number of repeats:  6
+~~~~~~
+
+
 Welcome to your wiki!
 
 This is the default page, edit it as you see fit. To add a new page simply reference it within brackets, e.g.: [SamplePage].

WikiPage Home modified by Mark_HIlls

Mark_HIlls — Thu, 18 Oct 2012 00:11:06 -0000

Welcome to your wiki! This is the default page, edit it as you see fit. To add a new page simply reference it within brackets, e.g.: [SamplePage]. The wiki uses [Markdown](/p/motifcounter/wiki/markdown_syntax/) syntax. [[project_admins]] [[download_button]]