Re: [Gusdev-gusdev] GBParser Failure

SourceForge Headquarters 225 Broadway Suite 1600 San Diego, CA 92101 +1 (858) 422-6466

Michael-

We (Debbie and I) have poked around, and think we know what is going on.

What we did:
  1. looked in your gbFailures.errors file (which captures stderr), and 
saw that there was an SQL error.  We matched all the values against the 
columns you were inserting into, and they looked fine.  But, looking at 
the stack trace, we saw that the SQL error happened in DbiDbHandle 
around line 147
  2. so, then, we looked in your log file (which captures stdout), and 
saw oracle errors that were reported as originating on line 144 of that 
same file:
DBD::Oracle::st execute failed: ORA-02291: integrity constraint 
(DOTS.NASEQUENCEIMP_FK01) violated - parent key not found (DBD ERROR: 
OCIStmtExecute) at /home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm 
line 144, <GEN0> line 74.

We then looked up that integrity contstrain in the file:
   projects/GUS/Model/schema/oracle/dots-constraints.sql

and we saw this:

alter table @oracle_dots@.NASEQUENCEIMP add constraint 
NASEQUENCEIMP_FK01 foreign key (SEQUENCE_TYPE_ID) references 
@oracle_dots@.SEQUENCETYPE (SEQUENCE_TYPE_ID);

which... leads us to the conclusion that this is another instance of you 
guys needing some data in a table.  In this case, the table is 
Dots.sequencetype.  basically, the gb parser is looking there to label 
the sequence with types such as mRNA.

Attached is a file containing the values from our table.  

Note:  the gbparser has *hard-coded* that the id for type "unknown" is 
11.  if you can force that to be the case, then the rest of the ids 
don't matter, as long as you have the sequence types in the table.

steve

MICHAEL LUCHTAN wrote:

>Looks like 1.15:
>
>
>
>$self->initialize({requiredDbVersion => {},
>		     cvsRevision => '$Revision: 1.15 $',	# cvs
>fills this in!
>		     cvsTag => '$Name:  $', # cvs fills this in!
>		     name => ref($self),
>		     revisionNotes => 'make consistent with GUS 3.0',
>		     easyCspOptions => $easycsp,
>		     usage => $usage
>		    });
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>On Tue, 13 May 2003, Steve Fischer wrote:
>
>  
>
>>michael-
>>
>>take a look at the top of your copy of GBParser.pm.  what version of cvs
>>is it showing?
>>
>>  $self->initialize({requiredDbVersion => {},
>>             cvsRevision => '$Revision: 1.14 $',    # cvs fills this in!
>>   <------ look here
>>             cvsTag => '$Name:  $', # cvs fills this in!
>>             name => ref($self),
>>             revisionNotes => 'make consistent with GUS 3.0',
>>             easyCspOptions => $easycsp,
>>             usage => $usage
>>            });
>>
>>steve
>>
>>MICHAEL LUCHTAN wrote:
>>
>>    
>>
>>>Hello-
>>>We are still trying to get the gbparser pluging to work correctly.
>>>Entries have been added in the Sres.ExternalDatabase and
>>>Sres.ExternalDatabaseReference tables.  We are still getting some strange
>>>errors at the terminal.  Here is the first few lines (I tried to send all
>>>of the input but there was a problem with the sourceforge mailer as far as
>>>the size of the file):
>>>[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
>>>--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
>>>CBIgenomic.gb --commit
>>>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>>>Reading properties from /home/luchtan/gus.properties
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>
>>>The first part of the error file generated looks like this(Again the file
>>>was too big to send as an attachment):
>>>------------------ entry number 1 -----------------
>>>
>>>SQL ERROR!! involving
>>>
>>>   INSERT INTO DoTS.ExternalNASequence (  c_count, description,
>>>sequence_type_id, row_user_id, user_write, group_write,
>>>secondary_identifier,
>>>na_sequence_id, row_project_id, name, taxon_id,
>>>external_database_release_id, subclass_view, group_read, sequence,
>>>sequence_version, row_grou
>>>p_id, other_read, a_count, length, source_id, modification_date, t_count,
>>>user_read, row_alg_invocation_id, g_count, other_write )
>>>   VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
>>>?, ?, SYSDATE, ?, ?, ?, ?, ? )
>>>Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
>>>PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
>>>947, 184573, 1, ExternalNASequence, 1,
>>>atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
>>>cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
>>>ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
>>>ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
>>>gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
>>>ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
>>>ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
>>>tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
>>>cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
>>>acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
>>>1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
>>>ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
>>>
>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>>>'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.Exter
>>>nalNASequenc...') called at
>>>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
>>>
>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>>>'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
>>>Y(0x90013e8)', '^J    INSERT INTO DoTS.ExternalNASequence (  c_count,
>>>description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
>>>line 674
>>>
>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
>>>'HASH(0x8fd9fa4)') called at /home/gus_
>>>home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>>>
>>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>>>called at /home/gus_home/lib/perl/GUS/Model/GusRo
>>>w.pm line 1677
>>>
>>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>>>called at /home/gus_home/lib/perl/GUS/Common/Plugin
>>>/GBParser.pm line 284
>>>
>>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>>>'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
>>>ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
>>>line 185
>>>       eval {...} called at
>>>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>>>
>>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>>>'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
>>>rl/GUS/PluginMgr/GusApplication.pm line 389
>>>       eval {...} called at
>>>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'GUS::Common::Plugin::GBParser') cal
>>>led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'GUS::Common::Plugin::GBParser') called
>>>at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
>>>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'ARRAY(0x8105130)') called at /home/gus_
>>>home/bin/ga line 11
>>>
>>>
>>>
>>>
>>>
>>>
>>>If anyone can look at this and
>>>see a quick oversight on our part, your advice would be much appreciated.
>>>In the meantime we will be working on it.   Thanks,
>>>
>>>Michael Luchtan
>>>http://www.cs.uga.edu/~luchtan
>>>
>>>
>>>
>>>
>>>
>>>-------------------------------------------------------
>>>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>>>The only event dedicated to issues related to Linux enterprise solutions
>>>www.enterpriselinuxforum.com
>>>
>>>_______________________________________________
>>>Gusdev-gusdev mailing list
>>>Gus...@li...
>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>
>>>
>>>      
>>>
>>
>>-------------------------------------------------------
>>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>>The only event dedicated to issues related to Linux enterprise solutions
>>www.enterpriselinuxforum.com
>>
>>_______________________________________________
>>Gusdev-gusdev mailing list
>>Gus...@li...
>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>
>>    
>>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>