Menu
▾
▴
Re: [Gusdev-gusdev] GBParser - problems with the perl modules
|
From: Deborah F. P. <pi...@pc...> - 2004-02-01 12:46:40
|
Hi Thomas,
Apparently Steve is looking into this but I notice that
external_database_release_id (--db_rel_id) is 135 and the genbank release
(--gbRel) is 1.05. Those look suspicious as 135 is a somewhat recent
release of GenBank although it could also be a valid
external_database_release_id in your ExternalDatabaseRelease table while
1.05 doesn't look like a gb release number at all. I wonder if your
failure is due to a foreign key constraint referencing
ExternalDatabaseRelease because you actually don't have a PK in that table
of 135. Easy to check.
Debbie
On Fri, 30 Jan
2004, Steve
Fischer wrote:
> thomas-
>
> i don't have time right now to look into this (i am home and need to
> take my daughter to skating lesson). i will as soon as i can.
>
> steve
>
> Thomas Otto wrote:
>
> >Hello -
> >
> >I am still fighting with the perl moduls.
> >
> >I.e. the GBParser to upload Genbank datasets gives following error:
> >ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
> >--file=/seq/tcruzi_3.fcgi --commit
> >
> > ------------------ entry number 2 -----------------
> >
> > SQL ERROR!! involving
> >
> > INSERT INTO DoTS.ExternalNASequence ( sequence, group_read,
> >sequence_type_id, user_read, other_write, modification_date, subcla
> >ss_view, row_group_id, user_write, other_read, group_write,
> >external_database_release_id, source_id, g_count, c_count, taxon_id, nam
> >e, secondary_identifier, description, row_user_id, a_count, t_count, length,
> >row_project_id, row_alg_invocation_id, sequence_version
> >, na_sequence_id )
> > VALUES ( ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
> >?, ?, ?, '', '', ?, ?, ?, ?, ? )
> >
> >Values:
> >ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
> >ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
> >ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
> >1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31 Trypanosoma
> >cruzi Berenice putative chimeric protein gene, partial
> >cds., 1, 177, 1, 28, 1, 1 at
> >/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> >
> >
> >GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a} INSE
> >RT INTO DoTS.ExternalNASequ...') called at
> >/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
> >
> >
> >GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
> >)','ARRAY(0x9118ca4)','\x{a} INSERT INTO DoTS.ExternalNASequence (
> >sequence, group_r...') called at /home/oracle/gus_home/lib/pe
> >rl/GUS/ObjRelP/DbiRow.pm line 674
> >
> >
> >GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
> >home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >
> >
> >GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
> >l/GUS/Model/GusRow.pm line 1677
> >
> >
> >GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
> >GUS/Common/Plugin/GBParser.pm line 284
> >
> >
> >GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
> >=HASH(0x8ec41bc)') called at
> >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> > eval {...} called at
> >/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >
> >
> >GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
> >/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> > eval {...} called at
> >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
> >
> >
> >GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
> >ser') called at
> >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
> >
> >
> >GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
> >) called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line 192
> >
> >
> >GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
> >home/oracle/gus_home/bin/ga line 11
> >
> >
> >
> >
> >on the prompt, following error is to see:
> >
> >
> >
> >********GEtting loc below30
> >
> >VLD CBIL::Bio::GenBank::Locus 1
> >VLD CBIL::Bio::GenBank::Definition 1
> >VLD CBIL::Bio::GenBank::Accession 1
> >VLD CBIL::Bio::GenBank::Version 1
> >VLD CBIL::Bio::GenBank::Keywords 1
> >VLD CBIL::Bio::GenBank::Source 1
> >VLD CBIL::Bio::GenBank::Reference 1
> >VLD CBIL::Bio::GenBank::Reference 1
> >RUN 1..177
> >RUN 1..46
> >RUN <30..>177
> >RUN 30..>177
> >VLD CBIL::Bio::GenBank::Features 1
> >VLD CBIL::Bio::GenBank::Origin 1
> >Fri Jan 30 15:41:11 2004 STATUS N=2 ACC=AY488502
> >TOTAL_OBJECTS=16
> >Fri Jan 30 15:41:11 2004 INVALID QUALIFIER
> >GUS::Model::DoTS::Source :: mol_type :: genomic DNA
> >
> >Fri Jan 30 15:41:11 2004 INVALID QUALIFIER
> >GUS::Model::DoTS::Source :: transgenic ::
> >
> >Fri Jan 30 15:41:11 2004 INVALID QUALIFIER
> >GUS::Model::DoTS::Source :: mol_type :: genomic DNA
> >
> >DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> >(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
> >: OCIStmtExecute) [for Statement "
> > INSERT INTO DoTS.ExternalNASequence ( sequence, group_read,
> >sequence_type_id, user_read, other_write, modification_date, subcla
> >ss_view, row_group_id, user_write, other_read, group_write,
> >external_database_release_id, source_id, g_count, c_count, taxon_id, nam
> >e, secondary_identifier, description, row_user_id, a_count, t_count, length,
> >row_project_id, row_alg_invocation_id, sequence_version
> >, na_sequence_id )
> > VALUES ( ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
> >?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
> >0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502', :p15='GI:41056860',
> >:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
> >2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
> >Trypanosoma cruzi Berenice putative chimeric protein gene, partia
> >l cds.', :p6='ExternalNASequence',
> >:p3='1',
> >:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
> >cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
> >p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> >145, <GEN0> line 112.
> >Fri Jan 30 15:41:12 2004 Genbank entries inserted= 0; updated= 0;
> >total #(inserted::updated::deleted)=16::::
> >
> >Fri Jan 30 15:41:12 2004 FAILURES Unable to process 2 entries.
> >See gbparserFailures/
> >Fri Jan 30 15:41:12 2004 RESULT Genbank entries inserted= 0;
> >updated= 0; failed= 2
> >
> >
> >
> >I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
> >perlprogramm. I thought about setting the variables manually, but doesn't
> >make
> >sence.
> >
> >To inserte the values ot the the ExternalDatabaseRelease tables, I
> >orientited myself on the
> >installguide_UGA.html .
> >The registration of the perl class InsertNewExtDbRelease gave following
> >error:
> >
> >ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
> >Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
> >Reading properties from /home/oracle/.gus.properties
> >Warning: Use of "require" without parens is ambiguous at (eval 3) line 1.
> >
> >ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3) line
> >1.
> >Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
> >"strict subs" in use at (eval 3) line 1.
> >
> >
> >--------------------------- STACK TRACE -------------------------
> >
> >
> >GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
> >(eval...') called at
> >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line 248
> >
> >
> >GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line 664
> >
> >
> >GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm') called at
> >/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
> >
> >
> >GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line 283
> >
> >
> >GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
> >called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
> >line
> >192
> >
> >
> >GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
> >/home/oracle/gus_home/bin/ga line 11
> >
> >I hope, that someone can help me.
> >
> >I wish a nice weekend and good luck with the grand -
> >Thomas
> >
> >
> >
> >
> >-------------------------------------------------------
> >The SF.Net email is sponsored by EclipseCon 2004
> >Premiere Conference on Open Tools Development and Integration
> >See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> >http://www.eclipsecon.org/osdn
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> >
>
>
>
> -------------------------------------------------------
> The SF.Net email is sponsored by EclipseCon 2004
> Premiere Conference on Open Tools Development and Integration
> See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
> http://www.eclipsecon.org/osdn
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
|
