Re: [Gusdev-gusdev] GBParser - problems with the perl modules

SourceForge Headquarters 225 Broadway Suite 1600 San Diego, CA 92101 +1 (858) 422-6466

thomas-

do you know how to check the oracle system tables to see which foreign 
key is causing the "integrity constraint?"

if not, i can send you a query to run.

debbie and I looked it up, and it is the taxon_id that is failing.   
this is because the genbank parser requires you to fill in the taxon 
tables (because the genbank records refer to taxon).

take a look at fidel and sucheta's user guide on 
http://www.gusdb.org/documentation.html.   i believe they discuss this.

steve

Thomas Otto wrote:

>Hi Deborah,
>
>you are right, the values are testvalues. But there are also in the
>sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't see that it is
>as a foreign key...
>
>Here the entrance of the sres.externaldatabaserelease:
>135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom of
>the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1 |  1 |
> 1 |  1 |  0 |  6 |  3 |  2 |  1
>and the modul call:
>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
>--file=/seq/tcruzi.fcgi --start=1 --commit
>
>It gives the same error...
>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR: OCIStmtExecute) ...
>
>Which part of the programm should manipulate the table DOTS.NASEQUENCEIMP ?
>
>
>Thomas
>
>  
>
>>Hi Thomas,
>>
>>Apparently Steve is looking into this but I notice that
>>external_database_release_id (--db_rel_id) is 135 and the genbank release
>>(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
>>release of GenBank although it could also be a valid
>>external_database_release_id in your ExternalDatabaseRelease table while
>>1.05 doesn't look like a gb release number at all. I wonder if your 
>>failure is due to a foreign key constraint referencing 
>>ExternalDatabaseRelease because you actually don't have a PK in that table
>>
>>of 135. Easy to check. 
>>
>>                                     Debbie
>>
>>                                              
>>
>>
>>
>>
>>On Fri, 30 Jan 
>>2004, Steve
>>Fischer wrote:
>>
>>    
>>
>>>thomas-
>>>
>>>i don't have time right now to look into this (i am home and need to 
>>>take my daughter to skating lesson).  i will as soon as i can.
>>>
>>>steve
>>>
>>>Thomas Otto wrote:
>>>
>>>      
>>>
>>>>Hello -
>>>>
>>>>I am still fighting with the perl moduls.
>>>>
>>>>I.e. the GBParser to upload Genbank datasets gives following error:
>>>>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
>>>>--file=/seq/tcruzi_3.fcgi --commit
>>>>
>>>>------------------ entry number 2 -----------------
>>>>
>>>>SQL ERROR!! involving
>>>>
>>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>>>>sequence_type_id, user_read, other_write, modification_date, subcla
>>>>ss_view, row_group_id, user_write, other_read, group_write,
>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
>>>>        
>>>>
>>nam
>>    
>>
>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
>>>>        
>>>>
>>length,
>>    
>>
>>>>row_project_id, row_alg_invocation_id, sequence_version
>>>>, na_sequence_id )
>>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
>>>>        
>>>>
>>?,
>>    
>>
>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? )  
>>>>
>>>>Values:
>>>>        
>>>>
>>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
>>    
>>
>>>>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
>>>>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
>>>>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
>>>>        
>>>>
>>Trypanosoma
>>    
>>
>>>>cruzi Berenice putative chimeric protein gene, partial
>>>>cds., 1, 177, 1, 28, 1, 1 at
>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
>>>>     
>>>>
>>>>        
>>>>
>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a}    INSE
>>    
>>
>>>>RT INTO DoTS.ExternalNASequ...') called at
>>>>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
>>>>     
>>>>
>>>>        
>>>>
>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
>>    
>>
>>>>)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
>>>>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
>>>>rl/GUS/ObjRelP/DbiRow.pm line 674
>>>>     
>>>>
>>>>        
>>>>
>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
>>    
>>
>>>>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>>>>     
>>>>
>>>>        
>>>>
>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
>>    
>>
>>>>l/GUS/Model/GusRow.pm line 1677
>>>>     
>>>>
>>>>        
>>>>
>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
>>    
>>
>>>>GUS/Common/Plugin/GBParser.pm line 284
>>>>     
>>>>
>>>>        
>>>>
>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
>>    
>>
>>>>=HASH(0x8ec41bc)') called at
>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
>>>>       eval {...} called at
>>>>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>>>>     
>>>>
>>>>        
>>>>
>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
>>    
>>
>>>>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
>>>>       eval {...} called at
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
>>    
>>
>>>>ser') called at
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
>>    
>>
>>>>) called at
>>>>        
>>>>
>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>    
>>
>>>>line 192
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
>>    
>>
>>>>home/oracle/gus_home/bin/ga line 11
>>>>
>>>>
>>>>
>>>>
>>>>on the prompt, following error is to see:
>>>>
>>>>
>>>>
>>>>********GEtting loc below30
>>>>
>>>>VLD     CBIL::Bio::GenBank::Locus       1
>>>>VLD     CBIL::Bio::GenBank::Definition  1
>>>>VLD     CBIL::Bio::GenBank::Accession   1
>>>>VLD     CBIL::Bio::GenBank::Version     1
>>>>VLD     CBIL::Bio::GenBank::Keywords    1
>>>>VLD     CBIL::Bio::GenBank::Source      1
>>>>VLD     CBIL::Bio::GenBank::Reference   1
>>>>VLD     CBIL::Bio::GenBank::Reference   1
>>>>RUN     1..177
>>>>RUN     1..46
>>>>RUN     <30..>177
>>>>RUN     30..>177
>>>>VLD     CBIL::Bio::GenBank::Features    1
>>>>VLD     CBIL::Bio::GenBank::Origin      1
>>>>Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
>>>>TOTAL_OBJECTS=16
>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>GUS::Model::DoTS::Source        ::      mol_type        ::      genomic
>>>>        
>>>>
>>DNA
>>    
>>
>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>GUS::Model::DoTS::Source        ::      transgenic      ::
>>>>
>>>>Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
>>>>GUS::Model::DoTS::Source        ::      mol_type        ::      genomic
>>>>        
>>>>
>>DNA
>>    
>>
>>>>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>>>>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
>>>>: OCIStmtExecute) [for Statement "
>>>>   INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
>>>>sequence_type_id, user_read, other_write, modification_date, subcla
>>>>ss_view, row_group_id, user_write, other_read, group_write,
>>>>external_database_release_id, source_id, g_count, c_count, taxon_id,
>>>>        
>>>>
>>nam
>>    
>>
>>>>e, secondary_identifier, description, row_user_id, a_count, t_count,
>>>>        
>>>>
>>length,
>>    
>>
>>>>row_project_id, row_alg_invocation_id, sequence_version
>>>>, na_sequence_id )
>>>>   VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
>>>>        
>>>>
>>?,
>>    
>>
>>>>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
>>>>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
>>>>        
>>>>
>>:p15='GI:41056860',
>>    
>>
>>>>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
>>>>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
>>>>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
>>>>l cds.', :p6='ExternalNASequence',
>>>>:p3='1',
>>>>        
>>>>
>>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
>>    
>>
>>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
>>    
>>
>>>>p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
>>>>        
>>>>
>>line
>>    
>>
>>>>145, <GEN0> line 112.
>>>>Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated=
>>>>        
>>>>
>>0;
>>    
>>
>>>>total #(inserted::updated::deleted)=16::::
>>>>
>>>>Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
>>>>        
>>>>
>>entries.
>>    
>>
>>>>See gbparserFailures/
>>>>Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
>>>>updated= 0;  failed= 2
>>>>
>>>>
>>>>
>>>>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
>>>>perlprogramm. I thought about setting the variables manually, but
>>>>        
>>>>
>>doesn't
>>    
>>
>>>>make
>>>>sence.
>>>>
>>>>To inserte the values ot the the ExternalDatabaseRelease tables, I
>>>>orientited myself on the
>>>>installguide_UGA.html .
>>>>The registration of the perl class InsertNewExtDbRelease gave following
>>>>error:
>>>>
>>>>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
>>>>Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
>>>>Reading properties from /home/oracle/.gus.properties
>>>>Warning: Use of "require" without parens is ambiguous at (eval 3) line
>>>>        
>>>>
>>1.
>>    
>>
>>>>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3)
>>>>        
>>>>
>>line
>>    
>>
>>>>1.
>>>>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
>>>>"strict subs" in use at (eval 3) line 1.
>>>>
>>>>
>>>>--------------------------- STACK TRACE -------------------------
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
>>    
>>
>>>>(eval...') called at
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>>>line 248
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>    
>>
>>>>called at
>>>>        
>>>>
>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>    
>>
>>>>line 664
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>called at
>>    
>>
>>>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>    
>>
>>>>called at
>>>>        
>>>>
>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>    
>>
>>>>line 283
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>>    
>>
>>>>called at
>>>>        
>>>>
>>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>>    
>>
>>>>line
>>>>192
>>>>     
>>>>
>>>>        
>>>>
>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
>>    
>>
>>>>/home/oracle/gus_home/bin/ga line 11
>>>>
>>>>I hope, that someone can help me.
>>>>
>>>>I wish a nice weekend and good luck with the grand -
>>>>Thomas
>>>>
>>>>
>>>>
>>>>
>>>>-------------------------------------------------------
>>>>The SF.Net email is sponsored by EclipseCon 2004
>>>>Premiere Conference on Open Tools Development and Integration
>>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>>>http://www.eclipsecon.org/osdn
>>>>_______________________________________________
>>>>Gusdev-gusdev mailing list
>>>>Gus...@li...
>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>> 
>>>>
>>>>        
>>>>
>>>
>>>-------------------------------------------------------
>>>The SF.Net email is sponsored by EclipseCon 2004
>>>Premiere Conference on Open Tools Development and Integration
>>>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>>>http://www.eclipsecon.org/osdn
>>>_______________________________________________
>>>Gusdev-gusdev mailing list
>>>Gus...@li...
>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>
>>>      
>>>
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>