Re: [Gusdev-gusdev] GBParser - problems with the perl modules

SourceForge Headquarters 225 Broadway Suite 1600 San Diego, CA 92101 +1 (858) 422-6466

Steve,

true, I had to install the taxon stuff. The datas are inserted in the
NAseqenceimp table

But now I get an error- (this is not the first call!!!)
Tue Feb  3 11:21:25 2004        Genbank entries inserted= 0;  updated= 0;
total #(inserted::updated::deleted)=16::::

Tue Feb  3 11:21:25 2004        FAILURES        Unable to process 1 entries.
See gbparserFailures/
Tue Feb  3 11:21:25 2004        RESULT  Genbank entries inserted= 0; 
updated= 0;  failed= 1
[oracle@localhost oracle]$ less gbparserFailures/errors
...
Can't call method "getAccession" on an undefined value at
/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 218, <GEN0> line 84.

Is this important?

-Thomas

> thomas-
> 
> do you know how to check the oracle system tables to see which foreign 
> key is causing the "integrity constraint?"
> 
> if not, i can send you a query to run.
> 
> debbie and I looked it up, and it is the taxon_id that is failing.   
> this is because the genbank parser requires you to fill in the taxon 
> tables (because the genbank records refer to taxon).
> 
> take a look at fidel and sucheta's user guide on 
> http://www.gusdb.org/documentation.html.   i believe they discuss this.
> 
> steve
> 
> Thomas Otto wrote:
> 
> >Hi Deborah,
> >
> >you are right, the values are testvalues. But there are also in the
> >sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't see
> that it is
> >as a foreign key...
> >
> >Here the entrance of the sres.externaldatabaserelease:
> >135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom
> of
> >the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1 |
>  1 |
> > 1 |  1 |  0 |  6 |  3 |  2 |  1
> >and the modul call:
> >ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
> >--file=/seq/tcruzi.fcgi --start=1 --commit
> >
> >It gives the same error...
> >DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR:
> OCIStmtExecute) ...
> >
> >Which part of the programm should manipulate the table DOTS.NASEQUENCEIMP
> ?
> >
> >
> >Thomas
> >
> >  
> >
> >>Hi Thomas,
> >>
> >>Apparently Steve is looking into this but I notice that
> >>external_database_release_id (--db_rel_id) is 135 and the genbank
> release
> >>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
> >>release of GenBank although it could also be a valid
> >>external_database_release_id in your ExternalDatabaseRelease table while
> >>1.05 doesn't look like a gb release number at all. I wonder if your 
> >>failure is due to a foreign key constraint referencing 
> >>ExternalDatabaseRelease because you actually don't have a PK in that
> table
> >>
> >>of 135. Easy to check. 
> >>
> >>                                     Debbie
> >>
> >>                                              
> >>
> >>
> >>
> >>
> >>On Fri, 30 Jan 
> >>2004, Steve
> >>Fischer wrote:
> >>
> >>    
> >>
> >>>thomas-
> >>>
> >>>i don't have time right now to look into this (i am home and need to 
> >>>take my daughter to skating lesson).  i will as soon as i can.
> >>>
> >>>steve
> >>>
> >>>Thomas Otto wrote:
> >>>
> >>>      
> >>>
> >>>>Hello -
> >>>>
> >>>>I am still fighting with the perl moduls.
> >>>>
> >>>>I.e. the GBParser to upload Genbank datasets gives following error:
> >>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >>>>--file=/seq/tcruzi_3.fcgi --commit
> >>>>
> >>>>------------------ entry number 2 -----------------
> >>>>
> >>>>SQL ERROR!! involving
> >>>>
> >>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>        
> >>>>
> >>nam
> >>    
> >>
> >>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>        
> >>>>
> >>length,
> >>    
> >>
> >>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>, na_sequence_id )
> >>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> >>>>        
> >>>>
> >>?,
> >>    
> >>
> >>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> >>>>
> >>>>Values:
> >>>>        
> >>>>
>
>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >>    
> >>
> >>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> >>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> >>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>        
> >>>>
> >>Trypanosoma
> >>    
> >>
> >>>>cruzi Berenice putative chimeric protein gene, partial
> >>>>cds., 1, 177, 1, 28, 1, 1 at
> >>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a}
> SQL ERROR!! involving\x{a} \x{a}    INSE
> >>    
> >>
> >>>>RT INTO DoTS.ExternalNASequ...') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >>    
> >>
> >>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
> >>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >>>>rl/GUS/ObjRelP/DbiRow.pm line 674
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)')
> called at /
> >>    
> >>
> >>>>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> called at /home/oracle/gus_home/lib/per
> >>    
> >>
> >>>>l/GUS/Model/GusRow.pm line 1677
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)')
> called at /home/oracle/gus_home/lib/perl/
> >>    
> >>
> >>>>GUS/Common/Plugin/GBParser.pm line 284
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> >>    
> >>
> >>>>=HASH(0x8ec41bc)') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> >>>>       eval {...} called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)')
> called at /home/oracle
> >>    
> >>
> >>>>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> >>>>       eval {...} called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 427
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> >>    
> >>
> >>>>ser') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 283
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> >>    
> >>
> >>>>) called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 192
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> called at /
> >>    
> >>
> >>>>home/oracle/gus_home/bin/ga line 11
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>on the prompt, following error is to see:
> >>>>
> >>>>
> >>>>
> >>>>********GEtting loc below30
> >>>>
> >>>>VLD     CBIL::Bio::GenBank::Locus       1
> >>>>VLD     CBIL::Bio::GenBank::Definition  1
> >>>>VLD     CBIL::Bio::GenBank::Accession   1
> >>>>VLD     CBIL::Bio::GenBank::Version     1
> >>>>VLD     CBIL::Bio::GenBank::Keywords    1
> >>>>VLD     CBIL::Bio::GenBank::Source      1
> >>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>VLD     CBIL::Bio::GenBank::Reference   1
> >>>>RUN     1..177
> >>>>RUN     1..46
> >>>>RUN     <30..>177
> >>>>RUN     30..>177
> >>>>VLD     CBIL::Bio::GenBank::Features    1
> >>>>VLD     CBIL::Bio::GenBank::Origin      1
> >>>>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
> >>>>TOTAL_OBJECTS=16
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> genomic
> >>>>        
> >>>>
> >>DNA
> >>    
> >>
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      transgenic      ::
> >>>>
> >>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> >>>>GUS::Model::DoTS::Source        ::      mol_type        ::     
> genomic
> >>>>        
> >>>>
> >>DNA
> >>    
> >>
> >>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> >>>>: OCIStmtExecute) [for Statement "
> >>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> >>>>sequence_type_id, user_read, other_write, modification_date, subcla
> >>>>ss_view, row_group_id, user_write, other_read, group_write,
> >>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
> >>>>        
> >>>>
> >>nam
> >>    
> >>
> >>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
> >>>>        
> >>>>
> >>length,
> >>    
> >>
> >>>>row_project_id, row_alg_invocation_id, sequence_version
> >>>>, na_sequence_id )
> >>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> >>>>        
> >>>>
> >>?,
> >>    
> >>
> >>>>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> >>>>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
> >>>>        
> >>>>
> >>:p15='GI:41056860',
> >>    
> >>
> >>>>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> >>>>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >>>>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> >>>>l cds.', :p6='ExternalNASequence',
> >>>>:p3='1',
> >>>>        
> >>>>
>
>>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >>    
> >>
>
>>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa',
> :p7='1', :p17='1', :p22=1, :p9=1, :
> >>    
> >>
> >>>>p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> >>>>        
> >>>>
> >>line
> >>    
> >>
> >>>>145, <GEN0> line 112.
> >>>>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated=
> >>>>        
> >>>>
> >>0;
> >>    
> >>
> >>>>total #(inserted::updated::deleted)=16::::
> >>>>
> >>>>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
> >>>>        
> >>>>
> >>entries.
> >>    
> >>
> >>>>See gbparserFailures/
> >>>>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
> >>>>updated= 0;  failed= 2
> >>>>
> >>>>
> >>>>
> >>>>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
> >>>>perlprogramm. I thought about setting the variables manually, but
> >>>>        
> >>>>
> >>doesn't
> >>    
> >>
> >>>>make
> >>>>sence.
> >>>>
> >>>>To inserte the values ot the the ExternalDatabaseRelease tables, I
> >>>>orientited myself on the
> >>>>installguide_UGA.html .
> >>>>The registration of the perl class InsertNewExtDbRelease gave
> following
> >>>>error:
> >>>>
> >>>>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> >>>>Reading properties from
> /home/oracle/gus_home/config/GUS-PluginMgr.prop
> >>>>Reading properties from /home/oracle/.gus.properties
> >>>>Warning: Use of "require" without parens is ambiguous at (eval 3) line
> >>>>        
> >>>>
> >>1.
> >>    
> >>
> >>>>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval
> 3)
> >>>>        
> >>>>
> >>line
> >>    
> >>
> >>>>1.
> >>>>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed
> while
> >>>>"strict subs" in use at (eval 3) line 1.
> >>>>
> >>>>
> >>>>--------------------------- STACK TRACE -------------------------
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword
> "pm" not allowed while "strict subs" in use at
> >>    
> >>
> >>>>(eval...') called at
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>>>line 248
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 664
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>called at
> >>    
> >>
> >>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line
> 456
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line 283
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >>    
> >>
> >>>>called at
> >>>>        
> >>>>
> >>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >>    
> >>
> >>>>line
> >>>>192
> >>>>     
> >>>>
> >>>>        
> >>>>
>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)')
> called at
> >>    
> >>
> >>>>/home/oracle/gus_home/bin/ga line 11
> >>>>
> >>>>I hope, that someone can help me.
> >>>>
> >>>>I wish a nice weekend and good luck with the grand -
> >>>>Thomas
> >>>>
> >>>>
> >>>>
> >>>>
> >>>>-------------------------------------------------------
> >>>>The SF.Net email is sponsored by EclipseCon 2004
> >>>>Premiere Conference on Open Tools Development and Integration
> >>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>>http://www.eclipsecon.org/osdn
> >>>>_______________________________________________
> >>>>Gusdev-gusdev mailing list
> >>>>Gus...@li...
> >>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>> 
> >>>>
> >>>>        
> >>>>
> >>>
> >>>-------------------------------------------------------
> >>>The SF.Net email is sponsored by EclipseCon 2004
> >>>Premiere Conference on Open Tools Development and Integration
> >>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >>>http://www.eclipsecon.org/osdn
> >>>_______________________________________________
> >>>Gusdev-gusdev mailing list
> >>>Gus...@li...
> >>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >>>
> >>>      
> >>>
> >
> >
> >
> >-------------------------------------------------------
> >The SF.Net email is sponsored by EclipseCon 2004
> >Premiere Conference on Open Tools Development and Integration
> >See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >http://www.eclipsecon.org/osdn
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >  
> >
> 