From: <pj...@sa...> - 2004-05-21 08:56:18
|
Madhura, The constraint applies to the DoTS.GeneFeature.ReviewStatus. The dictionary table SRes.ReviewStatus is probably not populated, hence you need some more XML!!! I have not tested this but it is quite simple. Yes, I have added it to my "list of XML files to put in CVS". <SRes::ReviewStatus> <REVIEW_STATUS_ID>5</REVIEW_STATUS_ID> <NAME>Unknown</NAME> <DESCRIPTION>Review status not known</DESCRIPTION> <SRes::ReviewStatus> <SRes::ReviewStatus> <REVIEW_STATUS_ID>10</REVIEW_STATUS_ID> <NAME>Not reviewed</NAME> <DESCRIPTION>A human has not yet reviewed this feature</DESCRIPTION> <SRes::ReviewStatus> <SRes::ReviewStatus> <REVIEW_STATUS_ID>15</REVIEW_STATUS_ID> <NAME>Annotated</NAME> <DESCRIPTION>Annotator/Curator has attached data to this feature</DESCRIPTION> <SRes::ReviewStatus> Quoting Madhura Sharangpani <sma...@st...>: > > Hi Paul > > After reading your email, I setted up Dots.SequenceType tables with required > ds-DNA entries and then tried loading EMBL files again, this time it made > progress, it didn't give "can't fine sequence type ds-DNA" error, but it > went ahead and gave following error: > > ********************************************** > buildRNA() : DoTS.RNA created. > buildRNAInstance() : $rna_object->getId() = > buildRNAInstance() : Creating brand new RNAInstance > Object type is 'GUS::Model::DoTS::GeneFeature', $object = > GUS::Model::DoTS::Gene > Feature=HASH(0x173113c) > DBD::Oracle::st execute failed: ORA-02291: integrity constraint > (DOTS.NAFEATUREI > MP_FK08) violated - parent key not found (DBD ERROR: OCIStmtExecute) at > /afs/ir/ > users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145. > > SQL ERROR!! involving > > INSERT INTO DoTS.GeneFeature ( gene_type, row_user_id, user_write, > group_wr > ite, na_sequence_id, row_project_id, name, is_partial, product, is_pseudo, > revie > w_status_id, subclass_view, group_read, row_group_id, other_read, > modification_d > ate, is_predicted, user_read, row_alg_invocation_id, other_write, > na_feature_id, > number_of_exons ) > VALUES ( ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, SYSDATE, ?, ?, > ?, ? > , ?, ? ) > Values: protein coding, 1, 1, 1, 49, 1, BP0001, 0, glucose inhibited > division p > rotein A, 0, 5, GeneFeature, 1, 1, 1, 1, 1, 99, 0, 1, 1 at > /afs/ir/users/s/m/sma > dhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185 > > GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0xb791a > 8)', '^J SQL ERROR!! involving^J ^J INSERT INTO DoTS.GeneFeature ( > ge...') c > alled at > /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm l > ine 148 > ********************************************** > > Madhura > > > > ----- Original Message ----- > From: <pj...@sa...> > To: "Madhura Sharangpani" <sma...@st...> > Cc: <gus...@li...> > Sent: Thursday, May 20, 2004 3:25 AM > Subject: Re: [Gusdev-gusdev] Problem loading EMBL files into GUS > > > > Madhura, > > > > Did you setup the DoTS.SequenceType tables? > > I presume it can't find ds-DNA in there (and doesn't report it - I shall > improve > > the plugin). > > See: GUS/Website/htdocs/documentation/installguide_UGA.html > > and do a search for ds-DNA to find all the INSERT statements for ss-DNA, > ds-DNA, > > ss-RNA etc. I'm guessing we used those statements here at Sanger. > > > > All, > > > > On a slightly related note, I do have a collection of XML files that > populate > > dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. > Someone > > emailed the list and said it would be good to have this somewhere, perhaps > CVS. > > I agree, although we would need to have "common" and "center specific" > > dirctories. I am in the process of setting up a new GUS instance so I will > soon > > be in a better position to propose something. > > > > Paul. > > > > Quoting Madhura Sharangpani <sma...@st...>: > > > > > Hi All > > > > > > I am trying to load EMBL files into GUS, but having some problems, > > > when I try to execute the command : > > > > > > ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl > > > -filepath=b.pertussis.embl -sequencetype=ds-DNA > > > > > > without commit, I get the following error: > > > > > > ********************************************************* > > > ***COMMIT TURNED OFF*** > > > Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log'; > > > > > > embl file to parse, b.bronchiseptica.embl... > > > ID line fine!!! > > > source feature found, FT source 1..5339179!! > > > processing bioperl sequence, BB... > > > sequence not in GUS yet > > > can't find SequenceType, ds-DNA > > > number of features = 5009 > > > organism, taxon id: Bordetella bronchiseptica, > > > DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into > > > ("DOTS"."NASE > > > QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at > > > /afs/ir/users/s/m/ > > > smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145. > > > > > > (after this along sequence is printed) > > > > > > > ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGC > TCTT > > > TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, > 1825282, > > > 0 > > > at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm > line > > > 18 > > > 5 > > > > > > > *************************************************************************** > > > Can someone tell me why this error is occuring? > > > > > > Thanks! > > > > > > Madhura > > > > > > > > > > |