Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[MICHAEL L. <lu...@cs...>]

I've encountered this SequenceType problem before also.  Some plug-ins
have database specific arguements in them regarding this table.
In my opinion it is another prime candidate for a "common" xml
instantiation file.
Maybe we should start making a list/asking for candidates of tables that
are common enough/generic enough to be used by everyone?

Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Thu, 20 May 2004, Steve Fischer wrote:

> paul-
>
> the xml files would be very helpful.   a cbil, we are about to setup a
> new instance... on PostgreSQL.    this will be our first new instance in
> years, so we'll also be trying to compile docs and data.
>
> steve
>
> pj...@sa... wrote:
>
> >Madhura,
> >
> >Did you setup the DoTS.SequenceType tables?
> >I presume it can't find ds-DNA in there (and doesn't report it - I shall improve
> >the plugin).
> >See: GUS/Website/htdocs/documentation/installguide_UGA.html
> >and do a search for ds-DNA to find all the INSERT statements for ss-DNA, ds-DNA,
> >ss-RNA etc. I'm guessing we used those statements here at Sanger.
> >
> >All,
> >
> >On a slightly related note, I do have a collection of XML files that populate
> >dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. Someone
> >emailed the list and said it would be good to have this somewhere, perhaps CVS.
> >I agree, although we would need to have "common" and "center specific"
> >dirctories. I am in the process of setting up a new GUS instance so I will soon
> >be in a better position to propose something.
> >
> >Paul.
> >
> >Quoting Madhura Sharangpani <sma...@st...>:
> >
> >
> >
> >>Hi All
> >>
> >>I am trying to load EMBL files into GUS, but having some problems,
> >>when I try to execute the command :
> >>
> >>ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> >>-filepath=b.pertussis.embl -sequencetype=ds-DNA
> >>
> >>without commit, I get the following error:
> >>
> >>*********************************************************
> >>***COMMIT TURNED OFF***
> >>Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> >>
> >>embl file to parse, b.bronchiseptica.embl...
> >>ID line fine!!!
> >>source feature found, FT   source          1..5339179!!
> >>processing bioperl sequence, BB...
> >>sequence not in GUS yet
> >>can't find SequenceType, ds-DNA
> >>number of features = 5009
> >>organism, taxon id: Bordetella bronchiseptica,
> >>DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> >>("DOTS"."NASE
> >>QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> >>/afs/ir/users/s/m/
> >>smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> >>
> >>(after this along sequence is printed)
> >>
> >>ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
> >>TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, 1825282,
> >>0
> >>at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> >>18
> >>5
> >>
> >>***************************************************************************
> >>Can someone tell me why this error is occuring?
> >>
> >>Thanks!
> >>
> >>Madhura
> >>
> >>
> >>
> >
> >
> >
> >
> >
> >-------------------------------------------------------
> >This SF.Net email is sponsored by: Oracle 10g
> >Get certified on the hottest thing ever to hit the market... Oracle 10g.
> >Take an Oracle 10g class now, and we'll give you the exam FREE.
> >http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> >
>