Menu
▾
▴
Re: [Gusdev-gusdev] GBParser - problems with the perl modules
|
From: Thomas O. <th...@gm...> - 2004-02-04 16:43:31
|
Hi Steve,
that's it!
Thanks a lot,
Thomas
> thomas-
>
> i found the problem. it is the last line of your file:
>
> 40921 cctcttccac ttcgtttcat tcttccaaca cctgcagccc caaatccatt
> tctaccgtct
> 40981 acaagagttg gaggtctttc tcataatcat ctattcattc cccatcaacc
> gtttactact
> 41041 cttgtttcga ccgattctag atattctgca ccgaaccctc tttctcatcg
> acttccaaac
> 41101 gagatttgcc gagttcatat gaattcaaat cctttccatt tttagtttta
> ttactctacc
> 41161 aaataattaa acagactttt cctatcgggt cccctaattt tctttcattt
> ttcaggcatc
> 41221 tcggttgttt ttttcaaagt attttgacct aattttccat gttgaaatta
> ataaaatatt
> 41281 tattaaatga acacaaacac agatgttgga attgtcttct tctggtcaag
> tactggatat
> 41341 actctctttt tttgataatg ctgaattga
> //
>
>
> the '//' is confusing the parser into thinking that there is another
> entry.
>
> to workaround this bug delete that line from your file.
>
> steve
>
> Thomas Otto wrote:
>
> >Hi Steve,
> >
> >I send you a sequence...
> >
> >Maybe I have an idea why I have so much problems. Is it possible, that
> the
> >Oracle is kind of delaying? I just retried to insert the first test
> sequences,
> >and today it worked!!??!!
> >The one I send you doesn't work - same error. So what could it be? The
> only
> >logic thing, would be the DB... (I am using Red Hat and Oracle 9.2 -
> there
> >are not certificaded together - I am just working on a testsystem, later
> on we
> >will put it on a 'real' server...)
> >
> >So, could this be?
> >
> >This would explain also other problems I had...
> >
> >- Thomas
> >
> >
> >
> >
> >>thomas-
> >>
> >>i think the error message is important, because it causes the plugin to
> >>abort.
> >>
> >>can you send a file?
> >>
> >>steve
> >>
> >>Thomas Otto wrote:
> >>
> >>
> >>
> >>>Steve-
> >>>I just picked one of the 'trypanosoma cruzi'... maybe just give me one
> >>>
> >>>
> >>that
> >>
> >>
> >>>should work.
> >>>
> >>>I tried also other entries...
> >>>One thing is, that I can only try it with some entries, where I have
> the
> >>>taxon in the DB. I couldn't install it totaly, because the ga wanted
> more
> >>>
> >>>
> >>memory
> >>
> >>
> >>>than my swap of 1GB could give him...
> >>>
> >>>Actually I do not know, what the error means:
> >>>Can't call method "getAccession" on an undefined value at
> >>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> >>>218, <GEN0> line 61.
> >>>maybe it is not so important, because the data seem to be in the
> >>>
> >>>
> >>database...
> >>
> >>
> >>>Thomas
> >>>
> >>>
> >>>
> >>>
> >>>
> >>>>debbie-
> >>>>
> >>>>we need to help thomas succeed in his use of the GBParser.
> >>>>
> >>>>do you have any ideas? would it make sense to get his input file
> from
> >>>>him and try to run it here?
> >>>>
> >>>>looking at the code, the problem seems that he is trying to get the
> >>>>first ACCESSION field from his file, but it is not found
> >>>>
> >>>> ## Check NAEntry for update
> >>>> my $naentry = GUS::Model::DoTS::NAEntry->new({'source_id' =>
> >>>>$e->{'ACCESSION'}->[0]->getAccession(),
> >>>> });
> >>>>
> >>>>
> >>>>thomas- how big is the file you are trying to parse? if its not too
> >>>>big, why don't you send it.
> >>>>
> >>>>
> >>>>steve
> >>>>
> >>>>
> >>>>Thomas Otto wrote:
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>Steve-
> >>>>>
> >>>>>I just downloaded the version anothertime with cvs and did an
> install.
> >>>>>
> >>>>>here the call and the log:
> >>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1
> >>>>>--file=/seq/tcruzi.fcgi --commit 2>&1| tee sonstiges/GBParser.log
> >>>>>Reading properties from
> /home/oracle/gus_home/config/GUS-PluginMgr.prop
> >>>>>Reading properties from /home/oracle/.gus.properties
> >>>>>Tue Feb 3 15:24:34 2004 COMMIT commit on
> >>>>>Maximum number of objects set to 50000
> >>>>>Tue Feb 3 15:24:34 2004 RELEASE 1
> >>>>>
> >>>>>Tue Feb 3 15:24:34 2004 FILE /seq/tcruzi.fcgi
> >>>>>
> >>>>>VLD CBIL::Bio::GenBank::Locus 1
> >>>>>VLD CBIL::Bio::GenBank::Definition 1
> >>>>>VLD CBIL::Bio::GenBank::Accession 1
> >>>>>VLD CBIL::Bio::GenBank::Version 1
> >>>>>VLD CBIL::Bio::GenBank::Keywords 1
> >>>>>VLD CBIL::Bio::GenBank::Source 1
> >>>>>VLD CBIL::Bio::GenBank::Reference 1
> >>>>>VLD CBIL::Bio::GenBank::Reference 1
> >>>>>RUN 1..2961
> >>>>>VLD CBIL::Bio::GenBank::Features 1
> >>>>>VLD CBIL::Bio::GenBank::Origin 1
> >>>>>Tue Feb 3 15:24:35 2004 STATUS N=1 ACC=AC116948
> >>>>>TOTAL_OBJECTS=16
> >>>>>Tue Feb 3 15:24:35 2004 Genbank entries inserted= 0;
> updated=
> >>>>>
> >>>>>
> >>0;
> >>
> >>
> >>>>>total #(inserted::updated::deleted)=16::::
> >>>>>
> >>>>>Tue Feb 3 15:24:35 2004 FAILURES Unable to process 1
> >>>>>
> >>>>>
> >>>>>
> >>>>>
> >>>>entries.
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>See gbparserFailures/
> >>>>>Tue Feb 3 15:24:35 2004 RESULT Genbank entries inserted= 0;
> >>>>>updated= 0; failed= 1
> >>>>>
> >>>>>The errorfile
> >>>>>cat gbparserFailures/errors
> >>>>>------------------ entry number 2 -----------------
> >>>>>Can't call method "getAccession" on an undefined value at
> >>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> >>>>>218, <GEN0> line 84.
> >>>>>
> >>>>>
> >>>>>Cheers,
> >>>>>Thomas
> >>>>>
> >>>>>
> >>>>>
> >>>>>
> >>>>>
> >>>>>
> >>>>>
> >>>>>>thomas-
> >>>>>>
> >>>>>>please send me your version of the GBParser.pm and the complete
> log...
> >>>>>>
> >>>>>>
> >>
> >>
> >>
> >>>>>>
> >>>>>>
> >>>>>>that might help me figure out what is wrong.
> >>>>>>
> >>>>>>steve
> >>>>>>
> >>>>>>Thomas Otto wrote:
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>Steve,
> >>>>>>>
> >>>>>>>true, I had to install the taxon stuff. The datas are inserted in
> the
> >>>>>>>NAseqenceimp table
> >>>>>>>
> >>>>>>>But now I get an error- (this is not the first call!!!)
> >>>>>>>Tue Feb 3 11:21:25 2004 Genbank entries inserted= 0;
> >>>>>>>
> >>>>>>>
> >>updated=
> >>
> >>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>0;
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>total #(inserted::updated::deleted)=16::::
> >>>>>>>
> >>>>>>>Tue Feb 3 11:21:25 2004 FAILURES Unable to process 1
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>entries.
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>See gbparserFailures/
> >>>>>>>Tue Feb 3 11:21:25 2004 RESULT Genbank entries inserted=
> 0;
> >>>>>>>updated= 0; failed= 1
> >>>>>>>[oracle@localhost oracle]$ less gbparserFailures/errors
> >>>>>>>...
> >>>>>>>Can't call method "getAccession" on an undefined value at
> >>>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> >>>>>>>
> >>>>>>>
> >>218,
> >>
> >>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>><GEN0> line 84.
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>Is this important?
> >>>>>>>
> >>>>>>>-Thomas
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>>thomas-
> >>>>>>>>
> >>>>>>>>do you know how to check the oracle system tables to see which
> >>>>>>>>
> >>>>>>>>
> >>foreign
> >>
> >>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>key is causing the "integrity constraint?"
> >>>>>>>>
> >>>>>>>>if not, i can send you a query to run.
> >>>>>>>>
> >>>>>>>>debbie and I looked it up, and it is the taxon_id that is failing.
>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>this is because the genbank parser requires you to fill in the
> taxon
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>tables (because the genbank records refer to taxon).
> >>>>>>>>
> >>>>>>>>take a look at fidel and sucheta's user guide on
> >>>>>>>>http://www.gusdb.org/documentation.html. i believe they discuss
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>this.
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>steve
> >>>>>>>>
> >>>>>>>>Thomas Otto wrote:
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>Hi Deborah,
> >>>>>>>>>
> >>>>>>>>>you are right, the values are testvalues. But there are also in
> the
> >>>>>>>>>sres.ExternalDatabaseRelease... is the gbRel so important? - I
> >>>>>>>>>
> >>>>>>>>>
> >>didn't
> >>
> >>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>see
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>that it is
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>as a foreign key...
> >>>>>>>>>
> >>>>>>>>>Here the entrance of the sres.externaldatabaserelease:
> >>>>>>>>>135 | 1 | 15-JAN-04 | 10 | tcrzidb.org | | | | | The
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>genom
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>of
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>the tcruzi virus | /seq/tcruzi.fcgi | | | | 29-JAN-04 |
> 1
> >>>>>>>>>
> >>>>>>>>>
> >>|
> >>
> >>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>1
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>|
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>1 |
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>1 | 1 | 0 | 6 | 3 | 2 | 1
> >>>>>>>>>and the modul call:
> >>>>>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
> >>>>>>>>>--file=/seq/tcruzi.fcgi --start=1 --commit
> >>>>>>>>>
> >>>>>>>>>It gives the same error...
> >>>>>>>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>>>>>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD
> >>>>>>>>>
> >>>>>>>>>
> >>ERROR:
> >>
> >>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>OCIStmtExecute) ...
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>Which part of the programm should manipulate the table
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>DOTS.NASEQUENCEIMP
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>?
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>Thomas
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>>Hi Thomas,
> >>>>>>>>>>
> >>>>>>>>>>Apparently Steve is looking into this but I notice that
> >>>>>>>>>>external_database_release_id (--db_rel_id) is 135 and the
> genbank
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>release
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat
> >>>>>>>>>>
> >>>>>>>>>>
> >>recent
> >>
> >>
> >>>>>>>>>>release of GenBank although it could also be a valid
> >>>>>>>>>>external_database_release_id in your ExternalDatabaseRelease
> table
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>while
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>>>>1.05 doesn't look like a gb release number at all. I wonder if
> >>>>>>>>>>
> >>>>>>>>>>
> >>your
> >>
> >>
> >>>>>>>>>>failure is due to a foreign key constraint referencing
> >>>>>>>>>>ExternalDatabaseRelease because you actually don't have a PK in
> >>>>>>>>>>
> >>>>>>>>>>
> >>that
> >>
> >>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>table
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>>of 135. Easy to check.
> >>>>>>>>>>
> >>>>>>>>>> Debbie
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>On Fri, 30 Jan
> >>>>>>>>>>2004, Steve
> >>>>>>>>>>Fischer wrote:
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>>thomas-
> >>>>>>>>>>>
> >>>>>>>>>>>i don't have time right now to look into this (i am home and
> need
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>to
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>>>take my daughter to skating lesson). i will as soon as i can.
> >>>>>>>>>>>
> >>>>>>>>>>>steve
> >>>>>>>>>>>
> >>>>>>>>>>>Thomas Otto wrote:
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>
> >>>>>>>>>>>>Hello -
> >>>>>>>>>>>>
> >>>>>>>>>>>>I am still fighting with the perl moduls.
> >>>>>>>>>>>>
> >>>>>>>>>>>>I.e. the GBParser to upload Genbank datasets gives following
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>error:
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >>>>>>>>>>>>--file=/seq/tcruzi_3.fcgi --commit
> >>>>>>>>>>>>
> >>>>>>>>>>>>------------------ entry number 2 -----------------
> >>>>>>>>>>>>
> >>>>>>>>>>>>SQL ERROR!! involving
> >>>>>>>>>>>>
> >>>>>>>>>>>>INSERT INTO DoTS.ExternalNASequence ( sequence, group_read,
> >>>>>>>>>>>>sequence_type_id, user_read, other_write, modification_date,
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>subcla
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>>>>>>>>>external_database_release_id, source_id, g_count, c_count,
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>taxon_id,
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>nam
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>>>e, secondary_identifier, description, row_user_id, a_count,
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>t_count,
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>length,
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>>>>>>>>>, na_sequence_id )
> >>>>>>>>>>>>VALUES ( ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '',
> '',
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>?,
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>?,
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )
> >>>>>>>>>>>>
> >>>>>>>>>>>>Values:
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
>
>>>>>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >>>>>>
> >>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1,
> 1,
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>0,
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502,
> GI:4
> >>>>>>>>>>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone
> 31
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>Trypanosoma
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>>>cruzi Berenice putative chimeric protein gene, partial
> >>>>>>>>>>>>cds., 1, 177, 1, 28, 1, 1 at
> >>>>>>>>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>185
> >>
> >>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
>
>>>>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
> >>>>>>
> >>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>SQL ERROR!! involving\x{a} \x{a} INSE
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>>>RT INTO DoTS.ExternalNASequ...') called at
> >>>>>>>>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>148
> >>
> >>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
>
>>>>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >>>>>>
> >>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>
> >>>>>>>>>>>>)','ARRAY(0x9118ca4)','\x{a} INSERT INTO
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>DoTS.ExternalNASequence
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>(
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>>>>>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >>>>>>>>>>>>rl/GUS/ObjRelP/DbiRow.pm line 674
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
> >>>>>>>>>>>>
>
>>>>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
> >>>>>>
> >>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>>
> >>>>>>>>called at /
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
> >>>>>>>>
>
>
>
> -------------------------------------------------------
> The SF.Net email is sponsored by EclipseCon 2004
> Premiere Conference on Open Tools Development and Integration
> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> http://www.eclipsecon.org/osdn
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
|
