Re: [Gusdev-gusdev] GBParser - problems with the perl modules

SourceForge Headquarters 225 Broadway Suite 1600 San Diego, CA 92101 +1 (858) 422-6466

Steve-

I just downloaded the version anothertime with cvs and did an install.

here the call and the log:
 ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1
--file=/seq/tcruzi.fcgi --commit 2>&1| tee sonstiges/GBParser.log
Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
Reading properties from /home/oracle/.gus.properties
Tue Feb  3 15:24:34 2004        COMMIT  commit on
Maximum number of  objects set to 50000
Tue Feb  3 15:24:34 2004        RELEASE 1

Tue Feb  3 15:24:34 2004        FILE    /seq/tcruzi.fcgi

VLD     CBIL::Bio::GenBank::Locus       1
VLD     CBIL::Bio::GenBank::Definition  1
VLD     CBIL::Bio::GenBank::Accession   1
VLD     CBIL::Bio::GenBank::Version     1
VLD     CBIL::Bio::GenBank::Keywords    1
VLD     CBIL::Bio::GenBank::Source      1
VLD     CBIL::Bio::GenBank::Reference   1
VLD     CBIL::Bio::GenBank::Reference   1
RUN     1..2961
VLD     CBIL::Bio::GenBank::Features    1
VLD     CBIL::Bio::GenBank::Origin      1
Tue Feb  3 15:24:35 2004        STATUS  N=1 ACC=AC116948        
TOTAL_OBJECTS=16
Tue Feb  3 15:24:35 2004        Genbank entries inserted= 0;  updated= 0;
total #(inserted::updated::deleted)=16::::

Tue Feb  3 15:24:35 2004        FAILURES        Unable to process 1 entries.
See gbparserFailures/
Tue Feb  3 15:24:35 2004        RESULT  Genbank entries inserted= 0; 
updated= 0;  failed= 1

The errorfile
 cat gbparserFailures/errors
 ------------------ entry number 2 -----------------
Can't call method "getAccession" on an undefined value at
/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
218, <GEN0> line 84.

Cheers,
Thomas

> thomas-
> 
> please send me your version of the GBParser.pm and the complete log...   
> that might help me figure out what is wrong.
> 
> steve
> 
> Thomas Otto wrote:
> 
> >Steve,
> >
> >true, I had to install the taxon stuff. The datas are inserted in the
> >NAseqenceimp table
> >
> >But now I get an error- (this is not the first call!!!)
> >Tue Feb  3 11:21:25 2004        Genbank entries inserted= 0;  updated= 0;
> >total #(inserted::updated::deleted)=16::::
> >
> >Tue Feb  3 11:21:25 2004        FAILURES        Unable to process 1
> entries.
> >See gbparserFailures/
> >Tue Feb  3 11:21:25 2004        RESULT  Genbank entries inserted= 0; 
> >updated= 0;  failed= 1
> >[oracle@localhost oracle]$ less gbparserFailures/errors
> >...
> >Can't call method "getAccession" on an undefined value at
> >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 218,
> <GEN0> line 84.
> >
> >Is this important?
> >
> >-Thomas
> >
> >
> >  
> >
> >>thomas-
> >>
> >>do you know how to check the oracle system tables to see which foreign 
> >>key is causing the "integrity constraint?"
> >>
> >>if not, i can send you a query to run.
> >>
> >>debbie and I looked it up, and it is the taxon_id that is failing.   
> >>this is because the genbank parser requires you to fill in the taxon 
> >>tables (because the genbank records refer to taxon).
> >>
> >>take a look at fidel and sucheta's user guide on 
> >>http://www.gusdb.org/documentation.html.   i believe they discuss this.
> >>
> >>steve
> >>
> >>Thomas Otto wrote:
> >>
> >>    
> >>
> >>>Hi Deborah,
> >>>
> >>>you are right, the values are testvalues. But there are also in the
> >>>sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't
> see
> >>>      
> >>>
> >>that it is
> >>    
> >>
> >>>as a foreign key...
> >>>
> >>>Here the entrance of the sres.externaldatabaserelease:
> >>>135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom
> >>>      
> >>>
> >>of
> >>    
> >>
> >>>the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1
> |
> >>>      
> >>>
> >> 1 |
> >>    
> >>
> >>>1 |  1 |  0 |  6 |  3 |  2 |  1
> >>>and the modul call:
> >>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
> >>>--file=/seq/tcruzi.fcgi --start=1 --commit
> >>>
> >>>It gives the same error...
> >>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR:
> >>>      
> >>>
> >>OCIStmtExecute) ...
> >>    
> >>
> >>>Which part of the programm should manipulate the table
> DOTS.NASEQUENCEIMP
> >>>      
> >>>
> >>?
> >>    
> >>
> >>>Thomas
> >>>
> >>> 
> >>>
> >>>      
> >>>
> >>>>Hi Thomas,
> >>>>
> >>>>Apparently Steve is looking into this but I notice that
> >>>>external_database_release_id (--db_rel_id) is 135 and the genbank
> >>>>        
> >>>>
> >>release
> >>    
> >>
> >>>>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
> >>>>release of GenBank although it could also be a valid
> >>>>external_database_release_id in your ExternalDatabaseRelease table
> while
> >>>>1.05 doesn't look like a gb release number at all. I wonder if your 
> >>>>failure is due to a foreign key constraint referencing 
> >>>>ExternalDatabaseRelease because you actually don't have a PK in that
> >>>>        
> >>>>
> >>table
> >>    
> >>
> >>>>of 135. Easy to check. 
> >>>>
> >>>>                                    Debbie
> >>>>
> >>>>                                             
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>On Fri, 30 Jan 
> >>>>2004, Steve
> >>>>Fischer wrote:
> >>>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>thomas-
> >>>>>
> >>>>>i don't have time right now to look into this (i am home and need to 
> >>>>>take my daughter to skating lesson).  i will as soon as i can.
> >>>>>
> >>>>>steve
> >>>>>
> >>>>>Thomas Otto wrote:
> >>>>>
> >>>>>     
> >>>>>
> >>>>>          
> >>>>>
> >>>>>>Hello -
> >>>>>>
> >>>>>>I am still fighting with the perl moduls.
> >>>>>>
> >>>>>>I.e. the GBParser to upload Genbank datasets gives following error:
> >>>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >>>>>>--file=/seq/tcruzi_3.fcgi --commit
> >>>>>>
> >>>>>>------------------ entry number 2 -----------------
> >>>>>>
> >>>>>>SQL ERROR!! involving
> >>>>>>
> >>>>>>  INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>nam
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>length,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>>>, na_sequence_id )
> >>>>>>  VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '',
> ?,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>?,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> >>>>>>
> >>>>>>Values:
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> >>>>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> >>>>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>Trypanosoma
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>cruzi Berenice putative chimeric protein gene, partial
> >>>>>>cds., 1, 177, 1, 28, 1, 1 at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
> >>>      
> >>>
> >>SQL ERROR!! involving\x{a} \x{a}    INSE
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>RT INTO DoTS.ExternalNASequ...') called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence
> (
> >>>>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >>>>>>rl/GUS/ObjRelP/DbiRow.pm line 674
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
> >>>      
> >>>
> >>called at /
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> >>>      
> >>>
> >>called at /home/oracle/gus_home/lib/per
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>l/GUS/Model/GusRow.pm line 1677
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> >>>      
> >>>
> >>called at /home/oracle/gus_home/lib/perl/
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>GUS/Common/Plugin/GBParser.pm line 284
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>=HASH(0x8ec41bc)') called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> 185
> >>>>>>      eval {...} called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line
> 184
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)')
> >>>      
> >>>
> >>called at /home/oracle
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> >>>>>>      eval {...} called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> >>>>>>            
> >>>>>>
> >>427
> >>    
> >>
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>ser') called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> >>>>>>            
> >>>>>>
> >>283
> >>    
> >>
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>) called at
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>line 192
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> >>>      
> >>>
> >>called at /
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>home/oracle/gus_home/bin/ga line 11
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>on the prompt, following error is to see:
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>********GEtting loc below30
> >>>>>>
> >>>>>>VLD     CBIL::Bio::GenBank::Locus       1
> >>>>>>VLD     CBIL::Bio::GenBank::Definition  1
> >>>>>>VLD     CBIL::Bio::GenBank::Accession   1
> >>>>>>VLD     CBIL::Bio::GenBank::Version     1
> >>>>>>VLD     CBIL::Bio::GenBank::Keywords    1
> >>>>>>VLD     CBIL::Bio::GenBank::Source      1
> >>>>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>>>RUN     1..177
> >>>>>>RUN     1..46
> >>>>>>RUN     <30..>177
> >>>>>>RUN     30..>177
> >>>>>>VLD     CBIL::Bio::GenBank::Features    1
> >>>>>>VLD     CBIL::Bio::GenBank::Origin      1
> >>>>>>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
> >>>>>>TOTAL_OBJECTS=16
> >>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> >>>>>>            
> >>>>>>
> >>genomic
> >>    
> >>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>DNA
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>>>GUS::Model::DoTS::Source        ::      transgenic      ::
> >>>>>>
> >>>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> >>>>>>            
> >>>>>>
> >>genomic
> >>    
> >>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>DNA
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> >>>>>>: OCIStmtExecute) [for Statement "
> >>>>>>  INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>nam
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>length,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>>>, na_sequence_id )
> >>>>>>  VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '',
> ?,
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>?,
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> >>>>>>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>:p15='GI:41056860',
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> >>>>>>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>>>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> >>>>>>l cds.', :p6='ExternalNASequence',
> >>>>>>:p3='1',
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
>
>>>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa',
> >>>      
> >>>
> >>:p7='1', :p17='1', :p22=1, :p9=1, :
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>p11=135] at
> /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>line
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>145, <GEN0> line 112.
> >>>>>>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0; 
> updated=
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>0;
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>total #(inserted::updated::deleted)=16::::
> >>>>>>
> >>>>>>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>entries.
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>See gbparserFailures/
> >>>>>>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
> >>>>>>updated= 0;  failed= 2
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by
> the
> >>>>>>perlprogramm. I thought about setting the variables manually, but
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>doesn't
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>make
> >>>>>>sence.
> >>>>>>
> >>>>>>To inserte the values ot the the ExternalDatabaseRelease tables, I
> >>>>>>orientited myself on the
> >>>>>>installguide_UGA.html .
> >>>>>>The registration of the perl class InsertNewExtDbRelease gave
> >>>>>>            
> >>>>>>
> >>following
> >>    
> >>
> >>>>>>error:
> >>>>>>
> >>>>>>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> >>>>>>Reading properties from
> >>>>>>            
> >>>>>>
> >>/home/oracle/gus_home/config/GUS-PluginMgr.prop
> >>    
> >>
> >>>>>>Reading properties from /home/oracle/.gus.properties
> >>>>>>Warning: Use of "require" without parens is ambiguous at (eval 3)
> line
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>1.
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval
> >>>>>>            
> >>>>>>
> >>3)
> >>    
> >>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>line
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>1.
> >>>>>>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed
> >>>>>>            
> >>>>>>
> >>while
> >>    
> >>
> >>>>>>"strict subs" in use at (eval 3) line 1.
> >>>>>>
> >>>>>>
> >>>>>>--------------------------- STACK TRACE -------------------------
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword
> >>>      
> >>>
> >>"pm" not allowed while "strict subs" in use at
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>(eval...') called at
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>>>line 248
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>called at
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>line 664
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>>      
> >>>
> >>>>called at
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> >>>>>>            
> >>>>>>
> >>456
> >>    
> >>
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>called at
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>line 283
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>>      
> >>>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>called at
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>line
> >>>>>>192
> >>>>>>    
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> >>>      
> >>>
> >>called at
> >>    
> >>
> >>>>   
> >>>>
> >>>>        
> >>>>
> >>>>>>/home/oracle/gus_home/bin/ga line 11
> >>>>>>
> >>>>>>I hope, that someone can help me.
> >>>>>>
> >>>>>>I wish a nice weekend and good luck with the grand -
> >>>>>>Thomas
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>>>-------------------------------------------------------
> >>>>>>The SF.Net email is sponsored by EclipseCon 2004
> >>>>>>Premiere Conference on Open Tools Development and Integration
> >>>>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>>>>http://www.eclipsecon.org/osdn
> >>>>>>_______________________________________________
> >>>>>>Gusdev-gusdev mailing list
> >>>>>>Gus...@li...
> >>>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>>>>
> >>>>>>
> >>>>>>       
> >>>>>>
> >>>>>>            
> >>>>>>
> >>>>>-------------------------------------------------------
> >>>>>The SF.Net email is sponsored by EclipseCon 2004
> >>>>>Premiere Conference on Open Tools Development and Integration
> >>>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>>>http://www.eclipsecon.org/osdn
> >>>>>_______________________________________________
> >>>>>Gusdev-gusdev mailing list
> >>>>>Gus...@li...
> >>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>>>
> >>>>>     
> >>>>>
> >>>>>          
> >>>>>
> >>>
> >>>-------------------------------------------------------
> >>>The SF.Net email is sponsored by EclipseCon 2004
> >>>Premiere Conference on Open Tools Development and Integration
> >>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>http://www.eclipsecon.org/osdn
> >>>_______________________________________________
> >>>Gusdev-gusdev mailing list
> >>>Gus...@li...
> >>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>> 
> >>>
> >>>      
> >>>
> 