Menu
▾
▴
gusdev-gusdev
|
From: Madhura S. <sma...@st...> - 2004-05-20 02:07:36
|
Hi All
I am trying to load EMBL files into GUS, but having some problems,
when I try to execute the command :
ga GUS::Common::Plugin::GenericParser2Gus --filetype=3Dembl =
-filepath=3Db.pertussis.embl -sequencetype=3Dds-DNA
without commit, I get the following error:
*********************************************************
***COMMIT TURNED OFF***
Dumping log: $VAR1 =3D '/tmp//GenericParser2Gusdev.pid28608.log';
embl file to parse, b.bronchiseptica.embl...
ID line fine!!!
source feature found, FT source 1..5339179!!
processing bioperl sequence, BB...
sequence not in GUS yet
can't find SequenceType, ds-DNA
number of features =3D 5009
organism, taxon id: Bordetella bronchiseptica,
DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into =
("DOTS"."NASE
QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at =
/afs/ir/users/s/m/
smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
(after this along sequence is printed)
ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAA=
CGCTCTT
TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, =
1825282, 0
at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm =
line 18
5
=20
*************************************************************************=
**
Can someone tell me why this error is occuring?
Thanks!
Madhura
|
|
From: <pj...@sa...> - 2004-05-20 10:25:49
|
Madhura,
Did you setup the DoTS.SequenceType tables?
I presume it can't find ds-DNA in there (and doesn't report it - I shall improve
the plugin).
See: GUS/Website/htdocs/documentation/installguide_UGA.html
and do a search for ds-DNA to find all the INSERT statements for ss-DNA, ds-DNA,
ss-RNA etc. I'm guessing we used those statements here at Sanger.
All,
On a slightly related note, I do have a collection of XML files that populate
dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. Someone
emailed the list and said it would be good to have this somewhere, perhaps CVS.
I agree, although we would need to have "common" and "center specific"
dirctories. I am in the process of setting up a new GUS instance so I will soon
be in a better position to propose something.
Paul.
Quoting Madhura Sharangpani <sma...@st...>:
> Hi All
>
> I am trying to load EMBL files into GUS, but having some problems,
> when I try to execute the command :
>
> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> -filepath=b.pertussis.embl -sequencetype=ds-DNA
>
> without commit, I get the following error:
>
> *********************************************************
> ***COMMIT TURNED OFF***
> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
>
> embl file to parse, b.bronchiseptica.embl...
> ID line fine!!!
> source feature found, FT source 1..5339179!!
> processing bioperl sequence, BB...
> sequence not in GUS yet
> can't find SequenceType, ds-DNA
> number of features = 5009
> organism, taxon id: Bordetella bronchiseptica,
> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> ("DOTS"."NASE
> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> /afs/ir/users/s/m/
> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
>
> (after this along sequence is printed)
>
> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, 1825282,
> 0
> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> 18
> 5
>
> ***************************************************************************
> Can someone tell me why this error is occuring?
>
> Thanks!
>
> Madhura
>
|
|
From: Steve F. <st...@pc...> - 2004-05-20 11:58:25
|
paul-
the xml files would be very helpful. a cbil, we are about to setup a
new instance... on PostgreSQL. this will be our first new instance in
years, so we'll also be trying to compile docs and data.
steve
pj...@sa... wrote:
>Madhura,
>
>Did you setup the DoTS.SequenceType tables?
>I presume it can't find ds-DNA in there (and doesn't report it - I shall improve
>the plugin).
>See: GUS/Website/htdocs/documentation/installguide_UGA.html
>and do a search for ds-DNA to find all the INSERT statements for ss-DNA, ds-DNA,
>ss-RNA etc. I'm guessing we used those statements here at Sanger.
>
>All,
>
>On a slightly related note, I do have a collection of XML files that populate
>dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. Someone
>emailed the list and said it would be good to have this somewhere, perhaps CVS.
>I agree, although we would need to have "common" and "center specific"
>dirctories. I am in the process of setting up a new GUS instance so I will soon
>be in a better position to propose something.
>
>Paul.
>
>Quoting Madhura Sharangpani <sma...@st...>:
>
>
>
>>Hi All
>>
>>I am trying to load EMBL files into GUS, but having some problems,
>>when I try to execute the command :
>>
>>ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
>>-filepath=b.pertussis.embl -sequencetype=ds-DNA
>>
>>without commit, I get the following error:
>>
>>*********************************************************
>>***COMMIT TURNED OFF***
>>Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
>>
>>embl file to parse, b.bronchiseptica.embl...
>>ID line fine!!!
>>source feature found, FT source 1..5339179!!
>>processing bioperl sequence, BB...
>>sequence not in GUS yet
>>can't find SequenceType, ds-DNA
>>number of features = 5009
>>organism, taxon id: Bordetella bronchiseptica,
>>DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
>>("DOTS"."NASE
>>QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
>>/afs/ir/users/s/m/
>>smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
>>
>>(after this along sequence is printed)
>>
>>ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
>>TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, 1825282,
>>0
>>at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
>>18
>>5
>>
>>***************************************************************************
>>Can someone tell me why this error is occuring?
>>
>>Thanks!
>>
>>Madhura
>>
>>
>>
>
>
>
>
>
>-------------------------------------------------------
>This SF.Net email is sponsored by: Oracle 10g
>Get certified on the hottest thing ever to hit the market... Oracle 10g.
>Take an Oracle 10g class now, and we'll give you the exam FREE.
>http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
>
|
|
From: MICHAEL L. <lu...@cs...> - 2004-05-20 13:03:36
|
I've encountered this SequenceType problem before also. Some plug-ins have database specific arguements in them regarding this table. In my opinion it is another prime candidate for a "common" xml instantiation file. Maybe we should start making a list/asking for candidates of tables that are common enough/generic enough to be used by everyone? Michael Luchtan http://www.cs.uga.edu/~luchtan On Thu, 20 May 2004, Steve Fischer wrote: > paul- > > the xml files would be very helpful. a cbil, we are about to setup a > new instance... on PostgreSQL. this will be our first new instance in > years, so we'll also be trying to compile docs and data. > > steve > > pj...@sa... wrote: > > >Madhura, > > > >Did you setup the DoTS.SequenceType tables? > >I presume it can't find ds-DNA in there (and doesn't report it - I shall improve > >the plugin). > >See: GUS/Website/htdocs/documentation/installguide_UGA.html > >and do a search for ds-DNA to find all the INSERT statements for ss-DNA, ds-DNA, > >ss-RNA etc. I'm guessing we used those statements here at Sanger. > > > >All, > > > >On a slightly related note, I do have a collection of XML files that populate > >dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. Someone > >emailed the list and said it would be good to have this somewhere, perhaps CVS. > >I agree, although we would need to have "common" and "center specific" > >dirctories. I am in the process of setting up a new GUS instance so I will soon > >be in a better position to propose something. > > > >Paul. > > > >Quoting Madhura Sharangpani <sma...@st...>: > > > > > > > >>Hi All > >> > >>I am trying to load EMBL files into GUS, but having some problems, > >>when I try to execute the command : > >> > >>ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl > >>-filepath=b.pertussis.embl -sequencetype=ds-DNA > >> > >>without commit, I get the following error: > >> > >>********************************************************* > >>***COMMIT TURNED OFF*** > >>Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log'; > >> > >>embl file to parse, b.bronchiseptica.embl... > >>ID line fine!!! > >>source feature found, FT source 1..5339179!! > >>processing bioperl sequence, BB... > >>sequence not in GUS yet > >>can't find SequenceType, ds-DNA > >>number of features = 5009 > >>organism, taxon id: Bordetella bronchiseptica, > >>DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into > >>("DOTS"."NASE > >>QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at > >>/afs/ir/users/s/m/ > >>smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145. > >> > >>(after this along sequence is printed) > >> > >>ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT > >>TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, 1825282, > >>0 > >>at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line > >>18 > >>5 > >> > >>*************************************************************************** > >>Can someone tell me why this error is occuring? > >> > >>Thanks! > >> > >>Madhura > >> > >> > >> > > > > > > > > > > > >------------------------------------------------------- > >This SF.Net email is sponsored by: Oracle 10g > >Get certified on the hottest thing ever to hit the market... Oracle 10g. > >Take an Oracle 10g class now, and we'll give you the exam FREE. > >http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click > >_______________________________________________ > >Gusdev-gusdev mailing list > >Gus...@li... > >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev > > > > > |
|
From: Sucheta T. <su...@vb...> - 2004-05-20 12:20:04
|
Hi,
Does it mean that GenericParser2GUS can upload data from signalP, TMHMM
and other data?
Thanks
Sucheta
>
> Did you setup the DoTS.SequenceType tables?
> I presume it can't find ds-DNA in there (and doesn't report it - I shall
> improve
> the plugin).
> See: GUS/Website/htdocs/documentation/installguide_UGA.html
> and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
> ds-DNA,
> ss-RNA etc. I'm guessing we used those statements here at Sanger.
>
> All,
>
> On a slightly related note, I do have a collection of XML files that
> populate
> dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
> Someone
> emailed the list and said it would be good to have this somewhere, perhaps
> CVS.
> I agree, although we would need to have "common" and "center specific"
> dirctories. I am in the process of setting up a new GUS instance so I will
> soon
> be in a better position to propose something.
>
> Paul.
>
> Quoting Madhura Sharangpani <sma...@st...>:
>
>> Hi All
>>
>> I am trying to load EMBL files into GUS, but having some problems,
>> when I try to execute the command :
>>
>> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
>> -filepath=b.pertussis.embl -sequencetype=ds-DNA
>>
>> without commit, I get the following error:
>>
>> *********************************************************
>> ***COMMIT TURNED OFF***
>> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
>>
>> embl file to parse, b.bronchiseptica.embl...
>> ID line fine!!!
>> source feature found, FT source 1..5339179!!
>> processing bioperl sequence, BB...
>> sequence not in GUS yet
>> can't find SequenceType, ds-DNA
>> number of features = 5009
>> organism, taxon id: Bordetella bronchiseptica,
>> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
>> ("DOTS"."NASE
>> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
>> /afs/ir/users/s/m/
>> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
>>
>> (after this along sequence is printed)
>>
>> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
>> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
>> 1825282,
>> 0
>> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
>> line
>> 18
>> 5
>>
>> ***************************************************************************
>> Can someone tell me why this error is occuring?
>>
>> Thanks!
>>
>> Madhura
>>
>
>
>
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by: Oracle 10g
> Get certified on the hottest thing ever to hit the market... Oracle 10g.
> Take an Oracle 10g class now, and we'll give you the exam FREE.
> http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>
--
Sucheta Tripathy
Virginia Bioinformatics Institute Phase-I
Washington street.
Virginia Tech.
Blacksburg,VA 24061-0447
phone:(540)231-8138
Fax: (540) 231-2606
|
|
From: <pj...@sa...> - 2004-05-20 12:45:06
|
Quoting Sucheta Tripathy <su...@vb...>:
> Hi,
>
> Does it mean that GenericParser2GUS can upload data from signalP, TMHMM
> and other data?
As long as the data is in an EMBL file.
In theory it could be any file Bioperl understands though but this has not been
tested.
> Thanks
>
> Sucheta
> >
> > Did you setup the DoTS.SequenceType tables?
> > I presume it can't find ds-DNA in there (and doesn't report it - I shall
> > improve
> > the plugin).
> > See: GUS/Website/htdocs/documentation/installguide_UGA.html
> > and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
> > ds-DNA,
> > ss-RNA etc. I'm guessing we used those statements here at Sanger.
> >
> > All,
> >
> > On a slightly related note, I do have a collection of XML files that
> > populate
> > dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
> > Someone
> > emailed the list and said it would be good to have this somewhere, perhaps
> > CVS.
> > I agree, although we would need to have "common" and "center specific"
> > dirctories. I am in the process of setting up a new GUS instance so I will
> > soon
> > be in a better position to propose something.
> >
> > Paul.
> >
> > Quoting Madhura Sharangpani <sma...@st...>:
> >
> >> Hi All
> >>
> >> I am trying to load EMBL files into GUS, but having some problems,
> >> when I try to execute the command :
> >>
> >> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> >> -filepath=b.pertussis.embl -sequencetype=ds-DNA
> >>
> >> without commit, I get the following error:
> >>
> >> *********************************************************
> >> ***COMMIT TURNED OFF***
> >> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> >>
> >> embl file to parse, b.bronchiseptica.embl...
> >> ID line fine!!!
> >> source feature found, FT source 1..5339179!!
> >> processing bioperl sequence, BB...
> >> sequence not in GUS yet
> >> can't find SequenceType, ds-DNA
> >> number of features = 5009
> >> organism, taxon id: Bordetella bronchiseptica,
> >> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> >> ("DOTS"."NASE
> >> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> >> /afs/ir/users/s/m/
> >> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> >>
> >> (after this along sequence is printed)
> >>
> >>
> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
> >> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
> >> 1825282,
> >> 0
> >> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> >> line
> >> 18
> >> 5
> >>
> >>
> ***************************************************************************
> >> Can someone tell me why this error is occuring?
> >>
> >> Thanks!
> >>
> >> Madhura
> >>
> >
> >
> >
> >
> >
> > -------------------------------------------------------
> > This SF.Net email is sponsored by: Oracle 10g
> > Get certified on the hottest thing ever to hit the market... Oracle 10g.
> > Take an Oracle 10g class now, and we'll give you the exam FREE.
> > http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> > _______________________________________________
> > Gusdev-gusdev mailing list
> > Gus...@li...
> > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
>
>
> --
> Sucheta Tripathy
> Virginia Bioinformatics Institute Phase-I
> Washington street.
> Virginia Tech.
> Blacksburg,VA 24061-0447
> phone:(540)231-8138
> Fax: (540) 231-2606
>
|
|
From: Madhura S. <sma...@st...> - 2004-05-20 20:08:59
|
Hi Paul
After reading your email, I setted up Dots.SequenceType tables with required
ds-DNA entries and then tried loading EMBL files again, this time it made
progress, it didn't give "can't fine sequence type ds-DNA" error, but it
went ahead and gave following error:
**********************************************
buildRNA() : DoTS.RNA created.
buildRNAInstance() : $rna_object->getId() =
buildRNAInstance() : Creating brand new RNAInstance
Object type is 'GUS::Model::DoTS::GeneFeature', $object =
GUS::Model::DoTS::Gene
Feature=HASH(0x173113c)
DBD::Oracle::st execute failed: ORA-02291: integrity constraint
(DOTS.NAFEATUREI
MP_FK08) violated - parent key not found (DBD ERROR: OCIStmtExecute) at
/afs/ir/
users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
SQL ERROR!! involving
INSERT INTO DoTS.GeneFeature ( gene_type, row_user_id, user_write,
group_wr
ite, na_sequence_id, row_project_id, name, is_partial, product, is_pseudo,
revie
w_status_id, subclass_view, group_read, row_group_id, other_read,
modification_d
ate, is_predicted, user_read, row_alg_invocation_id, other_write,
na_feature_id,
number_of_exons )
VALUES ( ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, SYSDATE, ?, ?,
?, ?
, ?, ? )
Values: protein coding, 1, 1, 1, 49, 1, BP0001, 0, glucose inhibited
division p
rotein A, 0, 5, GeneFeature, 1, 1, 1, 1, 1, 99, 0, 1, 1 at
/afs/ir/users/s/m/sma
dhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0xb791a
8)', '^J SQL ERROR!! involving^J ^J INSERT INTO DoTS.GeneFeature (
ge...') c
alled at
/afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm l
ine 148
**********************************************
Madhura
----- Original Message -----
From: <pj...@sa...>
To: "Madhura Sharangpani" <sma...@st...>
Cc: <gus...@li...>
Sent: Thursday, May 20, 2004 3:25 AM
Subject: Re: [Gusdev-gusdev] Problem loading EMBL files into GUS
> Madhura,
>
> Did you setup the DoTS.SequenceType tables?
> I presume it can't find ds-DNA in there (and doesn't report it - I shall
improve
> the plugin).
> See: GUS/Website/htdocs/documentation/installguide_UGA.html
> and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
ds-DNA,
> ss-RNA etc. I'm guessing we used those statements here at Sanger.
>
> All,
>
> On a slightly related note, I do have a collection of XML files that
populate
> dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
Someone
> emailed the list and said it would be good to have this somewhere, perhaps
CVS.
> I agree, although we would need to have "common" and "center specific"
> dirctories. I am in the process of setting up a new GUS instance so I will
soon
> be in a better position to propose something.
>
> Paul.
>
> Quoting Madhura Sharangpani <sma...@st...>:
>
> > Hi All
> >
> > I am trying to load EMBL files into GUS, but having some problems,
> > when I try to execute the command :
> >
> > ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> > -filepath=b.pertussis.embl -sequencetype=ds-DNA
> >
> > without commit, I get the following error:
> >
> > *********************************************************
> > ***COMMIT TURNED OFF***
> > Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> >
> > embl file to parse, b.bronchiseptica.embl...
> > ID line fine!!!
> > source feature found, FT source 1..5339179!!
> > processing bioperl sequence, BB...
> > sequence not in GUS yet
> > can't find SequenceType, ds-DNA
> > number of features = 5009
> > organism, taxon id: Bordetella bronchiseptica,
> > DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> > ("DOTS"."NASE
> > QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> > /afs/ir/users/s/m/
> > smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> >
> > (after this along sequence is printed)
> >
> >
ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGC
TCTT
> > TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
1825282,
> > 0
> > at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
line
> > 18
> > 5
> >
> >
***************************************************************************
> > Can someone tell me why this error is occuring?
> >
> > Thanks!
> >
> > Madhura
> >
>
>
>
|
|
From: <pj...@sa...> - 2004-05-21 08:56:18
|
Madhura,
The constraint applies to the DoTS.GeneFeature.ReviewStatus. The dictionary
table SRes.ReviewStatus is probably not populated, hence you need some more XML!!!
I have not tested this but it is quite simple. Yes, I have added it to my "list
of XML files to put in CVS".
<SRes::ReviewStatus>
<REVIEW_STATUS_ID>5</REVIEW_STATUS_ID>
<NAME>Unknown</NAME>
<DESCRIPTION>Review status not known</DESCRIPTION>
<SRes::ReviewStatus>
<SRes::ReviewStatus>
<REVIEW_STATUS_ID>10</REVIEW_STATUS_ID>
<NAME>Not reviewed</NAME>
<DESCRIPTION>A human has not yet reviewed this feature</DESCRIPTION>
<SRes::ReviewStatus>
<SRes::ReviewStatus>
<REVIEW_STATUS_ID>15</REVIEW_STATUS_ID>
<NAME>Annotated</NAME>
<DESCRIPTION>Annotator/Curator has attached data to this feature</DESCRIPTION>
<SRes::ReviewStatus>
Quoting Madhura Sharangpani <sma...@st...>:
>
> Hi Paul
>
> After reading your email, I setted up Dots.SequenceType tables with required
> ds-DNA entries and then tried loading EMBL files again, this time it made
> progress, it didn't give "can't fine sequence type ds-DNA" error, but it
> went ahead and gave following error:
>
> **********************************************
> buildRNA() : DoTS.RNA created.
> buildRNAInstance() : $rna_object->getId() =
> buildRNAInstance() : Creating brand new RNAInstance
> Object type is 'GUS::Model::DoTS::GeneFeature', $object =
> GUS::Model::DoTS::Gene
> Feature=HASH(0x173113c)
> DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> (DOTS.NAFEATUREI
> MP_FK08) violated - parent key not found (DBD ERROR: OCIStmtExecute) at
> /afs/ir/
> users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
>
> SQL ERROR!! involving
>
> INSERT INTO DoTS.GeneFeature ( gene_type, row_user_id, user_write,
> group_wr
> ite, na_sequence_id, row_project_id, name, is_partial, product, is_pseudo,
> revie
> w_status_id, subclass_view, group_read, row_group_id, other_read,
> modification_d
> ate, is_predicted, user_read, row_alg_invocation_id, other_write,
> na_feature_id,
> number_of_exons )
> VALUES ( ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, SYSDATE, ?, ?,
> ?, ?
> , ?, ? )
> Values: protein coding, 1, 1, 1, 49, 1, BP0001, 0, glucose inhibited
> division p
> rotein A, 0, 5, GeneFeature, 1, 1, 1, 1, 1, 99, 0, 1, 1 at
> /afs/ir/users/s/m/sma
> dhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
>
> GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0xb791a
> 8)', '^J SQL ERROR!! involving^J ^J INSERT INTO DoTS.GeneFeature (
> ge...') c
> alled at
> /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm l
> ine 148
> **********************************************
>
> Madhura
>
>
>
> ----- Original Message -----
> From: <pj...@sa...>
> To: "Madhura Sharangpani" <sma...@st...>
> Cc: <gus...@li...>
> Sent: Thursday, May 20, 2004 3:25 AM
> Subject: Re: [Gusdev-gusdev] Problem loading EMBL files into GUS
>
>
> > Madhura,
> >
> > Did you setup the DoTS.SequenceType tables?
> > I presume it can't find ds-DNA in there (and doesn't report it - I shall
> improve
> > the plugin).
> > See: GUS/Website/htdocs/documentation/installguide_UGA.html
> > and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
> ds-DNA,
> > ss-RNA etc. I'm guessing we used those statements here at Sanger.
> >
> > All,
> >
> > On a slightly related note, I do have a collection of XML files that
> populate
> > dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
> Someone
> > emailed the list and said it would be good to have this somewhere, perhaps
> CVS.
> > I agree, although we would need to have "common" and "center specific"
> > dirctories. I am in the process of setting up a new GUS instance so I will
> soon
> > be in a better position to propose something.
> >
> > Paul.
> >
> > Quoting Madhura Sharangpani <sma...@st...>:
> >
> > > Hi All
> > >
> > > I am trying to load EMBL files into GUS, but having some problems,
> > > when I try to execute the command :
> > >
> > > ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> > > -filepath=b.pertussis.embl -sequencetype=ds-DNA
> > >
> > > without commit, I get the following error:
> > >
> > > *********************************************************
> > > ***COMMIT TURNED OFF***
> > > Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> > >
> > > embl file to parse, b.bronchiseptica.embl...
> > > ID line fine!!!
> > > source feature found, FT source 1..5339179!!
> > > processing bioperl sequence, BB...
> > > sequence not in GUS yet
> > > can't find SequenceType, ds-DNA
> > > number of features = 5009
> > > organism, taxon id: Bordetella bronchiseptica,
> > > DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> > > ("DOTS"."NASE
> > > QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> > > /afs/ir/users/s/m/
> > > smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> > >
> > > (after this along sequence is printed)
> > >
> > >
> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGC
> TCTT
> > > TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
> 1825282,
> > > 0
> > > at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> line
> > > 18
> > > 5
> > >
> > >
> ***************************************************************************
> > > Can someone tell me why this error is occuring?
> > >
> > > Thanks!
> > >
> > > Madhura
> > >
> >
> >
> >
>
|
×
Want the latest updates on software, tech news, and AI?
Get latest updates about software, tech news, and AI from SourceForge directly in your inbox once a month.
Thanks for helping keep SourceForge clean.
X