Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[<pj...@sa...>]

Madhura,

Did you setup the DoTS.SequenceType tables?
I presume it can't find ds-DNA in there (and doesn't report it - I shall improve
the plugin).
See: GUS/Website/htdocs/documentation/installguide_UGA.html
and do a search for ds-DNA to find all the INSERT statements for ss-DNA, ds-DNA,
ss-RNA etc. I'm guessing we used those statements here at Sanger.

All,

On a slightly related note, I do have a collection of XML files that populate
dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. Someone
emailed the list and said it would be good to have this somewhere, perhaps CVS.
I agree, although we would need to have "common" and "center specific"
dirctories. I am in the process of setting up a new GUS instance so I will soon
be in a better position to propose something.

Paul.

Quoting Madhura Sharangpani <sma...@st...>:

> Hi All
> 
> I am trying to load EMBL files into GUS, but having some problems,
> when I try to execute the command :
> 
> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> -filepath=b.pertussis.embl -sequencetype=ds-DNA
> 
> without commit, I get the following error:
> 
> *********************************************************
> ***COMMIT TURNED OFF***
> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> 
> embl file to parse, b.bronchiseptica.embl...
> ID line fine!!!
> source feature found, FT   source          1..5339179!!
> processing bioperl sequence, BB...
> sequence not in GUS yet
> can't find SequenceType, ds-DNA
> number of features = 5009
> organism, taxon id: Bordetella bronchiseptica,
> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> ("DOTS"."NASE
> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> /afs/ir/users/s/m/
> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> 
> (after this along sequence is printed)
> 
> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, 1825282,
> 0
> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> 18
> 5
>         
> ***************************************************************************
> Can someone tell me why this error is occuring?
> 
> Thanks!
> 
> Madhura
>