#6 Problems with "Melting"

[Anonymous]

Hello,

I am having two problems with using this on-line software.

1. It generates an error message stating that my sequences are not DNA, while I paste specific DNA sequences "TGGTATTACTGCTCAACAAGC" and "ACCATAATGACGAGTTGTTCG" for a complement strand.
2. I am getting an error message indicating that my sequences are longer than default of 60 nt, whihc are not.
   Can you provide aome inputs on what is possible wrong? Thank you very much.

Marina Eremeeva

[Nicolas Rodriguez]

Which url are you using exactly ?