Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[<pj...@sa...>]

Quoting Sucheta Tripathy <su...@vb...>:

> Hi,
> 
> Does it mean that GenericParser2GUS can upload data from signalP, TMHMM
> and other data?

As long as the data is in an EMBL file.
In theory it could be any file Bioperl understands though but this has not been
tested.

> Thanks
> 
> Sucheta
> >
> > Did you setup the DoTS.SequenceType tables?
> > I presume it can't find ds-DNA in there (and doesn't report it - I shall
> > improve
> > the plugin).
> > See: GUS/Website/htdocs/documentation/installguide_UGA.html
> > and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
> > ds-DNA,
> > ss-RNA etc. I'm guessing we used those statements here at Sanger.
> >
> > All,
> >
> > On a slightly related note, I do have a collection of XML files that
> > populate
> > dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
> > Someone
> > emailed the list and said it would be good to have this somewhere, perhaps
> > CVS.
> > I agree, although we would need to have "common" and "center specific"
> > dirctories. I am in the process of setting up a new GUS instance so I will
> > soon
> > be in a better position to propose something.
> >
> > Paul.
> >
> > Quoting Madhura Sharangpani <sma...@st...>:
> >
> >> Hi All
> >>
> >> I am trying to load EMBL files into GUS, but having some problems,
> >> when I try to execute the command :
> >>
> >> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> >> -filepath=b.pertussis.embl -sequencetype=ds-DNA
> >>
> >> without commit, I get the following error:
> >>
> >> *********************************************************
> >> ***COMMIT TURNED OFF***
> >> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> >>
> >> embl file to parse, b.bronchiseptica.embl...
> >> ID line fine!!!
> >> source feature found, FT   source          1..5339179!!
> >> processing bioperl sequence, BB...
> >> sequence not in GUS yet
> >> can't find SequenceType, ds-DNA
> >> number of features = 5009
> >> organism, taxon id: Bordetella bronchiseptica,
> >> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> >> ("DOTS"."NASE
> >> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> >> /afs/ir/users/s/m/
> >> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> >>
> >> (after this along sequence is printed)
> >>
> >>
> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
> >> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
> >> 1825282,
> >> 0
> >> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> >> line
> >> 18
> >> 5
> >>
> >>
> ***************************************************************************
> >> Can someone tell me why this error is occuring?
> >>
> >> Thanks!
> >>
> >> Madhura
> >>
> >
> >
> >
> >
> >
> > -------------------------------------------------------
> > This SF.Net email is sponsored by: Oracle 10g
> > Get certified on the hottest thing ever to hit the market... Oracle 10g.
> > Take an Oracle 10g class now, and we'll give you the exam FREE.
> > http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> > _______________________________________________
> > Gusdev-gusdev mailing list
> > Gus...@li...
> > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> 
> 
> -- 
> Sucheta Tripathy
> Virginia Bioinformatics Institute Phase-I
> Washington street.
> Virginia Tech.
> Blacksburg,VA 24061-0447
> phone:(540)231-8138
> Fax:  (540) 231-2606
>