gusdev-gusdev — Topics concerning GUS development

Re: [Gusdev-gusdev] GBParser Failures...:(

[MICHAEL L. <lu...@cs...>]

Hello Steve--

Here is the first occurence of the dbdbihandle error:
Inserting:
Table: NAEntry
	created_date: [2003-5-03 00:00:00]   <--------
	row_user_id: [6]
	user_write: [1]
	group_write: [1]
	created_rel_ver: [135]
	na_sequence_id: [1911]
	row_project_id: [2]
	group_read: [1]
	row_group_id: [3]
	other_read: [1]
	source_id: [AY140947]
	modification_date: [SYSDATE]
	user_read: [1]
	row_alg_invocation_id: [139]
	other_write: [0]
	version: [1]
	division: [INV]
DBD::Oracle::st execute failed: ORA-01861: literal does not match format
string (DBD ERROR: OCIStmtExecute) at
/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 144, <GEN0> line
74.

On the sql prompt we checked the dots.NAentry table, which is this:
SQL> describe dots.naentry;
 Name                                      Null?    Type
 ----------------------------------------- --------
----------------------------
 NA_ENTRY_ID                               NOT NULL NUMBER(10)
 NA_SEQUENCE_ID                            NOT NULL NUMBER(10)
 SOURCE_ID                                 NOT NULL VARCHAR2(15)
 STATUS                                             VARCHAR2(12)
 DIVISION                                           VARCHAR2(15)
 VERSION                                            NUMBER(12)
 NID                                                VARCHAR2(15)
 CREATED_DATE                                       DATE
 CREATED_REL_VER                                    NUMBER(5)
 UPDATE_DATE                                        DATE
 UPDATE_REL_VER                                     NUMBER(5)
 MODIFICATION_DATE                         NOT NULL DATE
 USER_READ                                 NOT NULL NUMBER(1)
 USER_WRITE                                NOT NULL NUMBER(1)
 GROUP_READ                                NOT NULL NUMBER(1)
 GROUP_WRITE                               NOT NULL NUMBER(1)
 OTHER_READ                                NOT NULL NUMBER(1)
 OTHER_WRITE                               NOT NULL NUMBER(1)
 ROW_USER_ID                               NOT NULL NUMBER(12)
 ROW_GROUP_ID                              NOT NULL NUMBER(3)
 ROW_PROJECT_ID                            NOT NULL NUMBER(3)
 ROW_ALG_INVOCATION_ID                     NOT NULL NUMBER(12)


We are guessing that the type mismatch is with the created_date attribute,
which for some reason the parser is attempting to enter in the wrong
format.  Thanks,


Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Tue, 13 May 2003, Steve Fischer wrote:

> michael-
>
> look in the log that captures stdout for sql errors on or near line 144
> of DbDbiHandle.pm
>
> that was the main clue last time.
>
> steve
>
> MICHAEL LUCHTAN wrote:
>
> >Hello-
> >We have advanced a little further in our effort to get the gbparser plugin
> >running on a new GUS installation.  Thank you for the help so far, and we
> >have resolved the dependency regarding the Dots.sequencetype table, but
> >unfortunately we have new dependency errors.  Here a snapshot from the
> >generated error log:
> >
> >
> >
> > ------------------ entry number 1 -----------------
> >
> > SQL ERROR!! involving
> >
> >    INSERT INTO DoTS.NAEntry (  created_date, row_user_id, user_write,
> >group_write, created_rel_ver, na_sequence_id, row_project_id, group_read,
> >row_group_id, other_read, na_entry_id, source_id, modification_date,
> >user_read, row_alg_invocation_id, other_write, version, division )
> >    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?
> >)
> > Values: 2003-5-03 00:00:00, 6, 1, 1, 135, 1809, 2, 1, 3, 1, 205,
> >AY140947, 1, 138, 0, 1, INV at
> >/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
> >
> >GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbd68)',
> >'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.NAEntry (  create...')
> >called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
> >
> >GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbd68)',
> >'GUS::ObjRelP::DbiDbHandle::st=HASH(0x8f3e0ec)', 'ARRAY(0x8f3c990)', '^J
> >INSERT INTO DoTS.NAEntry (  created_date, row_user_id, user...') called at
> >/home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 674
> >
> >GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)',
> >'HASH(0x8f3c810)') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
> >line 621
> >
> >GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)')
> >called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1677
> >
> >GUS::Model::GusRow::submit('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)',
> >undef, 1) called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1765
> >
> >GUS::Model::GusRow::submitChildrenInClass('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)',
> >'GUS::Model::DoTS::NAEntry') called at
> >/home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1746
> >
> >GUS::Model::GusRow::submitAllChildren('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)')
> >called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1684
> >
> >GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)')
> >called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 284
> >
> >GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be838)',
> >'CBIL::Bio::GenBank::ArrayStream=HASH(0x8ccac48)') called at
> >/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
> >	eval {...} called at
> >/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >
> >GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be838)',
> >'HASH(0x8c60dc8)') called at
> >/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 389
> >	eval {...} called at
> >/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
> >
> >GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'GUS::Common::Plugin::GBParser') called at
> >/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
> >
> >GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'GUS::Common::Plugin::GBParser') called at
> >/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
> >
> >GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'ARRAY(0x8105130)') called at /home/gus_home/bin/ga line 11
> >
> >
> >Thank you...
> >
> >Michael Luchtan
> >http://www.cs.uga.edu/~luchtan
> >
> >
> >
> >
> >-------------------------------------------------------
> >Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> >The only event dedicated to issues related to Linux enterprise solutions
> >www.enterpriselinuxforum.com
> >
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> >
>
>
>
>
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
>
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>

Re: [Gusdev-gusdev] GBParser Failures...:(

[Steve F. <st...@pc...>]

michael-

look in the log that captures stdout for sql errors on or near line 144 
of DbDbiHandle.pm

that was the main clue last time.

steve

MICHAEL LUCHTAN wrote:

>Hello-
>We have advanced a little further in our effort to get the gbparser plugin
>running on a new GUS installation.  Thank you for the help so far, and we
>have resolved the dependency regarding the Dots.sequencetype table, but
>unfortunately we have new dependency errors.  Here a snapshot from the
>generated error log:
>
>
>
> ------------------ entry number 1 -----------------
>
> SQL ERROR!! involving
>
>    INSERT INTO DoTS.NAEntry (  created_date, row_user_id, user_write,
>group_write, created_rel_ver, na_sequence_id, row_project_id, group_read,
>row_group_id, other_read, na_entry_id, source_id, modification_date,
>user_read, row_alg_invocation_id, other_write, version, division )
>    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?
>)
> Values: 2003-5-03 00:00:00, 6, 1, 1, 135, 1809, 2, 1, 3, 1, 205,
>AY140947, 1, 138, 0, 1, INV at
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbd68)',
>'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.NAEntry (  create...')
>called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbd68)',
>'GUS::ObjRelP::DbiDbHandle::st=HASH(0x8f3e0ec)', 'ARRAY(0x8f3c990)', '^J
>INSERT INTO DoTS.NAEntry (  created_date, row_user_id, user...') called at
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 674
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)',
>'HASH(0x8f3c810)') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
>line 621
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)')
>called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1677
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)',
>undef, 1) called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1765
>
>GUS::Model::GusRow::submitChildrenInClass('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)',
>'GUS::Model::DoTS::NAEntry') called at
>/home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1746
>
>GUS::Model::GusRow::submitAllChildren('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)')
>called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1684
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)')
>called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 284
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be838)',
>'CBIL::Bio::GenBank::ArrayStream=HASH(0x8ccac48)') called at
>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
>	eval {...} called at
>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be838)',
>'HASH(0x8c60dc8)') called at
>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 389
>	eval {...} called at
>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') called at
>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') called at
>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'ARRAY(0x8105130)') called at /home/gus_home/bin/ga line 11
>
>
>Thank you...
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

[Gusdev-gusdev] GBParser Failures...:(

[MICHAEL L. <lu...@cs...>]

Hello-
We have advanced a little further in our effort to get the gbparser plugin
running on a new GUS installation.  Thank you for the help so far, and we
have resolved the dependency regarding the Dots.sequencetype table, but
unfortunately we have new dependency errors.  Here a snapshot from the
generated error log:



 ------------------ entry number 1 -----------------

 SQL ERROR!! involving

    INSERT INTO DoTS.NAEntry (  created_date, row_user_id, user_write,
group_write, created_rel_ver, na_sequence_id, row_project_id, group_read,
row_group_id, other_read, na_entry_id, source_id, modification_date,
user_read, row_alg_invocation_id, other_write, version, division )
    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, SYSDATE, ?, ?, ?, ?, ?
)
 Values: 2003-5-03 00:00:00, 6, 1, 1, 135, 1809, 2, 1, 3, 1, 205,
AY140947, 1, 138, 0, 1, INV at
/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184

GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbd68)',
'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.NAEntry (  create...')
called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147

GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbd68)',
'GUS::ObjRelP::DbiDbHandle::st=HASH(0x8f3e0ec)', 'ARRAY(0x8f3c990)', '^J
INSERT INTO DoTS.NAEntry (  created_date, row_user_id, user...') called at
/home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm line 674

GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)',
'HASH(0x8f3c810)') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
line 621

GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)')
called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1677

GUS::Model::GusRow::submit('GUS::Model::DoTS::NAEntry=HASH(0x8d72bf0)',
undef, 1) called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1765

GUS::Model::GusRow::submitChildrenInClass('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)',
'GUS::Model::DoTS::NAEntry') called at
/home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1746

GUS::Model::GusRow::submitAllChildren('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)')
called at /home/gus_home/lib/perl/GUS/Model/GusRow.pm line 1684

GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d6b500)')
called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 284

GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be838)',
'CBIL::Bio::GenBank::ArrayStream=HASH(0x8ccac48)') called at
/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 185
	eval {...} called at
/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184

GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be838)',
'HASH(0x8c60dc8)') called at
/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 389
	eval {...} called at
/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385

GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'GUS::Common::Plugin::GBParser') called at
/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284

GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'GUS::Common::Plugin::GBParser') called at
/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193

GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'ARRAY(0x8105130)') called at /home/gus_home/bin/ga line 11


Thank you...

Michael Luchtan
http://www.cs.uga.edu/~luchtan

Re: [Gusdev-gusdev] GBParser Failure

[Steve F. <sfi...@pc...>]

Michael-

We (Debbie and I) have poked around, and think we know what is going on.

What we did:
  1. looked in your gbFailures.errors file (which captures stderr), and 
saw that there was an SQL error.  We matched all the values against the 
columns you were inserting into, and they looked fine.  But, looking at 
the stack trace, we saw that the SQL error happened in DbiDbHandle 
around line 147
  2. so, then, we looked in your log file (which captures stdout), and 
saw oracle errors that were reported as originating on line 144 of that 
same file:
DBD::Oracle::st execute failed: ORA-02291: integrity constraint 
(DOTS.NASEQUENCEIMP_FK01) violated - parent key not found (DBD ERROR: 
OCIStmtExecute) at /home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm 
line 144, <GEN0> line 74.

We then looked up that integrity contstrain in the file:
   projects/GUS/Model/schema/oracle/dots-constraints.sql

and we saw this:

alter table @oracle_dots@.NASEQUENCEIMP add constraint 
NASEQUENCEIMP_FK01 foreign key (SEQUENCE_TYPE_ID) references 
@oracle_dots@.SEQUENCETYPE (SEQUENCE_TYPE_ID);

which... leads us to the conclusion that this is another instance of you 
guys needing some data in a table.  In this case, the table is 
Dots.sequencetype.  basically, the gb parser is looking there to label 
the sequence with types such as mRNA.

Attached is a file containing the values from our table.  

Note:  the gbparser has *hard-coded* that the id for type "unknown" is 
11.  if you can force that to be the case, then the rest of the ids 
don't matter, as long as you have the sequence types in the table.

steve


MICHAEL LUCHTAN wrote:

>Looks like 1.15:
>
>
>
>$self->initialize({requiredDbVersion => {},
>		     cvsRevision => '$Revision: 1.15 $',	# cvs
>fills this in!
>		     cvsTag => '$Name:  $', # cvs fills this in!
>		     name => ref($self),
>		     revisionNotes => 'make consistent with GUS 3.0',
>		     easyCspOptions => $easycsp,
>		     usage => $usage
>		    });
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>On Tue, 13 May 2003, Steve Fischer wrote:
>
>  
>
>>michael-
>>
>>take a look at the top of your copy of GBParser.pm.  what version of cvs
>>is it showing?
>>
>>  $self->initialize({requiredDbVersion => {},
>>             cvsRevision => '$Revision: 1.14 $',    # cvs fills this in!
>>   <------ look here
>>             cvsTag => '$Name:  $', # cvs fills this in!
>>             name => ref($self),
>>             revisionNotes => 'make consistent with GUS 3.0',
>>             easyCspOptions => $easycsp,
>>             usage => $usage
>>            });
>>
>>steve
>>
>>MICHAEL LUCHTAN wrote:
>>
>>    
>>
>>>Hello-
>>>We are still trying to get the gbparser pluging to work correctly.
>>>Entries have been added in the Sres.ExternalDatabase and
>>>Sres.ExternalDatabaseReference tables.  We are still getting some strange
>>>errors at the terminal.  Here is the first few lines (I tried to send all
>>>of the input but there was a problem with the sourceforge mailer as far as
>>>the size of the file):
>>>[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
>>>--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
>>>CBIgenomic.gb --commit
>>>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>>>Reading properties from /home/luchtan/gus.properties
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>>>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>>>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>>>
>>>The first part of the error file generated looks like this(Again the file
>>>was too big to send as an attachment):
>>>------------------ entry number 1 -----------------
>>>
>>>SQL ERROR!! involving
>>>
>>>   INSERT INTO DoTS.ExternalNASequence (  c_count, description,
>>>sequence_type_id, row_user_id, user_write, group_write,
>>>secondary_identifier,
>>>na_sequence_id, row_project_id, name, taxon_id,
>>>external_database_release_id, subclass_view, group_read, sequence,
>>>sequence_version, row_grou
>>>p_id, other_read, a_count, length, source_id, modification_date, t_count,
>>>user_read, row_alg_invocation_id, g_count, other_write )
>>>   VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
>>>?, ?, SYSDATE, ?, ?, ?, ?, ? )
>>>Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
>>>PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
>>>947, 184573, 1, ExternalNASequence, 1,
>>>atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
>>>cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
>>>ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
>>>ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
>>>gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
>>>ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
>>>ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
>>>tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
>>>cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
>>>acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
>>>1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
>>>ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
>>>
>>>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>>>'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.Exter
>>>nalNASequenc...') called at
>>>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
>>>
>>>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>>>'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
>>>Y(0x90013e8)', '^J    INSERT INTO DoTS.ExternalNASequence (  c_count,
>>>description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
>>>line 674
>>>
>>>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
>>>'HASH(0x8fd9fa4)') called at /home/gus_
>>>home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>>>
>>>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>>>called at /home/gus_home/lib/perl/GUS/Model/GusRo
>>>w.pm line 1677
>>>
>>>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>>>called at /home/gus_home/lib/perl/GUS/Common/Plugin
>>>/GBParser.pm line 284
>>>
>>>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>>>'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
>>>ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
>>>line 185
>>>       eval {...} called at
>>>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>>>
>>>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>>>'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
>>>rl/GUS/PluginMgr/GusApplication.pm line 389
>>>       eval {...} called at
>>>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'GUS::Common::Plugin::GBParser') cal
>>>led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
>>>
>>>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'GUS::Common::Plugin::GBParser') called
>>>at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
>>>
>>>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>>>'ARRAY(0x8105130)') called at /home/gus_
>>>home/bin/ga line 11
>>>
>>>
>>>
>>>
>>>
>>>
>>>If anyone can look at this and
>>>see a quick oversight on our part, your advice would be much appreciated.
>>>In the meantime we will be working on it.   Thanks,
>>>
>>>Michael Luchtan
>>>http://www.cs.uga.edu/~luchtan
>>>
>>>
>>>
>>>
>>>
>>>-------------------------------------------------------
>>>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>>>The only event dedicated to issues related to Linux enterprise solutions
>>>www.enterpriselinuxforum.com
>>>
>>>_______________________________________________
>>>Gusdev-gusdev mailing list
>>>Gus...@li...
>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>
>>>
>>>      
>>>
>>
>>-------------------------------------------------------
>>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>>The only event dedicated to issues related to Linux enterprise solutions
>>www.enterpriselinuxforum.com
>>
>>_______________________________________________
>>Gusdev-gusdev mailing list
>>Gus...@li...
>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>
>>    
>>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] mailing list protocol?

[Arnaud K. <ax...@sa...>]

Hi Steve

Sounds find to me but re. 1. I would keep the main recipient to specify who it 
is adressed to and cc gusdev mailing list.

Arnaud

Selon Steve Fischer <sfi...@pc...>:

> hey gusdevers-
> 
> i wanted to throw out there a proposal for how we can all use this 
> mailing list, possibly to best effect.  comments and tomatoes encouraged.
> 
> my idea is:
>   1. when responding to mail on the mail list, address your response 
> *only* to the news group.  thus, if you hit "reply all", remove all the 
> recipients who are not gusdev-gusdev.  This gets rid of the redundant 
> mail traffic.
> 
>   2. unless your response is really of no interest to the group, avoid 
> providing private answers.  this way, everybody will know that the 
> question has been answered and won't spend their time providing another 
> one, and, the answer will be available on the archive for future inquiries.
> 
>  3. don't be too shy about re-subjecting a thread if it has veered off 
> the original topic
> 
> steve
> 
> 

Re: [Gusdev-gusdev] GBParser Failure

[MICHAEL L. <lu...@cs...>]

Looks like 1.15:



$self->initialize({requiredDbVersion => {},
		     cvsRevision => '$Revision: 1.15 $',	# cvs
fills this in!
		     cvsTag => '$Name:  $', # cvs fills this in!
		     name => ref($self),
		     revisionNotes => 'make consistent with GUS 3.0',
		     easyCspOptions => $easycsp,
		     usage => $usage
		    });

Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Tue, 13 May 2003, Steve Fischer wrote:

> michael-
>
> take a look at the top of your copy of GBParser.pm.  what version of cvs
> is it showing?
>
>   $self->initialize({requiredDbVersion => {},
>              cvsRevision => '$Revision: 1.14 $',    # cvs fills this in!
>    <------ look here
>              cvsTag => '$Name:  $', # cvs fills this in!
>              name => ref($self),
>              revisionNotes => 'make consistent with GUS 3.0',
>              easyCspOptions => $easycsp,
>              usage => $usage
>             });
>
> steve
>
> MICHAEL LUCHTAN wrote:
>
> >Hello-
> >We are still trying to get the gbparser pluging to work correctly.
> >Entries have been added in the Sres.ExternalDatabase and
> >Sres.ExternalDatabaseReference tables.  We are still getting some strange
> >errors at the terminal.  Here is the first few lines (I tried to send all
> >of the input but there was a problem with the sourceforge mailer as far as
> >the size of the file):
> >[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
> >--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
> >CBIgenomic.gb --commit
> >Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
> >Reading properties from /home/luchtan/gus.properties
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
> >in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
> >lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
> >
> >The first part of the error file generated looks like this(Again the file
> >was too big to send as an attachment):
> > ------------------ entry number 1 -----------------
> >
> > SQL ERROR!! involving
> >
> >    INSERT INTO DoTS.ExternalNASequence (  c_count, description,
> >sequence_type_id, row_user_id, user_write, group_write,
> >secondary_identifier,
> > na_sequence_id, row_project_id, name, taxon_id,
> >external_database_release_id, subclass_view, group_read, sequence,
> >sequence_version, row_grou
> >p_id, other_read, a_count, length, source_id, modification_date, t_count,
> >user_read, row_alg_invocation_id, g_count, other_write )
> >    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
> >?, ?, SYSDATE, ?, ?, ?, ?, ? )
> > Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
> >PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
> >947, 184573, 1, ExternalNASequence, 1,
> >atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
> >cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
> >ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
> >ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
> >gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
> >ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
> >ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
> >tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
> >cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
> >acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
> >1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
> >ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
> >
> >GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
> >'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.Exter
> >nalNASequenc...') called at
> >/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
> >
> >GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
> >'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
> >Y(0x90013e8)', '^J    INSERT INTO DoTS.ExternalNASequence (  c_count,
> >description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
> > line 674
> >
> >GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
> >'HASH(0x8fd9fa4)') called at /home/gus_
> >home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
> >
> >GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
> >called at /home/gus_home/lib/perl/GUS/Model/GusRo
> >w.pm line 1677
> >
> >GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
> >called at /home/gus_home/lib/perl/GUS/Common/Plugin
> >/GBParser.pm line 284
> >
> >GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
> >'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
> >ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
> >line 185
> >        eval {...} called at
> >/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
> >
> >GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
> >'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
> >rl/GUS/PluginMgr/GusApplication.pm line 389
> >        eval {...} called at
> >/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
> >
> >GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'GUS::Common::Plugin::GBParser') cal
> >led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
> >
> >GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'GUS::Common::Plugin::GBParser') called
> >at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
> >
> >GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
> >'ARRAY(0x8105130)') called at /home/gus_
> >home/bin/ga line 11
> >
> >
> >
> >
> >
> >
> >If anyone can look at this and
> >see a quick oversight on our part, your advice would be much appreciated.
> >In the meantime we will be working on it.   Thanks,
> >
> >Michael Luchtan
> >http://www.cs.uga.edu/~luchtan
> >
> >
> >
> >
> >
> >-------------------------------------------------------
> >Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> >The only event dedicated to issues related to Linux enterprise solutions
> >www.enterpriselinuxforum.com
> >
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> >
>
>
>
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
>
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>

Re: [Gusdev-gusdev] GBParser Failure

[Steve F. <sfi...@pc...>]

michael-

take a look at the top of your copy of GBParser.pm.  what version of cvs 
is it showing?

  $self->initialize({requiredDbVersion => {},
             cvsRevision => '$Revision: 1.14 $',    # cvs fills this in! 
   <------ look here
             cvsTag => '$Name:  $', # cvs fills this in!
             name => ref($self),
             revisionNotes => 'make consistent with GUS 3.0',
             easyCspOptions => $easycsp,
             usage => $usage
            });

steve

MICHAEL LUCHTAN wrote:

>Hello-
>We are still trying to get the gbparser pluging to work correctly.
>Entries have been added in the Sres.ExternalDatabase and
>Sres.ExternalDatabaseReference tables.  We are still getting some strange
>errors at the terminal.  Here is the first few lines (I tried to send all
>of the input but there was a problem with the sourceforge mailer as far as
>the size of the file):
>[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
>--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
>CBIgenomic.gb --commit
>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>Reading properties from /home/luchtan/gus.properties
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>
>The first part of the error file generated looks like this(Again the file
>was too big to send as an attachment):
> ------------------ entry number 1 -----------------
>
> SQL ERROR!! involving
>
>    INSERT INTO DoTS.ExternalNASequence (  c_count, description,
>sequence_type_id, row_user_id, user_write, group_write,
>secondary_identifier,
> na_sequence_id, row_project_id, name, taxon_id,
>external_database_release_id, subclass_view, group_read, sequence,
>sequence_version, row_grou
>p_id, other_read, a_count, length, source_id, modification_date, t_count,
>user_read, row_alg_invocation_id, g_count, other_write )
>    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
>?, ?, SYSDATE, ?, ?, ?, ?, ? )
> Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
>PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
>947, 184573, 1, ExternalNASequence, 1,
>atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
>cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
>ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
>ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
>gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
>ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
>ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
>tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
>cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
>acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
>1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
>ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.Exter
>nalNASequenc...') called at
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
>Y(0x90013e8)', '^J    INSERT INTO DoTS.ExternalNASequence (  c_count,
>description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
> line 674
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
>'HASH(0x8fd9fa4)') called at /home/gus_
>home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>called at /home/gus_home/lib/perl/GUS/Model/GusRo
>w.pm line 1677
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>called at /home/gus_home/lib/perl/GUS/Common/Plugin
>/GBParser.pm line 284
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
>ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
>line 185
>        eval {...} called at
>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
>rl/GUS/PluginMgr/GusApplication.pm line 389
>        eval {...} called at
>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') cal
>led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') called
>at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'ARRAY(0x8105130)') called at /home/gus_
>home/bin/ga line 11
>
>
>
>
>
>
>If anyone can look at this and
>see a quick oversight on our part, your advice would be much appreciated.
>In the meantime we will be working on it.   Thanks,
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] GBParser Failure

[Steve F. <sfi...@pc...>]

Michael-

i'll have a look at this.

in case you didn't know, the stuff starting with "death" and below is a 
perl "stack trace."  it shows you the succession of subroutine calls 
(and their args) that lead to the problem.  sometimes that provides a 
major clue; sometimes not.

steve

MICHAEL LUCHTAN wrote:

>Hello-
>We are still trying to get the gbparser pluging to work correctly.
>Entries have been added in the Sres.ExternalDatabase and
>Sres.ExternalDatabaseReference tables.  We are still getting some strange
>errors at the terminal.  Here is the first few lines (I tried to send all
>of the input but there was a problem with the sourceforge mailer as far as
>the size of the file):
>[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
>--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
>CBIgenomic.gb --commit
>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>Reading properties from /home/luchtan/gus.properties
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
>lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>
>The first part of the error file generated looks like this(Again the file
>was too big to send as an attachment):
> ------------------ entry number 1 -----------------
>
> SQL ERROR!! involving
>
>    INSERT INTO DoTS.ExternalNASequence (  c_count, description,
>sequence_type_id, row_user_id, user_write, group_write,
>secondary_identifier,
> na_sequence_id, row_project_id, name, taxon_id,
>external_database_release_id, subclass_view, group_read, sequence,
>sequence_version, row_grou
>p_id, other_read, a_count, length, source_id, modification_date, t_count,
>user_read, row_alg_invocation_id, g_count, other_write )
>    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
>?, ?, SYSDATE, ?, ?, ?, ?, ? )
> Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
>PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
>947, 184573, 1, ExternalNASequence, 1,
>atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
>cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
>ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
>ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
>gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
>ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
>ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
>tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
>cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
>acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
>1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
>ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184
>
>GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.Exter
>nalNASequenc...') called at
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147
>
>GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
>'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
>Y(0x90013e8)', '^J    INSERT INTO DoTS.ExternalNASequence (  c_count,
>description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
> line 674
>
>GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
>'HASH(0x8fd9fa4)') called at /home/gus_
>home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621
>
>GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>called at /home/gus_home/lib/perl/GUS/Model/GusRo
>w.pm line 1677
>
>GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
>called at /home/gus_home/lib/perl/GUS/Common/Plugin
>/GBParser.pm line 284
>
>GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
>ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
>line 185
>        eval {...} called at
>/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184
>
>GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
>'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
>rl/GUS/PluginMgr/GusApplication.pm line 389
>        eval {...} called at
>/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385
>
>GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') cal
>led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284
>
>GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'GUS::Common::Plugin::GBParser') called
>at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193
>
>GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
>'ARRAY(0x8105130)') called at /home/gus_
>home/bin/ga line 11
>
>
>
>
>
>
>If anyone can look at this and
>see a quick oversight on our part, your advice would be much appreciated.
>In the meantime we will be working on it.   Thanks,
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

[Gusdev-gusdev] GBParser Failure

[MICHAEL L. <lu...@cs...>]

Hello-
We are still trying to get the gbparser pluging to work correctly.
Entries have been added in the Sres.ExternalDatabase and
Sres.ExternalDatabaseReference tables.  We are still getting some strange
errors at the terminal.  Here is the first few lines (I tried to send all
of the input but there was a problem with the sourceforge mailer as far as
the size of the file):
[luchtan@mango luchtan]$ ga GUS::Common::Plugin::GBParser --gbRel=135
--db_rel_id=135 --debug --file=/home/gusdev/gus3.0-checkouts/GenBank/TcN
CBIgenomic.gb --commit
Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
Reading properties from /home/luchtan/gus.properties
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation
in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at /home/gus_home/
lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.

The first part of the error file generated looks like this(Again the file
was too big to send as an attachment):
 ------------------ entry number 1 -----------------

 SQL ERROR!! involving

    INSERT INTO DoTS.ExternalNASequence (  c_count, description,
sequence_type_id, row_user_id, user_write, group_write,
secondary_identifier,
 na_sequence_id, row_project_id, name, taxon_id,
external_database_release_id, subclass_view, group_read, sequence,
sequence_version, row_grou
p_id, other_read, a_count, length, source_id, modification_date, t_count,
user_read, row_alg_invocation_id, g_count, other_write )
    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?,
?, ?, SYSDATE, ?, ?, ?, ?, ? )
 Values: 268, Trypanosoma cruzi proline racemase copy B (PA45-B) gene,
PA45-B-1 allele, complete cds., 11, 6, 1, 1, GI:30349128, 810, 2, AY140
947, 184573, 1, ExternalNASequence, 1,
atgcgatttaagaaatcattgacatgcatcgacatgcatacggaaggtgaagcagcacggattgtgacgagtggtttgccacacattccaggttcgaatatgg
cggagaagaaagcatacctgcaggaaaacatggattatttgaggcgtggcataatgctggagccacgtggtcatgatgatatgtttggagcctttttatttgaccctattgaagaaggcgctgacttgggcatcgtattcat
ggataccggtggctatttaaatatgtgtggacataactcaattgcagcggttacggcggcagtggaaacgggaattttgagcgtgccggcgaaggcaacaaatgttccggttgtcctggacacacctgcggggttggtgcgc
ggtacggcacaccttcagagtggtactgagagtgaggtgtcaaatgcgagtattatcaatgtgccctcatttttgtatcagcaggatgtggtgattgttttgccaaagccctatggtgaggtacgggttgatattgcatttg
gaggcaattttttcgccattgttcccgcggagcacttgggaattgatatctccgttcaaaacctctccaggctgcaggaggcaggagaacttctgcgtactgaaatcaatcgcagtgtgaaggttcagcaccctcagctgcc
ccatattaacactgtggactgtgttgagatatacggtaacgcaacgaacccggaggcaaaatacaagaacgttgtgatatttggcaatcgccaggcggatcgctctccatgtgggacaggcaccagcgccaagatggcaaca
ctttatgccaaaggccagcttcgcatcggagagacttttgtgtacgagagcatactcggctcactcttccagggcagggtacttggggaggagcgaataccgggggtgaaggtgccggtgaccaaagatgccgaggaaggga
tgctcgttgtaacgacagaaattactggaaaggcttttatcatgggtttcaacaccatgctgtttgacccaacggatccgttcttaaacggattcacactaaagcggtagatctggtagagcacagaaactattggggaaca
cgtgcgaacaggtgctgctacgtaaagggtattgaatgaatcgtttttttttttttttttttattagtgcattatttttttttttttttgttttggggtttcaacggtaccacgttgggagcagggaaacgatagcggccgg
acaattttttacttttattttcattttcaccttcctacccaacccccttggttccaccggtcgcggcgggg,
1, 2, 1, 324, 1310, AY140947, 355, 1, 122, 363, 0 at /home/gus_home/l
ib/perl/GUS/ObjRelP/DbiDbHandle.pm line 184

GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
'^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.Exter
nalNASequenc...') called at
/home/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 147

GUS::ObjRelP::DbiDbHandle::sqlExec('GUS::ObjRelP::DbiDbHandle=HASH(0x8afbb48)',
'GUS::ObjRelP::DbiDbHandle::st=HASH(0x9000b98)', 'ARRA
Y(0x90013e8)', '^J    INSERT INTO DoTS.ExternalNASequence (  c_count,
description...') called at /home/gus_home/lib/perl/GUS/ObjRelP/DbiRow.pm
 line 674

GUS::ObjRelP::DbiRow::quote_and_insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)',
'HASH(0x8fd9fa4)') called at /home/gus_
home/lib/perl/GUS/ObjRelP/DbiRow.pm line 621

GUS::ObjRelP::DbiRow::insert('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
called at /home/gus_home/lib/perl/GUS/Model/GusRo
w.pm line 1677

GUS::Model::GusRow::submit('GUS::Model::DoTS::ExternalNASequence=HASH(0x8d880a0)')
called at /home/gus_home/lib/perl/GUS/Common/Plugin
/GBParser.pm line 284

GUS::Common::Plugin::GBParser::processEntry('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
'CBIL::Bio::GenBank::ArrayStream=HASH(0x8
ccaa28)') called at /home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm
line 185
        eval {...} called at
/home/gus_home/lib/perl/GUS/Common/Plugin/GBParser.pm line 184

GUS::Common::Plugin::GBParser::run('GUS::Common::Plugin::GBParser=HASH(0x84be7b8)',
'HASH(0x8c60c10)') called at /home/gus_home/lib/pe
rl/GUS/PluginMgr/GusApplication.pm line 389
        eval {...} called at
/home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 385

GUS::PluginMgr::GusApplication::doMajorMode_Run('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'GUS::Common::Plugin::GBParser') cal
led at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 284

GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'GUS::Common::Plugin::GBParser') called
at /home/gus_home/lib/perl/GUS/PluginMgr/GusApplication.pm line 193

GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x80fbb0c)',
'ARRAY(0x8105130)') called at /home/gus_
home/bin/ga line 11






If anyone can look at this and
see a quick oversight on our part, your advice would be much appreciated.
In the meantime we will be working on it.   Thanks,

Michael Luchtan
http://www.cs.uga.edu/~luchtan

Re: [Gusdev-gusdev] GenBank, Gene Ontology questions

[Dave B. <db...@pc...>]

Just in case it's not clear, the name of the plugin to load all of this is 
LoadGoOntology; it is located in the GUS/GOPredict component. 

dave

On Tue, 13 May 2003, Dave Barkan wrote:

> Hi Chetna and folks--
> 
> > >2) GeneOntology
> > >
> > >We have successfully  installed Taxonomy in the gus 3.0 database at this 
> > >end. I need to know what version and files do I need to put all the 3 
> > >ontologies in the database.  Also what are the dependencies in loading 
> > >Gene Ontology in terms of data.
> 
> The three ontology files are located at
> 
> ftp://ftp.geneontology.org/pub/go/ontology/
> 
> They are named process.ontology, component.ontology, and 
> function.ontology.
> 
> Whatever is at that ftp site should be the latest version.  Use 
> --createRelease 
> option when running the plugin to automatically generate an External 
> Database Release Id (in SRes.ExternalDatabaseRelease) for these releases 
> of the ontology branches.  Note that there must be entries in 
> SRes.ExternalDatabase with names "GO Function", "GO Component", and 
> "GO Process."  (This could definitely be done better, avoiding hardcoding 
> names like this which are set in our version of GUS.  Let me know if you 
> have trouble with this and I will change it).
> 
> Specify the directory of the files with the --file_path option.  To load a 
> specific branch, specify the corresponding file with the --flat_file 
> option; to load all three just leave this blank.
> 
> You need to have two entries in SRes.GORelationshipType populated; they 
> correspond to the two different types of relationships a GO Term can have 
> with its child in the GO hierarchy, "isa" and "partof."  (These should be 
> set in the 'name' attribute of the GoRelationshipType table and have 
> corresponding ids).  More information on this representation is available 
> at
> 
> http://www.geneontology.org/doc/GO.doc.html#datarep
> 
> The other command lines should be self-explanatory but again let me know 
> if you have any trouble.
> 
> Dave  
> 
> 
> 
> 
> 
> 
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
> 
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> 

Re: [Gusdev-gusdev] GenBank, Gene Ontology questions

[Dave B. <db...@pc...>]

Hi Chetna and folks--

> >2) GeneOntology
> >
> >We have successfully  installed Taxonomy in the gus 3.0 database at this 
> >end. I need to know what version and files do I need to put all the 3 
> >ontologies in the database.  Also what are the dependencies in loading 
> >Gene Ontology in terms of data.

The three ontology files are located at

ftp://ftp.geneontology.org/pub/go/ontology/

They are named process.ontology, component.ontology, and 
function.ontology.

Whatever is at that ftp site should be the latest version.  Use 
--createRelease 
option when running the plugin to automatically generate an External 
Database Release Id (in SRes.ExternalDatabaseRelease) for these releases 
of the ontology branches.  Note that there must be entries in 
SRes.ExternalDatabase with names "GO Function", "GO Component", and 
"GO Process."  (This could definitely be done better, avoiding hardcoding 
names like this which are set in our version of GUS.  Let me know if you 
have trouble with this and I will change it).

Specify the directory of the files with the --file_path option.  To load a 
specific branch, specify the corresponding file with the --flat_file 
option; to load all three just leave this blank.

You need to have two entries in SRes.GORelationshipType populated; they 
correspond to the two different types of relationships a GO Term can have 
with its child in the GO hierarchy, "isa" and "partof."  (These should be 
set in the 'name' attribute of the GoRelationshipType table and have 
corresponding ids).  More information on this representation is available 
at

http://www.geneontology.org/doc/GO.doc.html#datarep

The other command lines should be self-explanatory but again let me know 
if you have any trouble.

Dave  

[Gusdev-gusdev] mailing list protocol?

[Steve F. <sfi...@pc...>]

hey gusdevers-

i wanted to throw out there a proposal for how we can all use this 
mailing list, possibly to best effect.  comments and tomatoes encouraged.

my idea is:
  1. when responding to mail on the mail list, address your response 
*only* to the news group.  thus, if you hit "reply all", remove all the 
recipients who are not gusdev-gusdev.  This gets rid of the redundant 
mail traffic.

  2. unless your response is really of no interest to the group, avoid 
providing private answers.  this way, everybody will know that the 
question has been answered and won't spend their time providing another 
one, and, the answer will be available on the archive for future inquiries.

 3. don't be too shy about re-subjecting a thread if it has veered off 
the original topic

steve

Re: [Gusdev-gusdev] GenBank, Gene Ontology questions

[MICHAEL L. <lu...@cs...>]

Hello--
My name is Michael, and I will be working here in the Kissinger lab over
the summer on the GUS project.  In regards to the following command:

ga GUS::Common::Plugin::GBParser --gbRel 132 --file
 /ptolemy/share/data/thirdparty/genbank/133/gbrod4.seq.gz --debug --log
 gbrod5.seq.log --db_rel_id 6547 > & gbrod5.err &

What does the number  6547 refer to?  I downloaded an gbrod4 file from
genbank and looked for this number, but could not find it.  From the
following post:
> Your command is missing the --db_rel_id option which is the
> external_database_release_id of GenBank release 133 from the
> ExternalDatabaseRelease table. I just made this a required option so you
> can update from CVS to get that change.
I would assume it to be the same as gbRel.  Any help would be much
appreciated...

Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Mon, 12 May 2003, Deborah F. Pinney wrote:

> Hi Chetna,
>
> Is your GBParser.pm updated from CVS? There were several changes made to
> the plugin for GUS3.0. I used the plugin in it's current form and it
> performed well.
>
> Here is a sample command line I used when testing the plugin:
>
> ga GUS::Common::Plugin::GBParser --gbRel 132 --file
> /ptolemy/share/data/thirdparty/genbank/133/gbrod4.seq.gz --debug --log
> gbrod5.seq.log --db_rel_id 6547 > & gbrod5.err &
>
>
> Your command is missing the --db_rel_id option which is the
> external_database_release_id of GenBank release 133 from the
> ExternalDatabaseRelease table. I just made this a required option so you
> can update from CVS to get that change.
>
> Can you e-mail the actual errors you get? It should not be necessary for
> the dbref table to be filled to run GBParser.
>
>                                                   Debbie
>
>
>
>
>
>
>
> On Mon, 12 May 2003, Chetna D. Warade wrote:
>
> > Hi all,
> >
> > It would be great if I can get insight into following:
> >
> > 1) GenBank
> >
> > I am trying to load data from GenBank with the  command
> >
> > ga GUS::Common::Plugin::GBParser --gbRel=133
> > --file=/home/gusdev/GenBank/TcNCBIgenomic.gb
> >
> > I am getting SQL Error: foreign  key violation for tables SRes.DbRef and
> > DoTS.ExternalNASequence.
> >
> > I wanted to know more about how to solve the dependencies in these
> > tables.
> >
> > In order to solve this dependency I might need the
> > InsertDbRefAndDbRefNASequence.pm and thats not functional as of yet. I
> > was wondering if its up and running.
> >
> > 2) GeneOntology
> >
> > We have successfully  installed Taxonomy in the gus 3.0 database at this
> > end. I need to know what version and files do I need to put all the 3
> > ontologies in the database.  Also what are the dependencies in loading
> > Gene Ontology in terms of data.
> >
> > 3) Following is the list of tables we have filled in to work with gus:
> > Core.Algorithm
> > Core.AlgorithmInvocation
> > Core.Userinfo
> > Core.Projectinfo
> > Core.Groupinfo
> > Core.Machine
> > SRes.Taxon
> > SRes.Taxonname
> > SRes.GeneticCode
> >
> > I would be very happy to call you guys over phone (if possible) at a
> > good time if you think that the answers are really long and complex to
> > talk over email.
> >
> > Hope to hear from you all,
> > Thanks,
> > Chetna
> >
> >
> >
> >
> > -------------------------------------------------------
> > Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> > The only event dedicated to issues related to Linux enterprise solutions
> > www.enterpriselinuxforum.com
> >
> > _______________________________________________
> > Gusdev-gusdev mailing list
> > Gus...@li...
> > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
>
>
>
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
>
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>

Re: [Gusdev-gusdev] GenBank, Gene Ontology questions

[Deborah F. P. <pi...@pc...>]

Sorry, there's no log option.


On Mon, 12 May 2003, Deborah F. Pinney wrote:

> Hi Chetna,
> 
> Is your GBParser.pm updated from CVS? There were several changes made to 
> the plugin for GUS3.0. I used the plugin in it's current form and it 
> performed well. 
> 
> Here is a sample command line I used when testing the plugin:
> 
> ga GUS::Common::Plugin::GBParser --gbRel 132 --file 
> /ptolemy/share/data/thirdparty/genbank/133/gbrod4.seq.gz --debug --log 
> gbrod5.seq.log --db_rel_id 6547 > & gbrod5.err &
> 
> 
> Your command is missing the --db_rel_id option which is the 
> external_database_release_id of GenBank release 133 from the 
> ExternalDatabaseRelease table. I just made this a required option so you 
> can update from CVS to get that change. 
> 
> Can you e-mail the actual errors you get? It should not be necessary for 
> the dbref table to be filled to run GBParser.
> 
>                                                   Debbie 
> 
> 
> 
> 
> 
> 
> 
> On Mon, 12 May 2003, Chetna D. Warade wrote:
> 
> > Hi all,
> > 
> > It would be great if I can get insight into following:
> > 
> > 1) GenBank
> > 
> > I am trying to load data from GenBank with the  command
> > 
> > ga GUS::Common::Plugin::GBParser --gbRel=133 
> > --file=/home/gusdev/GenBank/TcNCBIgenomic.gb
> > 
> > I am getting SQL Error: foreign  key violation for tables SRes.DbRef and 
> > DoTS.ExternalNASequence.
> > 
> > I wanted to know more about how to solve the dependencies in these 
> > tables.
> > 
> > In order to solve this dependency I might need the 
> > InsertDbRefAndDbRefNASequence.pm and thats not functional as of yet. I 
> > was wondering if its up and running.
> > 
> > 2) GeneOntology
> > 
> > We have successfully  installed Taxonomy in the gus 3.0 database at this 
> > end. I need to know what version and files do I need to put all the 3 
> > ontologies in the database.  Also what are the dependencies in loading 
> > Gene Ontology in terms of data.
> > 
> > 3) Following is the list of tables we have filled in to work with gus:
> > Core.Algorithm
> > Core.AlgorithmInvocation
> > Core.Userinfo
> > Core.Projectinfo
> > Core.Groupinfo
> > Core.Machine
> > SRes.Taxon
> > SRes.Taxonname
> > SRes.GeneticCode
> > 
> > I would be very happy to call you guys over phone (if possible) at a 
> > good time if you think that the answers are really long and complex to 
> > talk over email.
> > 
> > Hope to hear from you all,
> > Thanks,
> > Chetna
> > 
> > 
> > 
> > 
> > -------------------------------------------------------
> > Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> > The only event dedicated to issues related to Linux enterprise solutions
> > www.enterpriselinuxforum.com
> > 
> > _______________________________________________
> > Gusdev-gusdev mailing list
> > Gus...@li...
> > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > 
> 
> 
> 
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
> 
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> 

Re: [Gusdev-gusdev] GenBank, Gene Ontology questions

[Steve F. <st...@pc...>]

chetna-

I think Dave Barkan can probably answer your question about loading GO 
ontologies.

Dave... can you answer Chetna's question 2) below?

steve

Chetna D. Warade wrote:

>Hi all,
>
>It would be great if I can get insight into following:
>
>1) GenBank
>
>I am trying to load data from GenBank with the  command
>
>ga GUS::Common::Plugin::GBParser --gbRel=133 
>--file=/home/gusdev/GenBank/TcNCBIgenomic.gb
>
>I am getting SQL Error: foreign  key violation for tables SRes.DbRef and 
>DoTS.ExternalNASequence.
>
>I wanted to know more about how to solve the dependencies in these 
>tables.
>
>In order to solve this dependency I might need the 
>InsertDbRefAndDbRefNASequence.pm and thats not functional as of yet. I 
>was wondering if its up and running.
>
>2) GeneOntology
>
>We have successfully  installed Taxonomy in the gus 3.0 database at this 
>end. I need to know what version and files do I need to put all the 3 
>ontologies in the database.  Also what are the dependencies in loading 
>Gene Ontology in terms of data.
>
>3) Following is the list of tables we have filled in to work with gus:
>Core.Algorithm
>Core.AlgorithmInvocation
>Core.Userinfo
>Core.Projectinfo
>Core.Groupinfo
>Core.Machine
>SRes.Taxon
>SRes.Taxonname
>SRes.GeneticCode
>
>I would be very happy to call you guys over phone (if possible) at a 
>good time if you think that the answers are really long and complex to 
>talk over email.
>
>Hope to hear from you all,
>Thanks,
>Chetna
>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] GenBank, Gene Ontology questions

[Steve F. <st...@pc...>]

chetna-

it looks like the ga +meta --commit actuall worked, despite the nasty 
looking warnings.

steve

Chetna D. Warade wrote:

>Hi,
>
>I tried following after getting the latest tarball from cvs sanger:
>
>1)
>[chetna@mango Plugin]$ ga +update GUS::Common::Plugin::GBParser 
>--commit
>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>Reading properties from /home/chetna/.gus.properties
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation 
>
>in Autolib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>
>USER ERROR: GUS::PluginMgr::GusApplication revision 1.37 has not been 
>registered
>Please use 'ga +meta --commit'
>
>
>2)
>[chetna@mango Plugin]$ ga +meta commit
>Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
>Reading properties from /home/chetna/.gus.properties
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation 
>
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at 
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation 
>
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at 
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation 
>
>in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at 
>/home/gus_home/lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
>  <Core::Algorithm>
>    <algorithm_id>54</algorithm_id>
>    <name>GA-Plugin</name>
>    <description>GUS application framework for plugins</description>
>    <modification_date>24-MAR-03</modification_date>
>    <Core::AlgorithmImplementation>
>      <cvs_revision>1.37</cvs_revision>
>      <cvs_tag> </cvs_tag>
>      <executable>GUS::PluginMgr::GusApplication</executable>
>      <executable_md5>4bdb2e1291247ddfd653d63876c3eb7c</executable_md5>
>      <description>update for GUS 3.0</description>
>      <Core::AlgorithmInvocation>
>        <start_time>sysdate</start_time>
>        <end_time>sysdate</end_time>
>        <machine_id>0</machine_id>
>        <cpus_used>1</cpus_used>
>        <result>meta</result>
>      </Core::AlgorithmInvocation>
>    </Core::AlgorithmImplementation>
>    <user_read>1</user_read>
>    <user_write>1</user_write>
>    <group_read>1</group_read>
>    <group_write>1</group_write>
>    <other_read>1</other_read>
>    <other_write>0</other_write>
>    <row_user_id>2</row_user_id>
>    <row_group_id>2</row_group_id>
>    <row_project_id>2</row_project_id>
>    <row_alg_invocation_id>1</row_alg_invocation_id>
>  </Core::Algorithm>
>  <Core::Algorithm>
>    <algorithm_id>54</algorithm_id>
>    <name>GA-Plugin</name>
>    <description>GUS application framework for plugins</description>
>    <modification_date>24-MAR-03</modification_date>
>    <Core::AlgorithmImplementation>
>      <algorithm_implementation_id>78</algorithm_implementation_id>
>      <algorithm_id>54</algorithm_id>
>      <cvs_revision>1.37</cvs_revision>
>      <cvs_tag> </cvs_tag>
>      <executable>GUS::PluginMgr::GusApplication</executable>
>      <executable_md5>4bdb2e1291247ddfd653d63876c3eb7c</executable_md5>
>      <description>update for GUS 3.0</description>
>      <modification_date>SYSDATE</modification_date>
>      <Core::AlgorithmInvocation>
>        <algorithm_invocation_id>119</algorithm_invocation_id>
>        <algorithm_implementation_id>78</algorithm_implementation_id>
>        <start_time>sysdate</start_time>
>        <end_time>sysdate</end_time>
>        <machine_id>0</machine_id>
>        <cpus_used>1</cpus_used>
>        <result>meta</result>
>        <modification_date>SYSDATE</modification_date>
>        <user_read>1</user_read>
>        <user_write>1</user_write>
>        <group_read>1</group_read>
>        <group_write>1</group_write>
>        <other_read>1</other_read>
>        <other_write>0</other_write>
>        <row_user_id>2</row_user_id>
>        <row_group_id>2</row_group_id>
>        <row_project_id>2</row_project_id>
>        <row_alg_invocation_id>1</row_alg_invocation_id>
>     </Core::AlgorithmInvocation>
>     <user_read>1</user_read>
>      <user_write>1</user_write>
>      <group_read>1</group_read>
>      <group_write>1</group_write>
>      <other_read>1</other_read>
>      <other_write>0</other_write>
>      <row_user_id>2</row_user_id>
>      <row_group_id>2</row_group_id>
>      <row_project_id>2</row_project_id>
>      <row_alg_invocation_id>1</row_alg_invocation_id>
>    </Core::AlgorithmImplementation>
>    <user_read>1</user_read>
>    <user_write>1</user_write>
>    <group_read>1</group_read>
>    <group_write>1</group_write>
>    <other_read>1</other_read>
>    <other_write>0</other_write>
>    <row_user_id>2</row_user_id>
>    <row_group_id>2</row_group_id>
>    <row_project_id>2</row_project_id>
>    <row_alg_invocation_id>1</row_alg_invocation_id>
>  </Core::Algorithm>
>[chetna@mango Plugin]$
>
>It would be great if somebody could help,
>Thanks
>Chetna
>
>
>
>
>  
>
>>---------Included Message----------
>>    
>>
>>>Date: Mon, 12 May 2003 13:39:17 -0400 (EDT)
>>>From: "Deborah F. Pinney" <pi...@pc...>
>>>To: "Chetna D. Warade" <ch...@ug...>
>>>Cc: <gus...@li...>
>>>Subject: Re: [Gusdev-gusdev] GenBank, Gene Ontology questions
>>>
>>>Hi Chetna,
>>>
>>>Is your GBParser.pm updated from CVS? There were several changes made 
>>>      
>>>
>
>  
>
>>to 
>>    
>>
>>>the plugin for GUS3.0. I used the plugin in it's current form and it 
>>>performed well. 
>>>
>>>Here is a sample command line I used when testing the plugin:
>>>
>>>ga GUS::Common::Plugin::GBParser --gbRel 132 --file 
>>>/ptolemy/share/data/thirdparty/genbank/133/gbrod4.seq.gz --debug --log 
>>>      
>>>
>
>  
>
>>>gbrod5.seq.log --db_rel_id 6547 > & gbrod5.err &
>>>
>>>
>>>Your command is missing the --db_rel_id option which is the 
>>>external_database_release_id of GenBank release 133 from the 
>>>ExternalDatabaseRelease table. I just made this a required option so 
>>>      
>>>
>>you 
>>    
>>
>>>can update from CVS to get that change. 
>>>
>>>Can you e-mail the actual errors you get? It should not be necessary 
>>>      
>>>
>>for 
>>    
>>
>>>the dbref table to be filled to run GBParser.
>>>
>>>                                                 Debbie 
>>>
>>>
>>>
>>>
>>>
>>>
>>>
>>>On Mon, 12 May 2003, Chetna D. Warade wrote:
>>>
>>>      
>>>
>>>>Hi all,
>>>>
>>>>It would be great if I can get insight into following:
>>>>
>>>>1) GenBank
>>>>
>>>>I am trying to load data from GenBank with the  command
>>>>
>>>>ga GUS::Common::Plugin::GBParser --gbRel=133 
>>>>--file=/home/gusdev/GenBank/TcNCBIgenomic.gb
>>>>
>>>>I am getting SQL Error: foreign  key violation for tables SRes.DbRef 
>>>>        
>>>>
>
>  
>
>>and 
>>    
>>
>>>>DoTS.ExternalNASequence.
>>>>
>>>>I wanted to know more about how to solve the dependencies in these 
>>>>tables.
>>>>
>>>>In order to solve this dependency I might need the 
>>>>InsertDbRefAndDbRefNASequence.pm and thats not functional as of yet. 
>>>>        
>>>>
>
>  
>
>>I 
>>    
>>
>>>>was wondering if its up and running.
>>>>
>>>>2) GeneOntology
>>>>
>>>>We have successfully  installed Taxonomy in the gus 3.0 database at 
>>>>        
>>>>
>
>  
>
>>this 
>>    
>>
>>>>end. I need to know what version and files do I need to put all the 
>>>>        
>>>>
>3 
>  
>
>>>>ontologies in the database.  Also what are the dependencies in 
>>>>        
>>>>
>>loading 
>>    
>>
>>>>Gene Ontology in terms of data.
>>>>
>>>>3) Following is the list of tables we have filled in to work with 
>>>>        
>>>>
>>gus:
>>    
>>
>>>>Core.Algorithm
>>>>Core.AlgorithmInvocation
>>>>Core.Userinfo
>>>>Core.Projectinfo
>>>>Core.Groupinfo
>>>>Core.Machine
>>>>SRes.Taxon
>>>>SRes.Taxonname
>>>>SRes.GeneticCode
>>>>
>>>>I would be very happy to call you guys over phone (if possible) at a 
>>>>        
>>>>
>
>  
>
>>>>good time if you think that the answers are really long and complex 
>>>>        
>>>>
>
>  
>
>>to 
>>    
>>
>>>>talk over email.
>>>>
>>>>Hope to hear from you all,
>>>>Thanks,
>>>>Chetna
>>>>
>>>>
>>>>
>>>>
>>>>-------------------------------------------------------
>>>>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa 
>>>>        
>>>>
>>Clara
>>    
>>
>>>>The only event dedicated to issues related to Linux enterprise 
>>>>        
>>>>
>>solutions
>>    
>>
>>>>www.enterpriselinuxforum.com
>>>>
>>>>_______________________________________________
>>>>Gusdev-gusdev mailing list
>>>>Gus...@li...
>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>>
>>>>        
>>>>
>>>      
>>>
>>---------End of Included Message----------
>>
>>
>>
>>    
>>
>---------End of Included Message----------
>
>
>
>
>-------------------------------------------------------
>Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
>The only event dedicated to issues related to Linux enterprise solutions
>www.enterpriselinuxforum.com
>
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] GenBank, Gene Ontology questions

[Chetna D. W. <ch...@ug...>]

Hi,

I tried following after getting the latest tarball from cvs sanger:

1)
[chetna@mango Plugin]$ ga +update GUS::Common::Plugin::GBParser 
--commit
Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
Reading properties from /home/chetna/.gus.properties
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation 

in Autolib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.

USER ERROR: GUS::PluginMgr::GusApplication revision 1.37 has not been 
registered
Please use 'ga +meta --commit'


2)
[chetna@mango Plugin]$ ga +meta commit
Reading properties from /home/gus_home/config/GUS-PluginMgr.prop
Reading properties from /home/chetna/.gus.properties
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation 

in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at 
/home/gus_home/lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation 

in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at 
/home/gus_home/lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
DBD::Oracle::db do failed: ORA-30019: Illegal rollback Segment operation 

in Automatic Undo mode (DBD ERROR: OCIStmtExecute) at 
/home/gus_home/lib/perl/GUS/ObjRelP/DbiDatabase.pm line 149.
  <Core::Algorithm>
    <algorithm_id>54</algorithm_id>
    <name>GA-Plugin</name>
    <description>GUS application framework for plugins</description>
    <modification_date>24-MAR-03</modification_date>
    <Core::AlgorithmImplementation>
      <cvs_revision>1.37</cvs_revision>
      <cvs_tag> </cvs_tag>
      <executable>GUS::PluginMgr::GusApplication</executable>
      <executable_md5>4bdb2e1291247ddfd653d63876c3eb7c</executable_md5>
      <description>update for GUS 3.0</description>
      <Core::AlgorithmInvocation>
        <start_time>sysdate</start_time>
        <end_time>sysdate</end_time>
        <machine_id>0</machine_id>
        <cpus_used>1</cpus_used>
        <result>meta</result>
      </Core::AlgorithmInvocation>
    </Core::AlgorithmImplementation>
    <user_read>1</user_read>
    <user_write>1</user_write>
    <group_read>1</group_read>
    <group_write>1</group_write>
    <other_read>1</other_read>
    <other_write>0</other_write>
    <row_user_id>2</row_user_id>
    <row_group_id>2</row_group_id>
    <row_project_id>2</row_project_id>
    <row_alg_invocation_id>1</row_alg_invocation_id>
  </Core::Algorithm>
  <Core::Algorithm>
    <algorithm_id>54</algorithm_id>
    <name>GA-Plugin</name>
    <description>GUS application framework for plugins</description>
    <modification_date>24-MAR-03</modification_date>
    <Core::AlgorithmImplementation>
      <algorithm_implementation_id>78</algorithm_implementation_id>
      <algorithm_id>54</algorithm_id>
      <cvs_revision>1.37</cvs_revision>
      <cvs_tag> </cvs_tag>
      <executable>GUS::PluginMgr::GusApplication</executable>
      <executable_md5>4bdb2e1291247ddfd653d63876c3eb7c</executable_md5>
      <description>update for GUS 3.0</description>
      <modification_date>SYSDATE</modification_date>
      <Core::AlgorithmInvocation>
        <algorithm_invocation_id>119</algorithm_invocation_id>
        <algorithm_implementation_id>78</algorithm_implementation_id>
        <start_time>sysdate</start_time>
        <end_time>sysdate</end_time>
        <machine_id>0</machine_id>
        <cpus_used>1</cpus_used>
        <result>meta</result>
        <modification_date>SYSDATE</modification_date>
        <user_read>1</user_read>
        <user_write>1</user_write>
        <group_read>1</group_read>
        <group_write>1</group_write>
        <other_read>1</other_read>
        <other_write>0</other_write>
        <row_user_id>2</row_user_id>
        <row_group_id>2</row_group_id>
        <row_project_id>2</row_project_id>
        <row_alg_invocation_id>1</row_alg_invocation_id>
     </Core::AlgorithmInvocation>
     <user_read>1</user_read>
      <user_write>1</user_write>
      <group_read>1</group_read>
      <group_write>1</group_write>
      <other_read>1</other_read>
      <other_write>0</other_write>
      <row_user_id>2</row_user_id>
      <row_group_id>2</row_group_id>
      <row_project_id>2</row_project_id>
      <row_alg_invocation_id>1</row_alg_invocation_id>
    </Core::AlgorithmImplementation>
    <user_read>1</user_read>
    <user_write>1</user_write>
    <group_read>1</group_read>
    <group_write>1</group_write>
    <other_read>1</other_read>
    <other_write>0</other_write>
    <row_user_id>2</row_user_id>
    <row_group_id>2</row_group_id>
    <row_project_id>2</row_project_id>
    <row_alg_invocation_id>1</row_alg_invocation_id>
  </Core::Algorithm>
[chetna@mango Plugin]$

It would be great if somebody could help,
Thanks
Chetna




>---------Included Message----------
>>Date: Mon, 12 May 2003 13:39:17 -0400 (EDT)
>>From: "Deborah F. Pinney" <pi...@pc...>
>>To: "Chetna D. Warade" <ch...@ug...>
>>Cc: <gus...@li...>
>>Subject: Re: [Gusdev-gusdev] GenBank, Gene Ontology questions
>>
>>Hi Chetna,
>>
>>Is your GBParser.pm updated from CVS? There were several changes made 

>to 
>>the plugin for GUS3.0. I used the plugin in it's current form and it 
>>performed well. 
>>
>>Here is a sample command line I used when testing the plugin:
>>
>>ga GUS::Common::Plugin::GBParser --gbRel 132 --file 
>>/ptolemy/share/data/thirdparty/genbank/133/gbrod4.seq.gz --debug --log 

>
>>gbrod5.seq.log --db_rel_id 6547 > & gbrod5.err &
>>
>>
>>Your command is missing the --db_rel_id option which is the 
>>external_database_release_id of GenBank release 133 from the 
>>ExternalDatabaseRelease table. I just made this a required option so 
>you 
>>can update from CVS to get that change. 
>>
>>Can you e-mail the actual errors you get? It should not be necessary 
>for 
>>the dbref table to be filled to run GBParser.
>>
>>                                                  Debbie 
>>
>>
>>
>>
>>
>>
>>
>>On Mon, 12 May 2003, Chetna D. Warade wrote:
>>
>>> Hi all,
>>> 
>>> It would be great if I can get insight into following:
>>> 
>>> 1) GenBank
>>> 
>>> I am trying to load data from GenBank with the  command
>>> 
>>> ga GUS::Common::Plugin::GBParser --gbRel=133 
>>> --file=/home/gusdev/GenBank/TcNCBIgenomic.gb
>>> 
>>> I am getting SQL Error: foreign  key violation for tables SRes.DbRef 

>and 
>>> DoTS.ExternalNASequence.
>>> 
>>> I wanted to know more about how to solve the dependencies in these 
>>> tables.
>>> 
>>> In order to solve this dependency I might need the 
>>> InsertDbRefAndDbRefNASequence.pm and thats not functional as of yet. 

>I 
>>> was wondering if its up and running.
>>> 
>>> 2) GeneOntology
>>> 
>>> We have successfully  installed Taxonomy in the gus 3.0 database at 

>this 
>>> end. I need to know what version and files do I need to put all the 
3 
>
>>> ontologies in the database.  Also what are the dependencies in 
>loading 
>>> Gene Ontology in terms of data.
>>> 
>>> 3) Following is the list of tables we have filled in to work with 
>gus:
>>> Core.Algorithm
>>> Core.AlgorithmInvocation
>>> Core.Userinfo
>>> Core.Projectinfo
>>> Core.Groupinfo
>>> Core.Machine
>>> SRes.Taxon
>>> SRes.Taxonname
>>> SRes.GeneticCode
>>> 
>>> I would be very happy to call you guys over phone (if possible) at a 

>
>>> good time if you think that the answers are really long and complex 

>to 
>>> talk over email.
>>> 
>>> Hope to hear from you all,
>>> Thanks,
>>> Chetna
>>> 
>>> 
>>> 
>>> 
>>> -------------------------------------------------------
>>> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa 
>Clara
>>> The only event dedicated to issues related to Linux enterprise 
>solutions
>>> www.enterpriselinuxforum.com
>>> 
>>> _______________________________________________
>>> Gusdev-gusdev mailing list
>>> Gus...@li...
>>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>> 
>>
>>
>---------End of Included Message----------
>
>
>
---------End of Included Message----------

Re: [Gusdev-gusdev] GenBank, Gene Ontology questions

[Deborah F. P. <pi...@pc...>]

Hi Chetna,

Is your GBParser.pm updated from CVS? There were several changes made to 
the plugin for GUS3.0. I used the plugin in it's current form and it 
performed well. 

Here is a sample command line I used when testing the plugin:

ga GUS::Common::Plugin::GBParser --gbRel 132 --file 
/ptolemy/share/data/thirdparty/genbank/133/gbrod4.seq.gz --debug --log 
gbrod5.seq.log --db_rel_id 6547 > & gbrod5.err &


Your command is missing the --db_rel_id option which is the 
external_database_release_id of GenBank release 133 from the 
ExternalDatabaseRelease table. I just made this a required option so you 
can update from CVS to get that change. 

Can you e-mail the actual errors you get? It should not be necessary for 
the dbref table to be filled to run GBParser.

                                                  Debbie 







On Mon, 12 May 2003, Chetna D. Warade wrote:

> Hi all,
> 
> It would be great if I can get insight into following:
> 
> 1) GenBank
> 
> I am trying to load data from GenBank with the  command
> 
> ga GUS::Common::Plugin::GBParser --gbRel=133 
> --file=/home/gusdev/GenBank/TcNCBIgenomic.gb
> 
> I am getting SQL Error: foreign  key violation for tables SRes.DbRef and 
> DoTS.ExternalNASequence.
> 
> I wanted to know more about how to solve the dependencies in these 
> tables.
> 
> In order to solve this dependency I might need the 
> InsertDbRefAndDbRefNASequence.pm and thats not functional as of yet. I 
> was wondering if its up and running.
> 
> 2) GeneOntology
> 
> We have successfully  installed Taxonomy in the gus 3.0 database at this 
> end. I need to know what version and files do I need to put all the 3 
> ontologies in the database.  Also what are the dependencies in loading 
> Gene Ontology in terms of data.
> 
> 3) Following is the list of tables we have filled in to work with gus:
> Core.Algorithm
> Core.AlgorithmInvocation
> Core.Userinfo
> Core.Projectinfo
> Core.Groupinfo
> Core.Machine
> SRes.Taxon
> SRes.Taxonname
> SRes.GeneticCode
> 
> I would be very happy to call you guys over phone (if possible) at a 
> good time if you think that the answers are really long and complex to 
> talk over email.
> 
> Hope to hear from you all,
> Thanks,
> Chetna
> 
> 
> 
> 
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
> 
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> 

[Gusdev-gusdev] GenBank, Gene Ontology questions

[Chetna D. W. <ch...@ug...>]

Hi all,

It would be great if I can get insight into following:

1) GenBank

I am trying to load data from GenBank with the  command

ga GUS::Common::Plugin::GBParser --gbRel=133 
--file=/home/gusdev/GenBank/TcNCBIgenomic.gb

I am getting SQL Error: foreign  key violation for tables SRes.DbRef and 
DoTS.ExternalNASequence.

I wanted to know more about how to solve the dependencies in these 
tables.

In order to solve this dependency I might need the 
InsertDbRefAndDbRefNASequence.pm and thats not functional as of yet. I 
was wondering if its up and running.

2) GeneOntology

We have successfully  installed Taxonomy in the gus 3.0 database at this 
end. I need to know what version and files do I need to put all the 3 
ontologies in the database.  Also what are the dependencies in loading 
Gene Ontology in terms of data.

3) Following is the list of tables we have filled in to work with gus:
Core.Algorithm
Core.AlgorithmInvocation
Core.Userinfo
Core.Projectinfo
Core.Groupinfo
Core.Machine
SRes.Taxon
SRes.Taxonname
SRes.GeneticCode

I would be very happy to call you guys over phone (if possible) at a 
good time if you think that the answers are really long and complex to 
talk over email.

Hope to hear from you all,
Thanks,
Chetna

Re: [Gusdev-gusdev] representing gene symbols

[Steve F. <st...@pc...>]

the full gene name is something like (i'm making this up) "Breast Cancer 
1"  and the symbol is "BRCA1"

steve

Arnaud Kerhornou wrote:

> Steve
>
> What do you call a full gene name and what is the gene symbol ?
>
> cheers
> Arnaud
>
> Steve Fischer wrote:
>
>> folks-
>>
>> right now in GUS, we have a bunch of tables and attribute that relate 
>> to gene symbols, names and aliases:
>>
>> Dots::Gene.name
>> Dots::Gene.gene_symbol
>> Dots::GeneAlias
>> Sres::DbRef.gene_symbol   (this is pretty clearly a hack.  DbRef is 
>> intended to store references to external database entries.  it is 
>> hackish to encode in the schema that we assume that such entries are 
>> gene records.  they could easily be proteins or journals, whatever)
>>
>> This schema is being used by the DoTS project to hold both automated 
>> assignments of gene_symbol (Sres::DbRef) and manual assignments.  The 
>> problem for the DoTS project is that these disparate ways of making 
>> assignments are not managed as a coherent whole. The manual and 
>> automated assignments are not queried together. I am thinking that we 
>> should consider a different approach, one modeled on how we store GO 
>> assignments.  It seems that Gene symbols and GO terms are very 
>> similar.  they are both amenable to contolled vocabs, and are both 
>> assigned by automated and manual operations.  This pattern may apply 
>> to other types of annotation as well.
>>
>>
>> 1. introduce a GeneName table:
>>   GeneName.gene_name_id
>>   GeneName.name    --- the full name
>>   GeneName.symbol  -- the symbol
>>
>> 2. introduce a GeneSynonym table:
>>    GeneSynonym.gene_name_id     -- the GeneName it is a synonym for
>>    GeneSynonym.name                  -- the full name of the synonym
>>    GeneSynonym.symbol               -- the symbol
>>
>> these tables are treated as controlled vocabularies, downloaded from 
>> sites such as HUGO and MGI.
>>
>>
>> 3. introduce a GeneNameAssociation table -- a mapping between Gene 
>> and GeneName (better name for this??)
>>   GeneNameAssociation.gene_id
>>   GeneNameAssociation.gene_name_id
>>   GeneNameAssociaction.review_status_id
>>   GeneNameAssociaction.is_not
>>   probably adopt here an instance and evidence mechanism similar to 
>> go assocation.
>>
>> note that this implies a m-m relationship between gene and gene name. 
>> while this might not be true in the ideal sense, it may well be true 
>> for tentative data, which is what we often have.  so, this model 
>> accepts that unfortunate fact, and does the best to preserve as much 
>> info as we can.
>>
>
>
>
> -------------------------------------------------------
> Enterprise Linux Forum Conference & Expo, June 4-6, 2003, Santa Clara
> The only event dedicated to issues related to Linux enterprise solutions
> www.enterpriselinuxforum.com
>
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev

Re: [Gusdev-gusdev] representing gene symbols

[Arnaud K. <ax...@sa...>]

Steve

What do you call a full gene name and what is the gene symbol ?

cheers
Arnaud

Steve Fischer wrote:

> folks-
>
> right now in GUS, we have a bunch of tables and attribute that relate 
> to gene symbols, names and aliases:
>
> Dots::Gene.name
> Dots::Gene.gene_symbol
> Dots::GeneAlias
> Sres::DbRef.gene_symbol   (this is pretty clearly a hack.  DbRef is 
> intended to store references to external database entries.  it is 
> hackish to encode in the schema that we assume that such entries are 
> gene records.  they could easily be proteins or journals, whatever)
>
> This schema is being used by the DoTS project to hold both automated 
> assignments of gene_symbol (Sres::DbRef) and manual assignments.  The 
> problem for the DoTS project is that these disparate ways of making 
> assignments are not managed as a coherent whole. The manual and 
> automated assignments are not queried together. 
> I am thinking that we should consider a different approach, one 
> modeled on how we store GO assignments.  It seems that Gene symbols 
> and GO terms are very similar.  they are both amenable to contolled 
> vocabs, and are both assigned by automated and manual operations.  
> This pattern may apply to other types of annotation as well.
>
>
> 1. introduce a GeneName table:
>   GeneName.gene_name_id
>   GeneName.name    --- the full name
>   GeneName.symbol  -- the symbol
>
> 2. introduce a GeneSynonym table:
>    GeneSynonym.gene_name_id     -- the GeneName it is a synonym for
>    GeneSynonym.name                  -- the full name of the synonym
>    GeneSynonym.symbol               -- the symbol
>
> these tables are treated as controlled vocabularies, downloaded from 
> sites such as HUGO and MGI.
>
>
> 3. introduce a GeneNameAssociation table -- a mapping between Gene and 
> GeneName (better name for this??)
>   GeneNameAssociation.gene_id
>   GeneNameAssociation.gene_name_id
>   GeneNameAssociaction.review_status_id
>   GeneNameAssociaction.is_not
>   probably adopt here an instance and evidence mechanism similar to go 
> assocation.
>
> note that this implies a m-m relationship between gene and gene name. 
> while this might not be true in the ideal sense, it may well be true 
> for tentative data, which is what we often have.  so, this model 
> accepts that unfortunate fact, and does the best to preserve as much 
> info as we can.
>

Re: [Gusdev-gusdev] representing gene symbols

[Arnaud K. <ax...@sa...>]

Hi Steve

What about genes which have synonyms but don't have an approved primary 
name yet ?

See below the complete list of gene names we are using. This list 
doesn't only include the primary name and its synonyms which are, as far 
as I understood, infered from the function of the gene. It also includes 
systematic names, assigned by the sequencing centres.

Arnaud


        Additional qualifiers to be used in place of /gene for GeneDB
        purposes

    * /systematic_id - final systematic name for when chromosome is
      finished or stable sequence is submitted, will be title for gene
      page in abscence of standard name. Could be /locus_tag, the EMBL
      equivalent (to be discussed??)
    * /temporary_systematic_id - for temporary systematic name used
      during projects where sequence is unfinished, i.e temporary name
      for the shotgun sequences.
    * /previous_systematic_id - for systematic names no longer in use.
    * /synonym - used for other gene names still in use and to be
      displayed on the gene page
    * /obsolete_name - redundant gene names that can be queried but are
      not visible on gene page eg. errors
    * /primary_name - for published or agreed unique user friendly gene
      name, following the convention set out for kinetoplastids, will be
      the title for gene page. NB. this is an EMBL-compliant qualifier
      so it should be used "to give full gene name, but use /gene to
      give gene symbol".
    * /reserved_name - pre publication names that will, presumably,
      become the standard_name



Steve Fischer wrote:

> folks-
>
> right now in GUS, we have a bunch of tables and attribute that relate 
> to gene symbols, names and aliases:
>
> Dots::Gene.name
> Dots::Gene.gene_symbol
> Dots::GeneAlias
> Sres::DbRef.gene_symbol   (this is pretty clearly a hack.  DbRef is 
> intended to store references to external database entries.  it is 
> hackish to encode in the schema that we assume that such entries are 
> gene records.  they could easily be proteins or journals, whatever)
>
> This schema is being used by the DoTS project to hold both automated 
> assignments of gene_symbol (Sres::DbRef) and manual assignments.  The 
> problem for the DoTS project is that these disparate ways of making 
> assignments are not managed as a coherent whole. The manual and 
> automated assignments are not queried together. 
> I am thinking that we should consider a different approach, one 
> modeled on how we store GO assignments.  It seems that Gene symbols 
> and GO terms are very similar.  they are both amenable to contolled 
> vocabs, and are both assigned by automated and manual operations.  
> This pattern may apply to other types of annotation as well.
>
>
> 1. introduce a GeneName table:
>   GeneName.gene_name_id
>   GeneName.name    --- the full name
>   GeneName.symbol  -- the symbol
>
> 2. introduce a GeneSynonym table:
>    GeneSynonym.gene_name_id     -- the GeneName it is a synonym for
>    GeneSynonym.name                  -- the full name of the synonym
>    GeneSynonym.symbol               -- the symbol
>
> these tables are treated as controlled vocabularies, downloaded from 
> sites such as HUGO and MGI.
>
>
> 3. introduce a GeneNameAssociation table -- a mapping between Gene and 
> GeneName (better name for this??)
>   GeneNameAssociation.gene_id
>   GeneNameAssociation.gene_name_id
>   GeneNameAssociaction.review_status_id
>   GeneNameAssociaction.is_not
>   probably adopt here an instance and evidence mechanism similar to go 
> assocation.
>
> note that this implies a m-m relationship between gene and gene name. 
> while this might not be true in the ideal sense, it may well be true 
> for tentative data, which is what we often have.  so, this model 
> accepts that unfortunate fact, and does the best to preserve as much 
> info as we can.
>
>

Re: [Gusdev-gusdev] representing gene symbols

[Angel P. <an...@pc...>]

Chris Stoeckert wrote:

>On Mon, 5 May 2003, Steve Fischer wrote:
>
>  
>
>>i separated the synonyms from the names because i understood that HUGO 
>>and MGI have standardized that information, ie, that there is an 
>>approved name.
>>    
>>
>This is correct.
>  
>

I was thinking more in terms of other organisms outside of human and 
mouse. But in talking with Steve directly, I have come around to his way 
of thinking.

Basically, we don't want assignments of arbitrary gene names. If the 
synonym is in the same talbe as the approved name, then the possibility 
exists for someone to assign the synonym as the sole gene name.  This 
may happen anyway when there is no naming authority for the particular 
organism being annotated, but at least you are forced to explicitly 
graduate synonyms to an official gene name, as far as GUS is concerned.

Angel

>Chris
>
>  
>

Re: [Gusdev-gusdev] representing gene symbols

[Chris S. <sto...@pc...>]

On Mon, 5 May 2003, Steve Fischer wrote:

> i separated the synonyms from the names because i understood that HUGO 
> and MGI have standardized that information, ie, that there is an 
> approved name.
This is correct.

Chris

-- 
Chris Stoeckert, Ph.D.
Research Associate Professor, Dept. of Genetics
Center for Bioinformatics, University of Pennsylvania
423 Guardian Dr., Philadelphia, PA 19104
Ph: 215-573-4409   FAX:215-573-3111

Re: [Gusdev-gusdev] representing gene symbols

[Steve F. <sfi...@pc...>]

i separated the synonyms from the names because i understood that HUGO 
and MGI have standardized that information, ie, that there is an 
approved name.

about the ExternalDatabaseRelease FK, yes, that sounds good.  i was only 
providing a sketch here.

the is_not is there for the same reason it is there for GO assocations: 
the association was made automatically, but a curator says it "is not" true.

steve

Angel Pizarro wrote:

> Steve Fischer wrote:
>
>> folks-
>> 1. introduce a GeneName table:
>>   GeneName.gene_name_id
>>   GeneName.name    --- the full name
>>   GeneName.symbol  -- the symbol
>>
>> 2. introduce a GeneSynonym table:
>>    GeneSynonym.gene_name_id     -- the GeneName it is a synonym for
>>    GeneSynonym.name                  -- the full name of the synonym
>>    GeneSynonym.symbol               -- the symbol
>> these tables are treated as controlled vocabularies, downloaded from 
>> sites such as HUGO and MGI.
>
>
> Why do you want to separate the synonyms? It is implying that the 
> GeneName table has an "approved" name and only one approved name, but 
> approved by whom and what about alternate sources of information?  
> Also there should be a ExternalDatabaseRelease FK reference here. I 
> would store all names in a single table and handle the 'approved' 
> names either by a query to the ExternalDBRel (if you always prefer one 
> authority to others) or in the GeneNameAssociation table with a bit 
> column.
>
>>
>>
>> 3. introduce a GeneNameAssociation table -- a mapping between Gene 
>> and GeneName (better name for this??)
>>   GeneNameAssociation.gene_id
>>   GeneNameAssociation.gene_name_id
>>   GeneNameAssociaction.review_status_id
>>   GeneNameAssociaction.is_not 
>
>
> Why "is_not" ? Is this a hold-over from GO terms? I don't see how it 
> applies to GeneName.
>
>
> Angel
>
>
>
> -------------------------------------------------------
> This sf.net email is sponsored by:ThinkGeek
> Welcome to geek heaven.
> http://thinkgeek.com/sf
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev