Re: [Gusdev-gusdev] GBParser Failure

SourceForge Headquarters 1320 Columbia Street Suite 310 San Diego, CA 92101 +1 (858) 422-6466

Looks like 1.15:

$self->initialize({requiredDbVersion => {},
		     cvsRevision => '$Revision: 1.15 $',	# cvs
fills this in!
		     cvsTag => '$Name:  $', # cvs fills this in!
		     name => ref($self),
		     revisionNotes => 'make consistent with GUS 3.0',
		     easyCspOptions => $easycsp,
		     usage => $usage
		    });

Michael Luchtan
http://www.cs.uga.edu/~luchtan

On Tue, 13 May 2003, Steve Fischer wrote:

> michael-
>
> take a look at the top of your copy of GBParser.pm.  what version of cvs
> is it showing?
>
>   $self->initialize({requiredDbVersion => {},
>              cvsRevision => '$Revision: 1.14 $',    # cvs fills this in!
>    <------ look here
>              cvsTag => '$Name:  $', # cvs fills this in!
>              name => ref($self),
>              revisionNotes => 'make consistent with GUS 3.0',
>              easyCspOptions => $easycsp,
>              usage => $usage
>             });
>
> steve
>
> MICHAEL LUCHTAN wrote:
>
> >Hello-
> >We are still trying to get the gbparser pluging to work correctly.
> >Entries have been added in the Sres.ExternalDatabase and
> >Sres.ExternalDatabaseReference tables.  We are still getting some strange
> >errors at the terminal.  Here is the first few lines (I tried to send all
> >of the input but there was a problem with the sourceforge mailer as far as
> >the size of the file):
> >[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
> >--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
> >CBIgenomic.gb --commit
> >Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
> >Reading properties from /home/luchtan/gus.properties
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >
> >The first part of the error file generated looks like this(Again the file
> >was too big to send as an attachment):
> > ------------------ entry number 1 -----------------
> >
> > SQL ERROR!! involving
> >
> >    INSERT INTO DoTS.ExternalNASequence (  c_count, description,
> >sequence_type_id, row_user_id, user_write, group_write,
> >secondary_identifier,
> > na_sequence_id, row_project_id, name, taxon_id,
> >external_database_release_id, subclass_view, group_read, sequence,
> >sequence_version, row_grou
> >p_id, other_read, a_count, length, source_id, modification_date, t_count,
> >user_read, row_alg_invocation_id, g_count, other_write )
> >    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
> >?, ?, SYSDATE, ?, ?, ?, ?, ? )
> > Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
> >PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
> >947, 184573, 1, ExternalNASequence, 1,
> >atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
> >cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
> >ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
> >ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
> >gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
> >ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
> >ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
> >tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
> >cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
> >acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
> >1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
> >ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
> >
> >GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
> >'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.Exter
> >nalNASequenc...') called at
> >/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
> >
> >GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
> >'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
> >Y(0x90013e8)', '^J    INSERT INTO DoTS.ExternalNASequence (  c_count,
> >description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
> > line 674
> >
> >GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
> >'HASH(0x8fd9fa4)') called at /home/gus_
> >home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >
> >GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
> >called at /home/gus_home/lib/perl/GUS/Model/GusRo
> >w.pm line 1677
> >
> >GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
> >called at /home/gus_home/lib/perl/GUS/Common/Plugin
> >/GBParser.pm line 284
> >
> >GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
> >'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
> >ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
> >line 185
> >        eval {...} called at
> >/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >
> >GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
> >'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
> >rl/GUS/PluginMgr/GusApplication.pm line 389
> >        eval {...} called at
> >/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
> >
> >GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'GUS::Common::Plugin::GBParser') cal
> >led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
> >
> >GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'GUS::Common::Plugin::GBParser') called
> >at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
> >
> >GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'ARRAY(0x8105130)') called at /home/gus_
> >home/bin/ga line 11
> >
> >
> >
> >
> >
> >
> >If anyone can look at this and
> >see a quick oversight on our part, your advice would be much appreciated.
> >In the meantime we will be working on it.   Thanks,
> >
> >Michael Luchtan
> >http://www.cs.uga.edu/~luchtan
> >
> >
> >
> >
> >
> >-------------------------------------------------------
> >Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> >The only event dedicated to issues related to Linux enterprise solutions
> >www.enterpriselinuxforum.com
> >
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> >
>
>
>
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
>
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>