Menu
▾
▴
gusdev-gusdev
|
From: MICHAEL L. <lu...@cs...> - 2003-05-13 18:20:32
|
Hello-
We are still trying to get the gbparser pluging to work correctly.
Entries have been added in the Sres.ExternalDatabase and
Sres.ExternalDatabaseReference tables. We are still getting some strange
errors at the terminal. Here is the first few lines (I tried to send all
of the input but there was a problem with the sourceforge mailer as far as
the size of the file):
[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
CBIgenomic.gb --commit
Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
Reading properties from /home/luchtan/gus.properties
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
The first part of the error file generated looks like this(Again the file
was too big to send as an attachment):
------------------ entry number 1 -----------------
SQL ERROR!! involving
INSERT INTO DoTS.ExternalNASequence ( c_count, description,
sequence_type_id, row_user_id, user_write, group_write,
secondary_identifier,
na_sequence_id, row_project_id, name, taxon_id,
external_database_release_id, subclass_view, group_read, sequence,
sequence_version, row_grou
p_id, other_read, a_count, length, source_id, modification_date, t_count,
user_read, row_alg_invocation_id, g_count, other_write )
VALUES ( ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
?, ?, SYSDATE, ?, ?, ?, ?, ? )
Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
947, 184573, 1, ExternalNASequence, 1,
atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
'^J SQL ERROR!! involving^J ^J INSERT INTO DoTS.Exter
nalNASequenc...') called at
/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
Y(0x90013e8)', '^J INSERT INTO DoTS.ExternalNASequence ( c_count,
description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
line 674
GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
'HASH(0x8fd9fa4)') called at /home/gus_
home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
called at /home/gus_home/lib/perl/GUS/Model/GusRo
w.pm line 1677
GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
called at /home/gus_home/lib/perl/GUS/Common/Plugin
/GBParser.pm line 284
GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
line 185
eval {...} called at
/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
rl/GUS/PluginMgr/GusApplication.pm line 389
eval {...} called at
/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'GUS::Common::Plugin::GBParser') cal
led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'GUS::Common::Plugin::GBParser') called
at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'ARRAY(0x8105130)') called at /home/gus_
home/bin/ga line 11
If anyone can look at this and
see a quick oversight on our part, your advice would be much appreciated.
In the meantime we will be working on it. Thanks,
Michael Luchtan
http://www.cs.uga.edu/~luchtan
|
|
From: Steve F. <sfi...@pc...> - 2003-05-13 18:36:04
|
Michael-
i'll have a look at this.
in case you didn't know, the stuff starting with "death" and below is a
perl "stack trace." it shows you the succession of subroutine calls
(and their args) that lead to the problem. sometimes that provides a
major clue; sometimes not.
steve
MICHAEL LUCHTAN wrote:
>Hello-
>We are still trying to get the gbparser pluging to work correctly.
>Entries have been added in the Sres.ExternalDatabase and
>Sres.ExternalDatabaseReference tables. We are still getting some strange
>errors at the terminal. Here is the first few lines (I tried to send all
>of the input but there was a problem with the sourceforge mailer as far as
>the size of the file):
>[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
>--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
>CBIgenomic.gb --commit
>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>Reading properties from /home/luchtan/gus.properties
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>
>The first part of the error file generated looks like this(Again the file
>was too big to send as an attachment):
> ------------------ entry number 1 -----------------
>
> SQL ERROR!! involving
>
> INSERT INTO DoTS.ExternalNASequence ( c_count, description,
>sequence_type_id, row_user_id, user_write, group_write,
>secondary_identifier,
> na_sequence_id, row_project_id, name, taxon_id,
>external_database_release_id, subclass_view, group_read, sequence,
>sequence_version, row_grou
>p_id, other_read, a_count, length, source_id, modification_date, t_count,
>user_read, row_alg_invocation_id, g_count, other_write )
> VALUES ( ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
>?, ?, SYSDATE, ?, ?, ?, ?, ? )
> Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
>PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
>947, 184573, 1, ExternalNASequence, 1,
>atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
>cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
>ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
>ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
>gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
>ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
>ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
>tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
>cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
>acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
>1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
>ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>'^J SQL ERROR!! involving^J ^J INSERT INTO DoTS.Exter
>nalNASequenc...') called at
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
>Y(0x90013e8)', '^J INSERT INTO DoTS.ExternalNASequence ( c_count,
>description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
> line 674
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
>'HASH(0x8fd9fa4)') called at /home/gus_
>home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>called at /home/gus_home/lib/perl/GUS/Model/GusRo
>w.pm line 1677
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>called at /home/gus_home/lib/perl/GUS/Common/Plugin
>/GBParser.pm line 284
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
>ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
>line 185
> eval {...} called at
>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
>rl/GUS/PluginMgr/GusApplication.pm line 389
> eval {...} called at
>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') cal
>led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') called
>at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'ARRAY(0x8105130)') called at /home/gus_
>home/bin/ga line 11
>
>
>
>
>
>
>If anyone can look at this and
>see a quick oversight on our part, your advice would be much appreciated.
>In the meantime we will be working on it. Thanks,
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
>
|
|
From: Steve F. <sfi...@pc...> - 2003-05-13 18:42:24
|
michael-
take a look at the top of your copy of GBParser.pm. what version of cvs
is it showing?
$self->initialize({requiredDbVersion => {},
cvsRevision => '$Revision: 1.14 $', # cvs fills this in!
<------ look here
cvsTag => '$Name: $', # cvs fills this in!
name => ref($self),
revisionNotes => 'make consistent with GUS 3.0',
easyCspOptions => $easycsp,
usage => $usage
});
steve
MICHAEL LUCHTAN wrote:
>Hello-
>We are still trying to get the gbparser pluging to work correctly.
>Entries have been added in the Sres.ExternalDatabase and
>Sres.ExternalDatabaseReference tables. We are still getting some strange
>errors at the terminal. Here is the first few lines (I tried to send all
>of the input but there was a problem with the sourceforge mailer as far as
>the size of the file):
>[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
>--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
>CBIgenomic.gb --commit
>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>Reading properties from /home/luchtan/gus.properties
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>
>The first part of the error file generated looks like this(Again the file
>was too big to send as an attachment):
> ------------------ entry number 1 -----------------
>
> SQL ERROR!! involving
>
> INSERT INTO DoTS.ExternalNASequence ( c_count, description,
>sequence_type_id, row_user_id, user_write, group_write,
>secondary_identifier,
> na_sequence_id, row_project_id, name, taxon_id,
>external_database_release_id, subclass_view, group_read, sequence,
>sequence_version, row_grou
>p_id, other_read, a_count, length, source_id, modification_date, t_count,
>user_read, row_alg_invocation_id, g_count, other_write )
> VALUES ( ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
>?, ?, SYSDATE, ?, ?, ?, ?, ? )
> Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
>PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
>947, 184573, 1, ExternalNASequence, 1,
>atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
>cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
>ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
>ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
>gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
>ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
>ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
>tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
>cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
>acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
>1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
>ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>'^J SQL ERROR!! involving^J ^J INSERT INTO DoTS.Exter
>nalNASequenc...') called at
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
>Y(0x90013e8)', '^J INSERT INTO DoTS.ExternalNASequence ( c_count,
>description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
> line 674
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
>'HASH(0x8fd9fa4)') called at /home/gus_
>home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>called at /home/gus_home/lib/perl/GUS/Model/GusRo
>w.pm line 1677
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>called at /home/gus_home/lib/perl/GUS/Common/Plugin
>/GBParser.pm line 284
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
>ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
>line 185
> eval {...} called at
>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
>rl/GUS/PluginMgr/GusApplication.pm line 389
> eval {...} called at
>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') cal
>led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') called
>at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'ARRAY(0x8105130)') called at /home/gus_
>home/bin/ga line 11
>
>
>
>
>
>
>If anyone can look at this and
>see a quick oversight on our part, your advice would be much appreciated.
>In the meantime we will be working on it. Thanks,
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
>
|
|
From: MICHAEL L. <lu...@cs...> - 2003-05-13 18:49:14
|
Looks like 1.15:
$self->initialize({requiredDbVersion => {},
cvsRevision => '$Revision: 1.15 $', # cvs
fills this in!
cvsTag => '$Name: $', # cvs fills this in!
name => ref($self),
revisionNotes => 'make consistent with GUS 3.0',
easyCspOptions => $easycsp,
usage => $usage
});
Michael Luchtan
http://www.cs.uga.edu/~luchtan
On Tue, 13 May 2003, Steve Fischer wrote:
> michael-
>
> take a look at the top of your copy of GBParser.pm. what version of cvs
> is it showing?
>
> $self->initialize({requiredDbVersion => {},
> cvsRevision => '$Revision: 1.14 $', # cvs fills this in!
> <------ look here
> cvsTag => '$Name: $', # cvs fills this in!
> name => ref($self),
> revisionNotes => 'make consistent with GUS 3.0',
> easyCspOptions => $easycsp,
> usage => $usage
> });
>
> steve
>
> MICHAEL LUCHTAN wrote:
>
> >Hello-
> >We are still trying to get the gbparser pluging to work correctly.
> >Entries have been added in the Sres.ExternalDatabase and
> >Sres.ExternalDatabaseReference tables. We are still getting some strange
> >errors at the terminal. Here is the first few lines (I tried to send all
> >of the input but there was a problem with the sourceforge mailer as far as
> >the size of the file):
> >[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
> >--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
> >CBIgenomic.gb --commit
> >Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
> >Reading properties from /home/luchtan/gus.properties
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >
> >The first part of the error file generated looks like this(Again the file
> >was too big to send as an attachment):
> > ------------------ entry number 1 -----------------
> >
> > SQL ERROR!! involving
> >
> > INSERT INTO DoTS.ExternalNASequence ( c_count, description,
> >sequence_type_id, row_user_id, user_write, group_write,
> >secondary_identifier,
> > na_sequence_id, row_project_id, name, taxon_id,
> >external_database_release_id, subclass_view, group_read, sequence,
> >sequence_version, row_grou
> >p_id, other_read, a_count, length, source_id, modification_date, t_count,
> >user_read, row_alg_invocation_id, g_count, other_write )
> > VALUES ( ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
> >?, ?, SYSDATE, ?, ?, ?, ?, ? )
> > Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
> >PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
> >947, 184573, 1, ExternalNASequence, 1,
> >atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
> >cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
> >ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
> >ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
> >gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
> >ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
> >ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
> >tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
> >cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
> >acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
> >1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
> >ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
> >
> >GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
> >'^J SQL ERROR!! involving^J ^J INSERT INTO DoTS.Exter
> >nalNASequenc...') called at
> >/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
> >
> >GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
> >'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
> >Y(0x90013e8)', '^J INSERT INTO DoTS.ExternalNASequence ( c_count,
> >description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
> > line 674
> >
> >GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
> >'HASH(0x8fd9fa4)') called at /home/gus_
> >home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >
> >GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
> >called at /home/gus_home/lib/perl/GUS/Model/GusRo
> >w.pm line 1677
> >
> >GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
> >called at /home/gus_home/lib/perl/GUS/Common/Plugin
> >/GBParser.pm line 284
> >
> >GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
> >'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
> >ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
> >line 185
> > eval {...} called at
> >/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >
> >GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
> >'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
> >rl/GUS/PluginMgr/GusApplication.pm line 389
> > eval {...} called at
> >/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
> >
> >GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'GUS::Common::Plugin::GBParser') cal
> >led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
> >
> >GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'GUS::Common::Plugin::GBParser') called
> >at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
> >
> >GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'ARRAY(0x8105130)') called at /home/gus_
> >home/bin/ga line 11
> >
> >
> >
> >
> >
> >
> >If anyone can look at this and
> >see a quick oversight on our part, your advice would be much appreciated.
> >In the meantime we will be working on it. Thanks,
> >
> >Michael Luchtan
> >http://www.cs.uga.edu/~luchtan
> >
> >
> >
> >
> >
> >-------------------------------------------------------
> >Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> >The only event dedicated to issues related to Linux enterprise solutions
> >www.enterpriselinuxforum.com
> >
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> >
>
>
>
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
>
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
|
|
From: Steve F. <sfi...@pc...> - 2003-05-13 19:43:21
Attachments:
bumpy.lst
|
Michael-
We (Debbie and I) have poked around, and think we know what is going on.
What we did:
1. looked in your gbFailures.errors file (which captures stderr), and
saw that there was an SQL error. We matched all the values against the
columns you were inserting into, and they looked fine. But, looking at
the stack trace, we saw that the SQL error happened in DbiDbHandle
around line 147
2. so, then, we looked in your log file (which captures stdout), and
saw oracle errors that were reported as originating on line 144 of that
same file:
DBD::Oracle::st execute failed: ORA-02291: integrity constraint
(DOTS.NASEQUENCEIMP_FK01) violated - parent key not found (DBD ERROR:
OCIStmtExecute) at /home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
line 144, <GEN0> line 74.
We then looked up that integrity contstrain in the file:
projects/GUS/Model/schema/oracle/dots-constraints.sql
and we saw this:
alter table @oracle_dots@.NASEQUENCEIMP add constraint
NASEQUENCEIMP_FK01 foreign key (SEQUENCE_TYPE_ID) references
@oracle_dots@.SEQUENCETYPE (SEQUENCE_TYPE_ID);
which... leads us to the conclusion that this is another instance of you
guys needing some data in a table. In this case, the table is
Dots.sequencetype. basically, the gb parser is looking there to label
the sequence with types such as mRNA.
Attached is a file containing the values from our table.
Note: the gbparser has *hard-coded* that the id for type "unknown" is
11. if you can force that to be the case, then the rest of the ids
don't matter, as long as you have the sequence types in the table.
steve
MICHAEL LUCHTAN wrote:
>Looks like 1.15:
>
>
>
>$self->initialize({requiredDbVersion => {},
> cvsRevision => '$Revision: 1.15 $', # cvs
>fills this in!
> cvsTag => '$Name: $', # cvs fills this in!
> name => ref($self),
> revisionNotes => 'make consistent with GUS 3.0',
> easyCspOptions => $easycsp,
> usage => $usage
> });
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>On Tue, 13 May 2003, Steve Fischer wrote:
>
>
>
>>michael-
>>
>>take a look at the top of your copy of GBParser.pm. what version of cvs
>>is it showing?
>>
>> $self->initialize({requiredDbVersion => {},
>> cvsRevision => '$Revision: 1.14 $', # cvs fills this in!
>> <------ look here
>> cvsTag => '$Name: $', # cvs fills this in!
>> name => ref($self),
>> revisionNotes => 'make consistent with GUS 3.0',
>> easyCspOptions => $easycsp,
>> usage => $usage
>> });
>>
>>steve
>>
>>MICHAEL LUCHTAN wrote:
>>
>>
>>
>>>Hello-
>>>We are still trying to get the gbparser pluging to work correctly.
>>>Entries have been added in the Sres.ExternalDatabase and
>>>Sres.ExternalDatabaseReference tables. We are still getting some strange
>>>errors at the terminal. Here is the first few lines (I tried to send all
>>>of the input but there was a problem with the sourceforge mailer as far as
>>>the size of the file):
>>>[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
>>>--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
>>>CBIgenomic.gb --commit
>>>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>>>Reading properties from /home/luchtan/gus.properties
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>
>>>The first part of the error file generated looks like this(Again the file
>>>was too big to send as an attachment):
>>>------------------ entry number 1 -----------------
>>>
>>>SQL ERROR!! involving
>>>
>>> INSERT INTO DoTS.ExternalNASequence ( c_count, description,
>>>sequence_type_id, row_user_id, user_write, group_write,
>>>secondary_identifier,
>>>na_sequence_id, row_project_id, name, taxon_id,
>>>external_database_release_id, subclass_view, group_read, sequence,
>>>sequence_version, row_grou
>>>p_id, other_read, a_count, length, source_id, modification_date, t_count,
>>>user_read, row_alg_invocation_id, g_count, other_write )
>>> VALUES ( ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
>>>?, ?, SYSDATE, ?, ?, ?, ?, ? )
>>>Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
>>>PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
>>>947, 184573, 1, ExternalNASequence, 1,
>>>atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
>>>cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
>>>ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
>>>ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
>>>gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
>>>ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
>>>ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
>>>tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
>>>cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
>>>acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
>>>1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
>>>ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
>>>
>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>>>'^J SQL ERROR!! involving^J ^J INSERT INTO DoTS.Exter
>>>nalNASequenc...') called at
>>>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
>>>
>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>>>'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
>>>Y(0x90013e8)', '^J INSERT INTO DoTS.ExternalNASequence ( c_count,
>>>description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
>>>line 674
>>>
>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
>>>'HASH(0x8fd9fa4)') called at /home/gus_
>>>home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>>>
>>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>>>called at /home/gus_home/lib/perl/GUS/Model/GusRo
>>>w.pm line 1677
>>>
>>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>>>called at /home/gus_home/lib/perl/GUS/Common/Plugin
>>>/GBParser.pm line 284
>>>
>>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>>>'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
>>>ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
>>>line 185
>>> eval {...} called at
>>>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>>>
>>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>>>'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
>>>rl/GUS/PluginMgr/GusApplication.pm line 389
>>> eval {...} called at
>>>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'GUS::Common::Plugin::GBParser') cal
>>>led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'GUS::Common::Plugin::GBParser') called
>>>at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
>>>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'ARRAY(0x8105130)') called at /home/gus_
>>>home/bin/ga line 11
>>>
>>>
>>>
>>>
>>>
>>>
>>>If anyone can look at this and
>>>see a quick oversight on our part, your advice would be much appreciated.
>>>In the meantime we will be working on it. Thanks,
>>>
>>>Michael Luchtan
>>>http://www.cs.uga.edu/~luchtan
>>>
>>>
>>>
>>>
>>>
>>>-------------------------------------------------------
>>>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>>>The only event dedicated to issues related to Linux enterprise solutions
>>>www.enterpriselinuxforum.com
>>>
>>>_______________________________________________
>>>Gusdev-gusdev mailing list
>>>Gus...@li...
>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>
>>>
>>>
>>>
>>
>>-------------------------------------------------------
>>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>>The only event dedicated to issues related to Linux enterprise solutions
>>www.enterpriselinuxforum.com
>>
>>_______________________________________________
>>Gusdev-gusdev mailing list
>>Gus...@li...
>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>
>>
>>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
>
|
×
Want the latest updates on software, tech news, and AI?
Get latest updates about software, tech news, and AI from SourceForge directly in your inbox once a month.
Thanks for helping keep SourceForge clean.
X