Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[Sucheta T. <su...@vb...>]

Hi,

Does it mean that GenericParser2GUS can upload data from signalP, TMHMM
and other data?

Thanks

Sucheta
>
> Did you setup the DoTS.SequenceType tables?
> I presume it can't find ds-DNA in there (and doesn't report it - I shall
> improve
> the plugin).
> See: GUS/Website/htdocs/documentation/installguide_UGA.html
> and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
> ds-DNA,
> ss-RNA etc. I'm guessing we used those statements here at Sanger.
>
> All,
>
> On a slightly related note, I do have a collection of XML files that
> populate
> dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
> Someone
> emailed the list and said it would be good to have this somewhere, perhaps
> CVS.
> I agree, although we would need to have "common" and "center specific"
> dirctories. I am in the process of setting up a new GUS instance so I will
> soon
> be in a better position to propose something.
>
> Paul.
>
> Quoting Madhura Sharangpani <sma...@st...>:
>
>> Hi All
>>
>> I am trying to load EMBL files into GUS, but having some problems,
>> when I try to execute the command :
>>
>> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
>> -filepath=b.pertussis.embl -sequencetype=ds-DNA
>>
>> without commit, I get the following error:
>>
>> *********************************************************
>> ***COMMIT TURNED OFF***
>> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
>>
>> embl file to parse, b.bronchiseptica.embl...
>> ID line fine!!!
>> source feature found, FT   source          1..5339179!!
>> processing bioperl sequence, BB...
>> sequence not in GUS yet
>> can't find SequenceType, ds-DNA
>> number of features = 5009
>> organism, taxon id: Bordetella bronchiseptica,
>> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
>> ("DOTS"."NASE
>> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
>> /afs/ir/users/s/m/
>> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
>>
>> (after this along sequence is printed)
>>
>> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
>> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
>> 1825282,
>> 0
>> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
>> line
>> 18
>> 5
>>
>> ***************************************************************************
>> Can someone tell me why this error is occuring?
>>
>> Thanks!
>>
>> Madhura
>>
>
>
>
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by: Oracle 10g
> Get certified on the hottest thing ever to hit the market... Oracle 10g.
> Take an Oracle 10g class now, and we'll give you the exam FREE.
> http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>


-- 
Sucheta Tripathy
Virginia Bioinformatics Institute Phase-I
Washington street.
Virginia Tech.
Blacksburg,VA 24061-0447
phone:(540)231-8138
Fax:  (540) 231-2606