Menu
▾
▴
Re: [Gusdev-gusdev] GBParser - problems with the perl modules
|
From: Steve F. <st...@pc...> - 2004-01-30 23:31:40
|
thomas-
i don't have time right now to look into this (i am home and need to
take my daughter to skating lesson). i will as soon as i can.
steve
Thomas Otto wrote:
>Hello -
>
>I am still fighting with the perl moduls.
>
>I.e. the GBParser to upload Genbank datasets gives following error:
>ga GUS::Common::Plugin::GBParser --db_rel_id=135 --gbRel=1.05
>--file=/seq/tcruzi_3.fcgi --commit
>
> ------------------ entry number 2 -----------------
>
> SQL ERROR!! involving
>
> INSERT INTO DoTS.ExternalNASequence ( sequence, group_read,
>sequence_type_id, user_read, other_write, modification_date, subcla
>ss_view, row_group_id, user_write, other_read, group_write,
>external_database_release_id, source_id, g_count, c_count, taxon_id, nam
>e, secondary_identifier, description, row_user_id, a_count, t_count, length,
>row_project_id, row_alg_invocation_id, sequence_version
>, na_sequence_id )
> VALUES ( ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
>?, ?, ?, '', '', ?, ?, ?, ?, ? )
>
>Values:
>ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaacttcagtgggacgaagcctcactcatgaaggaggcagggt
>ggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa, 1, 1, 1, 0,
>ExternalNASequence, 1, 1, 1, 1, 135, AY488502, 0, AY488502, GI:4
>1056860, Oryctolagus cuniculus transgenic isolate COF12 clone 31 Trypanosoma
>cruzi Berenice putative chimeric protein gene, partial
>cds., 1, 177, 1, 28, 1, 1 at
>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
>
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','\x{a} SQL ERROR!! involving\x{a} \x{a} INSE
>RT INTO DoTS.ExternalNASequ...') called at
>/home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 148
>
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8c052d0)','GUS::ObjRelP::DbiDbHandle::st=HASH(0x90e53a8
>)','ARRAY(0x9118ca4)','\x{a} INSERT INTO DoTS.ExternalNASequence (
>sequence, group_r...') called at /home/oracle/gus_home/lib/pe
>rl/GUS/ObjRelP/DbiRow.pm line 674
>
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)','HASH(0x9117668)') called at /
>home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/per
>l/GUS/Model/GusRow.pm line 1677
>
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8ec4204)') called at /home/oracle/gus_home/lib/perl/
>GUS/Common/Plugin/GBParser.pm line 284
>
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x857042c)','CBIL::Bio::GenBank::ArrayStream
>=HASH(0x8ec41bc)') called at
>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> eval {...} called at
>/home/oracle/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x857042c)','HASH(0x8e4b10c)') called at /home/oracle
>/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 430
> eval {...} called at
>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 427
>
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBPar
>ser') called at
>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
>
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::GBParser'
>) called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line 192
>
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at /
>home/oracle/gus_home/bin/ga line 11
>
>
>
>
>on the prompt, following error is to see:
>
>
>
>********GEtting loc below30
>
>VLD CBIL::Bio::GenBank::Locus 1
>VLD CBIL::Bio::GenBank::Definition 1
>VLD CBIL::Bio::GenBank::Accession 1
>VLD CBIL::Bio::GenBank::Version 1
>VLD CBIL::Bio::GenBank::Keywords 1
>VLD CBIL::Bio::GenBank::Source 1
>VLD CBIL::Bio::GenBank::Reference 1
>VLD CBIL::Bio::GenBank::Reference 1
>RUN 1..177
>RUN 1..46
>RUN <30..>177
>RUN 30..>177
>VLD CBIL::Bio::GenBank::Features 1
>VLD CBIL::Bio::GenBank::Origin 1
>Fri Jan 30 15:41:11 2004 STATUS N=2 ACC=AY488502
>TOTAL_OBJECTS=16
>Fri Jan 30 15:41:11 2004 INVALID QUALIFIER
>GUS::Model::DoTS::Source :: mol_type :: genomic DNA
>
>Fri Jan 30 15:41:11 2004 INVALID QUALIFIER
>GUS::Model::DoTS::Source :: transgenic ::
>
>Fri Jan 30 15:41:11 2004 INVALID QUALIFIER
>GUS::Model::DoTS::Source :: mol_type :: genomic DNA
>
>DBD::Oracle::st execute failed: ORA-02291: integrity constraint
>(DOTS.NASEQUENCEIMP_FK02) violated - parent key not found (DBD ERROR
>: OCIStmtExecute) [for Statement "
> INSERT INTO DoTS.ExternalNASequence ( sequence, group_read,
>sequence_type_id, user_read, other_write, modification_date, subcla
>ss_view, row_group_id, user_write, other_read, group_write,
>external_database_release_id, source_id, g_count, c_count, taxon_id, nam
>e, secondary_identifier, description, row_user_id, a_count, t_count, length,
>row_project_id, row_alg_invocation_id, sequence_version
>, na_sequence_id )
> VALUES ( ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?, ?, ?, '', '', ?, ?,
>?, ?, ?, '', '', ?, ?, ?, ?, ? ) " with ParamValues: :p5=
>0, :p20='28', :p12='AY488502', :p8=1, :p14='AY488502', :p15='GI:41056860',
>:p19='1', :p4=1, :p21='1', :p18='177', :p10=1, :p13=0, :p
>2=1, :p16='Oryctolagus cuniculus transgenic isolate COF12 clone 31
>Trypanosoma cruzi Berenice putative chimeric protein gene, partia
>l cds.', :p6='ExternalNASequence',
>:p3='1',
>:p1='ataatgtacgggtgagatgcccatgtataatgtacgggggagatgccaacactgctgatgagacggtcaagcgattgtcccaa
>cttcagtgggacgaagcctcactcatgaaggaggcagggtggttgtggacaagcctaggtgtaccaatcacctccttccacaaagagaggccaa', :p7='1', :p17='1', :p22=1, :p9=1, :
>p11=135] at /home/oracle/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
>145, <GEN0> line 112.
>Fri Jan 30 15:41:12 2004 Genbank entries inserted= 0; updated= 0;
>total #(inserted::updated::deleted)=16::::
>
>Fri Jan 30 15:41:12 2004 FAILURES Unable to process 2 entries.
>See gbparserFailures/
>Fri Jan 30 15:41:12 2004 RESULT Genbank entries inserted= 0;
>updated= 0; failed= 2
>
>
>
>I see the problem, that the table DOTS.NASEQUENCEIMP is not set by the
>perlprogramm. I thought about setting the variables manually, but doesn't
>make
>sence.
>
>To inserte the values ot the the ExternalDatabaseRelease tables, I
>orientited myself on the
>installguide_UGA.html .
>The registration of the perl class InsertNewExtDbRelease gave following
>error:
>
>ga +create GUS::Common::Plugin::InsertNewExtDbRelease.pm
>Reading properties from /home/oracle/gus_home/config/GUS-PluginMgr.prop
>Reading properties from /home/oracle/.gus.properties
>Warning: Use of "require" without parens is ambiguous at (eval 3) line 1.
>
>ERROR: Bareword "pm" not allowed while "strict subs" in use at (eval 3) line
>1.
>Bareword "GUS::Common::Plugin::InsertNewExtDbRelease" not allowed while
>"strict subs" in use at (eval 3) line 1.
>
>
>--------------------------- STACK TRACE -------------------------
>
>
>GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','Bareword "pm" not allowed while "strict subs" in use at
>(eval...') called at
>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line 248
>
>
>GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line 664
>
>
>GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x804d00c)',0,'GUS::Common::Plugin::InsertNewExtDbRelease.pm') called at
>/home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
>
>
>GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line 283
>
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','GUS::Common::Plugin::InsertNewExtDbRelease.pm')
>called at /home/oracle/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm
>line
>192
>
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x804d00c)','ARRAY(0x80606b0)') called at
>/home/oracle/gus_home/bin/ga line 11
>
>I hope, that someone can help me.
>
>I wish a nice weekend and good luck with the grand -
>Thomas
>
>
>
>
>-------------------------------------------------------
>The SF.Net email is sponsored by EclipseCon 2004
>Premiere Conference on Open Tools Development and Integration
>See the breadth of Eclipse activity. February 3-5 in Anaheim, CA.
>http://www.eclipsecon.org/osdn
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
>
|
