Re: [Gusdev-gusdev] GBParser - problems with the perl modules

SourceForge Headquarters 225 Broadway Suite 1600 San Diego, CA 92101 +1 (858) 422-6466

Hi Deborah,

you are right, the values are testvalues. But there are also in the
sres.ExternalDatabaseRelease... is the gbRel so important? - I didn't see that it is
as a foreign key...

Here the entrance of the sres.externaldatabaserelease:
135 |  1 |  15-JAN-04 |  10 |  tcrzidb.org |   |   |   |   |  The genom of
the tcruzi virus |  /seq/tcruzi.fcgi |   |   |   |  29-JAN-04 |  1 |  1 |  1 |
 1 |  1 |  0 |  6 |  3 |  2 |  1
and the modul call:
ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=10
--file=/seq/tcruzi.fcgi --start=1 --commit

It gives the same error...
DBD::Oracle::st execute failed: ORA-02291: integrity constraint
(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR: OCIStmtExecute) ...

Which part of the programm should manipulate the table DOTS.NASEQUENCEIMP ?

Thomas

> Hi Thomas,
> 
> Apparently Steve is looking into this but I notice that
> external_database_release_id (--db_rel_id) is 135 and the genbank release
> (--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
> release of GenBank although it could also be a valid
> external_database_release_id in your ExternalDatabaseRelease table while
> 1.05 doesn't look like a gb release number at all. I wonder if your 
> failure is due to a foreign key constraint referencing 
> ExternalDatabaseRelease because you actually don't have a PK in that table
> 
> of 135. Easy to check. 
> 
>                                      Debbie
> 
>                                               
> 
> 
> 
> 
> On Fri, 30 Jan 
> 2004, Steve
> Fischer wrote:
> 
> > thomas-
> > 
> > i don't have time right now to look into this (i am home and need to 
> > take my daughter to skating lesson).  i will as soon as i can.
> > 
> > steve
> > 
> > Thomas Otto wrote:
> > 
> > >Hello -
> > >
> > >I am still fighting with the perl moduls.
> > >
> > >I.e. the GBParser to upload Genbank datasets gives following error:
> > >ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> > >--file=/seq/tcruzi_3.fcgi --commit
> > >
> > > ------------------ entry number 2 -----------------
> > >
> > > SQL ERROR!! involving
> > > 
> > >    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> > >sequence_type_id, user_read, other_write, modification_date, subcla
> > >ss_view, row_group_id, user_write, other_read, group_write,
> > >external_database_release_id, source_id, g_count, c_count, taxon_id,
> nam
> > >e, secondary_identifier, description, row_user_id, a_count, t_count,
> length,
> > >row_project_id, row_alg_invocation_id, sequence_version
> > >, na_sequence_id )
> > >    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> ?,
> > >?, ?, ?, '', '', ?, ?, ?, ?, ? )  
> > >
> > >Values:
> >
>
>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> > >ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> > >ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> > >1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31
> Trypanosoma
> > >cruzi Berenice putative chimeric protein gene, partial
> > >cds., 1, 177, 1, 28, 1, 1 at
> > >/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> > >      
> > >
> >
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a}    INSE
> > >RT INTO DoTS.ExternalNASequ...') called at
> > >/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> > >      
> > >
> >
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> > >)','ARRAY(0x9118ca4)','\x{a}    INSERT INTO DoTS.ExternalNASequence (
> > >sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> > >rl/GUS/ObjRelP/DbiRow.pm line 674
> > >      
> > >
> >
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
> > >home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> > >      
> > >
> >
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
> > >l/GUS/Model/GusRow.pm line 1677
> > >      
> > >
> >
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
> > >GUS/Common/Plugin/GBParser.pm line 284
> > >      
> > >
> >
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> > >=HASH(0x8ec41bc)') called at
> > >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> > >        eval {...} called at
> > >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> > >      
> > >
> >
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
> > >/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> > >        eval {...} called at
> > >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> > >ser') called at
> > >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> > >) called at
> /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line 192
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
> > >home/oracle/gus_home/bin/ga line 11
> > >
> > >
> > >
> > >
> > >on the prompt, following error is to see:
> > >
> > >
> > >
> > >********GEtting loc below30
> > >
> > >VLD     CBIL::Bio::GenBank::Locus       1
> > >VLD     CBIL::Bio::GenBank::Definition  1
> > >VLD     CBIL::Bio::GenBank::Accession   1
> > >VLD     CBIL::Bio::GenBank::Version     1
> > >VLD     CBIL::Bio::GenBank::Keywords    1
> > >VLD     CBIL::Bio::GenBank::Source      1
> > >VLD     CBIL::Bio::GenBank::Reference   1
> > >VLD     CBIL::Bio::GenBank::Reference   1
> > >RUN     1..177
> > >RUN     1..46
> > >RUN     <30..>177
> > >RUN     30..>177
> > >VLD     CBIL::Bio::GenBank::Features    1
> > >VLD     CBIL::Bio::GenBank::Origin      1
> > >Fri Jan 30 15:41:11 2004        STATUS  N=2 ACC=AY488502        
> > >TOTAL_OBJECTS=16
> > >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> > >GUS::Model::DoTS::Source        ::      mol_type        ::      genomic
> DNA
> > >
> > >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> > >GUS::Model::DoTS::Source        ::      transgenic      ::
> > >
> > >Fri Jan 30 15:41:11 2004        INVALID QUALIFIER      
> > >GUS::Model::DoTS::Source        ::      mol_type        ::      genomic
> DNA
> > >
> > >DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> > >(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> > >: OCIStmtExecute) [for Statement "
> > >    INSERT INTO DoTS.ExternalNASequence (  sequence, group_read,
> > >sequence_type_id, user_read, other_write, modification_date, subcla
> > >ss_view, row_group_id, user_write, other_read, group_write,
> > >external_database_release_id, source_id, g_count, c_count, taxon_id,
> nam
> > >e, secondary_identifier, description, row_user_id, a_count, t_count,
> length,
> > >row_project_id, row_alg_invocation_id, sequence_version
> > >, na_sequence_id )
> > >    VALUES   (  ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?,
> ?,
> > >?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> > >0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502',
> :p15='GI:41056860',
> > >:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> > >2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> > >Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> > >l cds.', :p6='ExternalNASequence',
> > >:p3='1',
> >
>
>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >
>
>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
> > >p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> line
> > >145, <GEN0> line 112.
> > >Fri Jan 30 15:41:12 2004        Genbank entries inserted= 0;  updated=
> 0;
> > >total #(inserted::updated::deleted)=16::::
> > >
> > >Fri Jan 30 15:41:12 2004        FAILURES        Unable to process 2
> entries.
> > >See gbparserFailures/
> > >Fri Jan 30 15:41:12 2004        RESULT  Genbank entries inserted= 0;
> > >updated= 0;  failed= 2
> > >
> > >
> > >
> > >I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
> > >perlprogramm. I thought about setting the variables manually, but
> doesn't
> > >make
> > >sence.
> > >
> > >To inserte the values ot the the ExternalDatabaseRelease tables, I
> > >orientited myself on the
> > >installguide_UGA.html .
> > >The registration of the perl class InsertNewExtDbRelease gave following
> > >error:
> > >
> > >ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> > >Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
> > >Reading properties from /home/oracle/.gus.properties
> > >Warning: Use of "require" without parens is ambiguous at (eval 3) line
> 1.
> > > 
> > >ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3)
> line
> > >1.
> > >Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
> > >"strict subs" in use at (eval 3) line 1.
> > > 
> > > 
> > >--------------------------- STACK TRACE -------------------------
> > >      
> > >
> >
>
>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
> > >(eval...') called at
> > >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line 248
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> > >called at
> /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line 664
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> called at
> > >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> > >called at
> /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line 283
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> > >called at
> /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> > >line
> > >192
> > >      
> > >
> >
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
> > >/home/oracle/gus_home/bin/ga line 11
> > >
> > >I hope, that someone can help me.
> > >
> > >I wish a nice weekend and good luck with the grand -
> > >Thomas
> > >
> > >
> > >
> > >
> > >-------------------------------------------------------
> > >The SF.Net email is sponsored by EclipseCon 2004
> > >Premiere Conference on Open Tools Development and Integration
> > >See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> > >http://www.eclipsecon.org/osdn
> > >_______________________________________________
> > >Gusdev-gusdev mailing list
> > >Gus...@li...
> > >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > >  
> > >
> > 
> > 
> > 
> > -------------------------------------------------------
> > The SF.Net email is sponsored by EclipseCon 2004
> > Premiere Conference on Open Tools Development and Integration
> > See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> > http://www.eclipsecon.org/osdn
> > _______________________________________________
> > Gusdev-gusdev mailing list
> > Gus...@li...
> > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > 
> 