gusdev-gusdev — Topics concerning GUS development

[Gusdev-gusdev] Installing a new DB

[<pj...@sa...>]

Hi,

I have a shiney new Oracle instance to populate. I have done cvs update, moved
my old GUS_HOME directory out of the way and ran the below command. I was hoping
to get a $GUS_HOME/schema/oracle/create-db.sh script created for me as mentioned
here http://www.gusdb.org/documentation/schema-setup.html but the schema dir
does not get created, though lots of other stuff gets created and copied over.

Perhaps I've missed something or the method of doing this has changed? I'm running;

  `build GUS install -append -skipJavaCompiling`

Paul.

Re: [Gusdev-gusdev] Error registering GenericParser2 Plugin

[<pj...@sa...>]

Quoting Tejal Karkhanis <tka...@vb...>:

> Hi,
> 
> I am trying to register this plugin, but am getting the following error: 
> Please refer to the stack trace below. I have the latest version of bioperl 
> installed. Any suggestions ?

Unfortuantely this plugin has a dependancy to the Pathogen Sequencing Unit (PSU,
at the Sanger Institute) internal code library;

  Bio/PSU/IO/BufferFH.pm

The short term fix is to download the set of code from webcvs.sanger.ac.uk. I
can not currently access the site since we had a air conditioning failure on
Saturday and some of the systems have not yet been brought back to life. The
path to the "Bio/PSU" is psu/genlib/perl/src/Bio/PSU in the repository.
Hopefully this will be obvious on the website...

Email me direct if you have problems,
Paul.


> --------------------ERROR: Can't locate Bio/PSU/IO/BufferFH.pm in @INC 
> (@INC contains: /home/apps/GUS/dev/gushome/lib/perl 
> /usr/lib/perl5/5.8.0/i486-linux /usr/lib/perl5/5.8.0 
> /usr/lib/perl5/site_perl/5.8.0/i486-linux /usr/lib/perl5/site_perl/5.8.0 
> /usr/lib/perl5/site_perl .) at GenericParser2GUS.pm line 76.
> 
> BEGIN failed--compilation aborted at GenericParser2GUS.pm line 76.
> Compilation failed in require at (eval 3) line 1.
> 
> 
> --------------------------- STACK TRACE -------------------------
>         
>
GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x813361c)','Can\'t
> 
> locate Bio/PSU/IO/BufferFH.pm in @INC (@INC contains: ...') called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 248
> 
>         
>
GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS')
> 
> called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 664
> 
>         
>
GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x813361c)',0,'GenericParser2GUS')
> 
> called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
> 
>         
>
GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS')
> 
> called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
> 
>         
>
GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS')
> 
> called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 192
> 
>         
>
GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x813361c)','ARRAY(0x813ad20)')
> 
> called at /home/apps/GUS/dev/gushome/bin/ga line 11
> 
> Thanks,
> 
> Tejal
> 
> ---------------------------------------------------------
> Tejal Karkhanis
> Research Associate
> Virginia Bioinformatics Institute
> Bioinformatics I Washington Street
> Blacksburg VA -24061
> Tel: (540) 231 5249
> Email: tka...@vb...
> 
> 
> 
> -------------------------------------------------------
> This SF.Net email is sponsored by: Oracle 10g
> Get certified on the hottest thing ever to hit the market... Oracle 10g. 
> Take an Oracle 10g class now, and we'll give you the exam FREE.
> http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> 

Re: [Gusdev-gusdev] Error registering GenericParser2 Plugin

[<pj...@sa...>]

Quoting Tejal Karkhanis <tka...@vb...>:

> Hi,
> 
> I am trying to register this plugin, but am getting the following error: 
> Please refer to the stack trace below. I have the latest version of bioperl 
> installed. Any suggestions ?

Unfortuantely this plugin has a dependancy to the Pathogen Sequencing Unit (PSU,
at the Sanger Institute) internal code library;

  Bio/PSU/IO/BufferFH.pm

The short term fix is to download the set of code from webcvs.sanger.ac.uk. I
can not currently access the site since we had a air conditioning failure on
Saturday and some of the systems have not yet been brought back to life. The
path to the "Bio/PSU" is psu/genlib/perl/src/Bio/PSU in the repository.
Hopefully this will be obvious on the website...

Email me direct if you have problems,
Paul.


> --------------------ERROR: Can't locate Bio/PSU/IO/BufferFH.pm in @INC 
> (@INC contains: /home/apps/GUS/dev/gushome/lib/perl 
> /usr/lib/perl5/5.8.0/i486-linux /usr/lib/perl5/5.8.0 
> /usr/lib/perl5/site_perl/5.8.0/i486-linux /usr/lib/perl5/site_perl/5.8.0 
> /usr/lib/perl5/site_perl .) at GenericParser2GUS.pm line 76.
> 
> BEGIN failed--compilation aborted at GenericParser2GUS.pm line 76.
> Compilation failed in require at (eval 3) line 1.
> 
> 
> --------------------------- STACK TRACE -------------------------
>         
>
GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x813361c)','Can\'t
> 
> locate Bio/PSU/IO/BufferFH.pm in @INC (@INC contains: ...') called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 248
> 
>         
>
GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS')
> 
> called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 664
> 
>         
>
GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x813361c)',0,'GenericParser2GUS')
> 
> called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 456
> 
>         
>
GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS')
> 
> called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 283
> 
>         
>
GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS')
> 
> called at 
> /home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 192
> 
>         
>
GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x813361c)','ARRAY(0x813ad20)')
> 
> called at /home/apps/GUS/dev/gushome/bin/ga line 11
> 
> Thanks,
> 
> Tejal
> 
> ---------------------------------------------------------
> Tejal Karkhanis
> Research Associate
> Virginia Bioinformatics Institute
> Bioinformatics I Washington Street
> Blacksburg VA -24061
> Tel: (540) 231 5249
> Email: tka...@vb...
> 
> 
> 
> -------------------------------------------------------
> This SF.Net email is sponsored by: Oracle 10g
> Get certified on the hottest thing ever to hit the market... Oracle 10g. 
> Take an Oracle 10g class now, and we'll give you the exam FREE.
> http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> 

[Gusdev-gusdev] Error registering GenericParser2 Plugin

[Tejal K. <tka...@vb...>]

Hi,

I am trying to register this plugin, but am getting the following error: 
Please refer to the stack trace below. I have the latest version of bioperl 
installed. Any suggestions ?

--------------------ERROR: Can't locate Bio/PSU/IO/BufferFH.pm in @INC 
(@INC contains: /home/apps/GUS/dev/gushome/lib/perl 
/usr/lib/perl5/5.8.0/i486-linux /usr/lib/perl5/5.8.0 
/usr/lib/perl5/site_perl/5.8.0/i486-linux /usr/lib/perl5/site_perl/5.8.0 
/usr/lib/perl5/site_perl .) at GenericParser2GUS.pm line 76.

BEGIN failed--compilation aborted at GenericParser2GUS.pm line 76.
Compilation failed in require at (eval 3) line 1.


--------------------------- STACK TRACE -------------------------
         GUS::PluginMgr::Plugin::error('GUS::PluginMgr::GusApplication=HASH(0x813361c)','Can\'t 
locate Bio/PSU/IO/BufferFH.pm in @INC (@INC contains: ...') called at 
/home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 248

         GUS::PluginMgr::GusApplication::newFromPluginName('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS') 
called at 
/home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 664

         GUS::PluginMgr::GusApplication::create_or_update_implementation('GUS::PluginMgr::GusApplication=HASH(0x813361c)',0,'GenericParser2GUS') 
called at 
/home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 456

         GUS::PluginMgr::GusApplication::doMajorMode_Create('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS') 
called at 
/home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 283

         GUS::PluginMgr::GusApplication::doMajorMode('GUS::PluginMgr::GusApplication=HASH(0x813361c)','GenericParser2GUS') 
called at 
/home/apps/GUS/dev/gushome/lib/perl/GUS/PluginMgr/GusApplication.pm line 192

         GUS::PluginMgr::GusApplication::parseAndRun('GUS::PluginMgr::GusApplication=HASH(0x813361c)','ARRAY(0x813ad20)') 
called at /home/apps/GUS/dev/gushome/bin/ga line 11

Thanks,

Tejal

---------------------------------------------------------
Tejal Karkhanis
Research Associate
Virginia Bioinformatics Institute
Bioinformatics I Washington Street
Blacksburg VA -24061
Tel: (540) 231 5249
Email: tka...@vb...

[Gusdev-gusdev] Errors when running plugins -- fix inside

[Dave B. <db...@pc...>]

Hey all,

Recently some people have been getting errors when running plugins.  
I implemented a fix for these problems.  I suspect that everyone will see 
the same problems the next time they CVS update the GUS project in the 
build system, so it might be worth it to get the fix now.  The text 
of the error message is at the end of the email.

Here are the steps to resolve the problem:

%cd {PROJECT_HOME}/GUS/ObjRelP/lib/perl

%cvs update  (This will update the module Oracle.pm, and possibly 
others.)

Regenerate your objects:

%touch {PROJECT_HOME}/GUS/Model/schema/VERSION

%build GUS/Model install -append

You are now ready to run plugins again.  Sorry for any inconvenience. 

Dave


The error in question looks similar to the following: 

 > DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into 
> ("CORE"."ALGORITHMINVOCATION"."ALGORITHM_INVOCATION_ID") (DBD ERROR: 
> OCIStmtExecute) at 
> /home/manduchi/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> 
>  SQL ERROR!! involving
>  
>     INSERT INTO Core.AlgorithmInvocation (  group_read, comment_string, 
> user_read, algorithm_implementation_id, other_write, modification_date, 
> end_time, cpu_time, row_group_id, machine_id, user_write, other_read, 
> group_write, cpus_used, start_time, row_user_id, row_alg_invocation_id, 
> row_project_id, result )
>     VALUES   (  ?, '', ?, ?, ?, SYSDATE, SYSDATE, ?, ?, ?, ?, ?, ?, ?, 
> SYSDATE, ?, ?, ?, ? )  
>  Values: 1, 1, 21248, 0, 0, 0, 0, 1, 1, 1, 1, 1020, 1, 12, pending at 
> /home/manduchi/gus_home/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185

etc. etc.

Re: [Gusdev-gusdev] GBParser

[Angel P. <an...@pc...>]

Thanks very much for writing this up Michael. It will eventually go into 
real GUS documentation ;)
Some additional comments below:
MICHAEL LUCHTAN wrote:

>Hey Jinal-
>It is kind of important to know what's going on with the algorithm_id.
>Almost every table in GUS has a field called row_alg_invocation_id that is
>a primary foriegn key.
>  
>
At the rick of throwing grease on the fire, you should know that as far 
as the plugin layer is concerned, this is a foriegn key. But the foreign 
key does not actaully exist in the database. We found that performance 
on deletes with respect to the AgloritmInvocation table was not feasible 
when the FK was actually enforced in the database.

>I will attempt to explain, and maybe someone can clarify my lack of
>knowledge.  But this is strongly tied to the whole ga/plugin structure.
>Every plugin that you use is an an algorithm.  When you use ga +create
>SomePlugin it puts an entry into the algorithm table for that plug-in, and
>I assume an  initial entry into the algorithmImplementation table.
>When you do a ga +update SomePlugin it puts a new entry into into the
>algorithmImplementation table with the same algorithm_id.  This way you
>can keep updating your plug-ins from CVS.  So, depending on how many times
>you run ga +update SomePlugin, you can have that many rows in
>algorithmImplementation with the algorithm_id that corresponds to
>SomePlugin.
>Once that's in there, every time you <i>use</i> SomePlugin, ga places an
>entry into algorithmInvocation, with a new algorithm_invocation_id , and
>an algorithm_implentation_id corresponding to the version of the plugin
>you are running.  This is usefull for when you have entered a bunch of
>data using SomePlugin, and then you find out that SomePlugin had a bug in
>it and you placed the data in an incorrect place, or entered incorrect
>data.  You can then remove everything that has the row_alg_invocation_id
>equal to the algorithm_invocation_id that messed up.
>Now, this collection of tables is really circular, with
>algorithmInvocation having a self-referential primary key, but I think
>that the install of GUS will take care of it.
>
Yes, the bootstraprow.sql file takes care of the circular reference.

>  I assume that ga itself is
>an algorithm.  My oracle is down right now so I can't check.
>I couldn't answer your question directly before because I distinctly
>remember entering a row in Algorithm once for an annotation ID, so if I
>don't know the particulars of the plugin, can't say for sure what you
>need.  But I might remember distinctly doing something wrong, since I was
>still quite the nube back then(now I am only a little less
>wet-behind-the-ears).  I don't know if every algorithm is a plugin, and
>every plugin is an algorithm(ie a one-to-one correspondence), or if every
>plug-in is an algorithm but not every algorithm is a plugin-- you know
>like all shriners are masons but not all masons are shriners.
>If anyone wants to clarify this, feel free.
>  
>
Every plugin is an algortihm, but not every algorithm is a plugin. For 
instance we have an "sqlplus" algorithm for insertions done through 
SQLPlus interface.
Angel

>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>  
>

Re: [Gusdev-gusdev] GBParser

[MICHAEL L. <lu...@cs...>]

Hey Jinal-
It is kind of important to know what's going on with the algorithm_id.
Almost every table in GUS has a field called row_alg_invocation_id that is
a primary foriegn key.
I will attempt to explain, and maybe someone can clarify my lack of
knowledge.  But this is strongly tied to the whole ga/plugin structure.
Every plugin that you use is an an algorithm.  When you use ga +create
SomePlugin it puts an entry into the algorithm table for that plug-in, and
I assume an  initial entry into the algorithmImplementation table.
When you do a ga +update SomePlugin it puts a new entry into into the
algorithmImplementation table with the same algorithm_id.  This way you
can keep updating your plug-ins from CVS.  So, depending on how many times
you run ga +update SomePlugin, you can have that many rows in
algorithmImplementation with the algorithm_id that corresponds to
SomePlugin.
Once that's in there, every time you <i>use</i> SomePlugin, ga places an
entry into algorithmInvocation, with a new algorithm_invocation_id , and
an algorithm_implentation_id corresponding to the version of the plugin
you are running.  This is usefull for when you have entered a bunch of
data using SomePlugin, and then you find out that SomePlugin had a bug in
it and you placed the data in an incorrect place, or entered incorrect
data.  You can then remove everything that has the row_alg_invocation_id
equal to the algorithm_invocation_id that messed up.
Now, this collection of tables is really circular, with
algorithmInvocation having a self-referential primary key, but I think
that the install of GUS will take care of it.  I assume that ga itself is
an algorithm.  My oracle is down right now so I can't check.
I couldn't answer your question directly before because I distinctly
remember entering a row in Algorithm once for an annotation ID, so if I
don't know the particulars of the plugin, can't say for sure what you
need.  But I might remember distinctly doing something wrong, since I was
still quite the nube back then(now I am only a little less
wet-behind-the-ears).  I don't know if every algorithm is a plugin, and
every plugin is an algorithm(ie a one-to-one correspondence), or if every
plug-in is an algorithm but not every algorithm is a plugin-- you know
like all shriners are masons but not all masons are shriners.
If anyone wants to clarify this, feel free.

Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Thu, 20 May 2004, jinal jhaveri wrote:

> I am using CVS Version 1.30
>
> ----- Original Message -----
> From: MICHAEL LUCHTAN <lu...@cs...>
> Date: Thursday, May 20, 2004 6:21 am
> Subject: Re: [Gusdev-gusdev] GBParser
>
> > Actually I answered the second question.  But I was willing to give a try
> > at the third.  But upon looking at my GBParser module, there IS NO
> > arguement for algoinvo.  I have CVS version 1.17.  Jinal, what are you
> > running?  Unfortunately, I can't remember if we modified these here or
> > not, but I don't think that we did.  Here is our module, attached.
> >
> >
> > Michael Luchtan
> > http://www.cs.uga.edu/~luchtan
> >
> >
> > On Thu, 20 May 2004, Steve Fischer wrote:
> >
> > > jinal-
> > >
> > > see below
> > >
> > > jinal jhaveri wrote:
> > >
> > > >Hi,
> > > >
> > > >I have some questions regarding the GBParser module
> > > >
> > > >1) First required field  is --gbRel. As I understand this is genbank's
> > db realease id. Now where do I get this number from? ( genbanks
> > website????) Does anybody has idea about what is the release right now on web?
> > > >
> > > >
> > > yes, this is from the readme file .   it is stored in GUS in the
> > > created_rel_ver and updated_rel_ver attributes of the DoTS::NAEntry table:
> > > http://www.gusdb.org/cgi-
> > bin/schemaBrowser?db=CBILBLD&table=DoTS::NAEntry&path=DoTS::NAEntry>
> > > >2) --db_rel_id : As the documentation describes, this is external
> > database id. Do I create this id on my own? Do I need to keep this entry
> > in any other table? Does this id has one to one correspondence with the
> > project I am working on (and the one I described in my .gus.properties file?)
> > > >
> > > gus is strict about its data.   we track pretty much everything.  so,
> > > for example, in order to put data in from an external database, or, to
> > > mention source ids of an external database, the external database must
> > > be known by gus.   the two tables that hold this are:
> > > SRes.ExternalDatabase and SRes.ExternalDatabaseRelease.  The former
> > > describes the DB, the latter the particular release of the DB, and it
> > > points back to the former.   The GBParser is asking you for a primary
> > > key in the ExternalDatabaseRelease table so that all the data you load
> > > will be associated with it.
> > >
> > > in the case of GenBank, we at cbil only store one version of it, which
> > > we update periodically.  so, for it, we set the 'version' attribute to
> > > "continuous."   for other DBs, we store multiple copies.  in that case
> > > we use a real version number, and create a new ExternalDatabaseRelease
> > > row each time we load a new one in.
> > >
> > > one of the known weaknesses of the current GUS install process is that
> > > we don't provide a bunch of standard databases as part of the data that
> > > we load to get you off the ground.   but, paul mooney has been handing
> > > out an xml file which you can load with the UpdateGusFromXML plugin.
> > > his mail is pj...@sa...
> > >
> > > that file only works for databases that you will only maintain one
> > > release of.   if you want to load multiple versions of a db (eg, pfam),
> > > you will need to add new rows.
> > >
> > > >3) --algoinvo=s: What is this? (I looked at the docs but they talk
> > about some invocation id. Is this to change the algorithm to be invoked?)
> > > >
> > > >
> > > >
> > > i see that michael answered this
> > >
> > > >Any help will be really appreciated
> > > >
> > > >
> > > >thanks
> > > >--Jinal
> > > >
> > > >
> > > >
> > > >
> > > >
> > > >-------------------------------------------------------
> > > >This SF.Net email is sponsored by: SourceForge.net Broadband
> > > >Sign-up now for SourceForge Broadband and get the fastest
> > > >6.0/768 connection for only $19.95/mo for the first 3 months!
> > > >http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
> > > >_______________________________________________
> > > >Gusdev-gusdev mailing list
> > > >Gus...@li...
> > > >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > > >
> > > >
> > >
> > >
> > >
> > > -------------------------------------------------------
> > > This SF.Net email is sponsored by: Oracle 10g
> > > Get certified on the hottest thing ever to hit the market... Oracle 10g.
> > > Take an Oracle 10g class now, and we'll give you the exam FREE.
> > > http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> > > _______________________________________________
> > > Gusdev-gusdev mailing list
> > > Gus...@li...
> > > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > >
> >
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by: Oracle 10g
> Get certified on the hottest thing ever to hit the market... Oracle 10g.
> Take an Oracle 10g class now, and we'll give you the exam FREE.
> http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>

Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[<pj...@sa...>]

Madhura,

The constraint applies to the DoTS.GeneFeature.ReviewStatus. The dictionary
table SRes.ReviewStatus is probably not populated, hence you need some more XML!!!

I have not tested this but it is quite simple. Yes, I have added it to my "list
of XML files to put in CVS".

<SRes::ReviewStatus>
  <REVIEW_STATUS_ID>5</REVIEW_STATUS_ID>
  <NAME>Unknown</NAME>
  <DESCRIPTION>Review status not known</DESCRIPTION>
<SRes::ReviewStatus>

<SRes::ReviewStatus>
  <REVIEW_STATUS_ID>10</REVIEW_STATUS_ID>
  <NAME>Not reviewed</NAME>
  <DESCRIPTION>A human has not yet reviewed this feature</DESCRIPTION>
<SRes::ReviewStatus>

<SRes::ReviewStatus>
  <REVIEW_STATUS_ID>15</REVIEW_STATUS_ID>
  <NAME>Annotated</NAME>
  <DESCRIPTION>Annotator/Curator has attached data to this feature</DESCRIPTION>
<SRes::ReviewStatus>



Quoting Madhura Sharangpani <sma...@st...>:

> 
> Hi Paul
> 
> After reading your email, I setted up Dots.SequenceType tables with required
> ds-DNA entries and then tried loading EMBL files again, this time it made
> progress, it didn't give "can't fine sequence type ds-DNA" error, but it
> went ahead and gave following error:
> 
> **********************************************
> buildRNA() : DoTS.RNA created.
> buildRNAInstance() : $rna_object->getId() =
> buildRNAInstance() : Creating brand new RNAInstance
> Object type is 'GUS::Model::DoTS::GeneFeature', $object =
> GUS::Model::DoTS::Gene
> Feature=HASH(0x173113c)
> DBD::Oracle::st execute failed: ORA-02291: integrity constraint
> (DOTS.NAFEATUREI
> MP_FK08) violated - parent key not found (DBD ERROR: OCIStmtExecute) at
> /afs/ir/
> users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> 
>  SQL ERROR!! involving
> 
>     INSERT INTO DoTS.GeneFeature (  gene_type, row_user_id, user_write,
> group_wr
> ite, na_sequence_id, row_project_id, name, is_partial, product, is_pseudo,
> revie
> w_status_id, subclass_view, group_read, row_group_id, other_read,
> modification_d
> ate, is_predicted, user_read, row_alg_invocation_id, other_write,
> na_feature_id,
>  number_of_exons )
>     VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, SYSDATE, ?, ?,
> ?, ?
> , ?, ? )
>  Values: protein coding, 1, 1, 1, 49, 1, BP0001, 0, glucose inhibited
> division p
> rotein A, 0, 5, GeneFeature, 1, 1, 1, 1, 1, 99, 0, 1, 1 at
> /afs/ir/users/s/m/sma
> dhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185
> 
> GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0xb791a
> 8)', '^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.GeneFeature (
> ge...') c
> alled at
> /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm l
> ine 148
> **********************************************
> 
> Madhura
> 
> 
> 
> ----- Original Message ----- 
> From: <pj...@sa...>
> To: "Madhura Sharangpani" <sma...@st...>
> Cc: <gus...@li...>
> Sent: Thursday, May 20, 2004 3:25 AM
> Subject: Re: [Gusdev-gusdev] Problem loading EMBL files into GUS
> 
> 
> > Madhura,
> >
> > Did you setup the DoTS.SequenceType tables?
> > I presume it can't find ds-DNA in there (and doesn't report it - I shall
> improve
> > the plugin).
> > See: GUS/Website/htdocs/documentation/installguide_UGA.html
> > and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
> ds-DNA,
> > ss-RNA etc. I'm guessing we used those statements here at Sanger.
> >
> > All,
> >
> > On a slightly related note, I do have a collection of XML files that
> populate
> > dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
> Someone
> > emailed the list and said it would be good to have this somewhere, perhaps
> CVS.
> > I agree, although we would need to have "common" and "center specific"
> > dirctories. I am in the process of setting up a new GUS instance so I will
> soon
> > be in a better position to propose something.
> >
> > Paul.
> >
> > Quoting Madhura Sharangpani <sma...@st...>:
> >
> > > Hi All
> > >
> > > I am trying to load EMBL files into GUS, but having some problems,
> > > when I try to execute the command :
> > >
> > > ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> > > -filepath=b.pertussis.embl -sequencetype=ds-DNA
> > >
> > > without commit, I get the following error:
> > >
> > > *********************************************************
> > > ***COMMIT TURNED OFF***
> > > Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> > >
> > > embl file to parse, b.bronchiseptica.embl...
> > > ID line fine!!!
> > > source feature found, FT   source          1..5339179!!
> > > processing bioperl sequence, BB...
> > > sequence not in GUS yet
> > > can't find SequenceType, ds-DNA
> > > number of features = 5009
> > > organism, taxon id: Bordetella bronchiseptica,
> > > DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> > > ("DOTS"."NASE
> > > QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> > > /afs/ir/users/s/m/
> > > smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> > >
> > > (after this along sequence is printed)
> > >
> > >
> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGC
> TCTT
> > > TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
> 1825282,
> > > 0
> > > at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> line
> > > 18
> > > 5
> > >
> > >
> ***************************************************************************
> > > Can someone tell me why this error is occuring?
> > >
> > > Thanks!
> > >
> > > Madhura
> > >
> >
> >
> >
> 

Re: [Gusdev-gusdev] GBParser bug

[Fidel S. <fi...@vb...>]

Jonathan,

Thanks!  They work.

Fidel


Jonathan Schug <js...@pc...> writes:

     > Fidel:
>
     > Here are the relevant files.  They belong at this path:
>
     > Projects/CBIL/Bio/lib/perl/GenBank
>
     > Let me know they work.
>
     > Jonathan
>
>
>
>
>
>
     > On May 19, 2004, at 1:29 AM, Fidel Salas wrote:
>
>> Jonathan,
>>
>> Hi!
>>
>> We do not have access to CBIL's source tree except through compressed
>> tar files.  The most recent file available is from 5/6/2004 and
>> therefore it does not contain your edits.
>>
>> Fidel
>>
>>
>> Jonathan Schug <js...@pc...> writes:
>>
>>> Hi Fidel!
>>>
>>> I believe I have fixed this error.  I have committed files in
>>> CBIL/Bio/lib/perl/GenBank that contain the changes.
>>>
>>> Please let me know if it is working now.
>>>
>>> Thanks,
>>>
>>> Jonathan
>>>
>>> On May 18, 2004, at 9:32 AM, Angel Pizarro wrote:
>>>
>>>> Fidel Salas wrote:
>>>>
>>>>> There is a bug in the parser that only becomes expressed if the DNA
>>>>> sequence goes over 99999999 nucleotides.  An error gets output like
>>>>> this:
>>>>> ERR     LINE=2575409    unparsed line   100000021 cggggcgggg
>>>>> agactaggag aaagctgcca gaggctgctg gcaagagata tccactggtt
>>>>>
>>>>>
>>>> Fidel, I suspect that this error is coming from the support gbff
>>>> parser CBIL::GenBank modules. J. Schug is the author and I'll ask
>>>> him if he knows what causes this.
>>>>
>>>> Angel
>>>>
>>>>> The error happens because the parser assumes that there will be
>>>>> spaces
>>>>> before the number indicating the nucleotide number.  That is the
>>>>> case
>>>>> until the number of nucleotides goes over the threshold value
>>>>> indicated above.
>>>>>
>>>>> Fidel
>>>>>
>>>>>
>>>>>
>>>>> -------------------------------------------------------
>>>>> This SF.Net email is sponsored by: SourceForge.net Broadband
>>>>> Sign-up now for SourceForge Broadband and get the fastest
>>>>> 6.0/768 connection for only $19.95/mo for the first 3 months!
>>>>> http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
>>>>> _______________________________________________
>>>>> Gusdev-gusdev mailing list
>>>>> Gus...@li...
>>>>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>>>
>>>>>
>>> Jonathan Schug  -   js...@pc...

Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[Madhura S. <sma...@st...>]

Hi Paul

After reading your email, I setted up Dots.SequenceType tables with required
ds-DNA entries and then tried loading EMBL files again, this time it made
progress, it didn't give "can't fine sequence type ds-DNA" error, but it
went ahead and gave following error:

**********************************************
buildRNA() : DoTS.RNA created.
buildRNAInstance() : $rna_object->getId() =
buildRNAInstance() : Creating brand new RNAInstance
Object type is 'GUS::Model::DoTS::GeneFeature', $object =
GUS::Model::DoTS::Gene
Feature=HASH(0x173113c)
DBD::Oracle::st execute failed: ORA-02291: integrity constraint
(DOTS.NAFEATUREI
MP_FK08) violated - parent key not found (DBD ERROR: OCIStmtExecute) at
/afs/ir/
users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.

 SQL ERROR!! involving

    INSERT INTO DoTS.GeneFeature (  gene_type, row_user_id, user_write,
group_wr
ite, na_sequence_id, row_project_id, name, is_partial, product, is_pseudo,
revie
w_status_id, subclass_view, group_read, row_group_id, other_read,
modification_d
ate, is_predicted, user_read, row_alg_invocation_id, other_write,
na_feature_id,
 number_of_exons )
    VALUES   (  ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, ?, SYSDATE, ?, ?,
?, ?
, ?, ? )
 Values: protein coding, 1, 1, 1, 49, 1, BP0001, 0, glucose inhibited
division p
rotein A, 0, 5, GeneFeature, 1, 1, 1, 1, 1, 99, 0, 1, 1 at
/afs/ir/users/s/m/sma
dhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 185

GUS::ObjRelP::DbiDbHandle::death('GUS::ObjRelP::DbiDbHandle=HASH(0xb791a
8)', '^J SQL ERROR!! involving^J ^J    INSERT INTO DoTS.GeneFeature (
ge...') c
alled at
/afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm l
ine 148
**********************************************

Madhura



----- Original Message ----- 
From: <pj...@sa...>
To: "Madhura Sharangpani" <sma...@st...>
Cc: <gus...@li...>
Sent: Thursday, May 20, 2004 3:25 AM
Subject: Re: [Gusdev-gusdev] Problem loading EMBL files into GUS


> Madhura,
>
> Did you setup the DoTS.SequenceType tables?
> I presume it can't find ds-DNA in there (and doesn't report it - I shall
improve
> the plugin).
> See: GUS/Website/htdocs/documentation/installguide_UGA.html
> and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
ds-DNA,
> ss-RNA etc. I'm guessing we used those statements here at Sanger.
>
> All,
>
> On a slightly related note, I do have a collection of XML files that
populate
> dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
Someone
> emailed the list and said it would be good to have this somewhere, perhaps
CVS.
> I agree, although we would need to have "common" and "center specific"
> dirctories. I am in the process of setting up a new GUS instance so I will
soon
> be in a better position to propose something.
>
> Paul.
>
> Quoting Madhura Sharangpani <sma...@st...>:
>
> > Hi All
> >
> > I am trying to load EMBL files into GUS, but having some problems,
> > when I try to execute the command :
> >
> > ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> > -filepath=b.pertussis.embl -sequencetype=ds-DNA
> >
> > without commit, I get the following error:
> >
> > *********************************************************
> > ***COMMIT TURNED OFF***
> > Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> >
> > embl file to parse, b.bronchiseptica.embl...
> > ID line fine!!!
> > source feature found, FT   source          1..5339179!!
> > processing bioperl sequence, BB...
> > sequence not in GUS yet
> > can't find SequenceType, ds-DNA
> > number of features = 5009
> > organism, taxon id: Bordetella bronchiseptica,
> > DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> > ("DOTS"."NASE
> > QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> > /afs/ir/users/s/m/
> > smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> >
> > (after this along sequence is printed)
> >
> >
ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGC
TCTT
> > TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
1825282,
> > 0
> > at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
line
> > 18
> > 5
> >
> >
***************************************************************************
> > Can someone tell me why this error is occuring?
> >
> > Thanks!
> >
> > Madhura
> >
>
>
>

[Gusdev-gusdev] Sequencetype Table

[jinal j. <jh...@us...>]

Hi,

Can anyone explain what the subtype,hierarchy,strand field means in dots.sequencetype table

I am planning to load 4 replicons of agrobacterium out of which

1 is circular dna
1 is linear dna
2 are cirular plasmid (with names At and Ti)

so do you think this categorization is OK

#  NUCLEOTIDE_TYPE  SUB_TYPE  PARENT_SEQUENCE_TYPE_ID hierarchy  strand   name

1) DNA              null       null                     ??         ??      DNA
2) DNA              circular   1                        ??         ??      Cir DNA
3) DNA              linear     1                        ??         ??      Lin DNA
4) Plasmid          circular       1                    ??         ??     At-Plasmid
5) Plasmid          circular       1                    ??         ??     Ti-Plasmid


Can 4 and 5 be represented as one entry (both have same types. Just the names are different)? Is strand field for ss/ds or +/-???? My guess is that it should be for ss/ds but I thought it would be great to get other ideas from this group.

thanks for your help...

--Jinal

p.s Sorry for bombarding this group with questions, but I really wanted to clarify how the whole thing works together with its dependencies, before loading the sequences. I looked at the Schema Browser but I didn't see much description of these fields

Re: [Gusdev-gusdev] GBParser

[Steve F. <sfi...@pc...>]

ok, i looked into this.   the algoinvo arg is a bit arcane.   ignore 
it.    (whenever a plugin is run we track that fact in GUS.  that is 
done with the AlgorithmInvocation tables among others.  this arg allows 
you to restart a run of the plugin and have it be identified as a part 
of its original AlgorithmInvocation).

steve

MICHAEL LUCHTAN wrote:

>Well, good thing I already loaded our data!  Guess we need to update CVS.
>
>Michael Luchtan
>http://www.cs.uga.edu/~luchtan
>
>
>On Thu, 20 May 2004, jinal jhaveri wrote:
>
>  
>
>>I am using CVS Version 1.30
>>
>>----- Original Message -----
>>From: MICHAEL LUCHTAN <lu...@cs...>
>>Date: Thursday, May 20, 2004 6:21 am
>>Subject: Re: [Gusdev-gusdev] GBParser
>>
>>    
>>
>>>Actually I answered the second question.  But I was willing to give a try
>>>at the third.  But upon looking at my GBParser module, there IS NO
>>>arguement for algoinvo.  I have CVS version 1.17.  Jinal, what are you
>>>running?  Unfortunately, I can't remember if we modified these here or
>>>not, but I don't think that we did.  Here is our module, attached.
>>>
>>>
>>>Michael Luchtan
>>>http://www.cs.uga.edu/~luchtan
>>>
>>>
>>>On Thu, 20 May 2004, Steve Fischer wrote:
>>>
>>>      
>>>
>>>>jinal-
>>>>
>>>>see below
>>>>
>>>>jinal jhaveri wrote:
>>>>
>>>>        
>>>>
>>>>>Hi,
>>>>>
>>>>>I have some questions regarding the GBParser module
>>>>>
>>>>>1) First required field  is --gbRel. As I understand this is genbank's
>>>>>          
>>>>>
>>>db realease id. Now where do I get this number from? ( genbanks
>>>website????) Does anybody has idea about what is the release right now on web?
>>>      
>>>
>>>>>          
>>>>>
>>>>yes, this is from the readme file .   it is stored in GUS in the
>>>>created_rel_ver and updated_rel_ver attributes of the DoTS::NAEntry table:
>>>>http://www.gusdb.org/cgi-
>>>>        
>>>>
>>>bin/schemaBrowser?db=CBILBLD&table=DoTS::NAEntry&path=DoTS::NAEntry>
>>>      
>>>
>>>>>2) --db_rel_id : As the documentation describes, this is external
>>>>>          
>>>>>
>>>database id. Do I create this id on my own? Do I need to keep this entry
>>>in any other table? Does this id has one to one correspondence with the
>>>project I am working on (and the one I described in my .gus.properties file?)
>>>      
>>>
>>>>gus is strict about its data.   we track pretty much everything.  so,
>>>>for example, in order to put data in from an external database, or, to
>>>>mention source ids of an external database, the external database must
>>>>be known by gus.   the two tables that hold this are:
>>>>SRes.ExternalDatabase and SRes.ExternalDatabaseRelease.  The former
>>>>describes the DB, the latter the particular release of the DB, and it
>>>>points back to the former.   The GBParser is asking you for a primary
>>>>key in the ExternalDatabaseRelease table so that all the data you load
>>>>will be associated with it.
>>>>
>>>>in the case of GenBank, we at cbil only store one version of it, which
>>>>we update periodically.  so, for it, we set the 'version' attribute to
>>>>"continuous."   for other DBs, we store multiple copies.  in that case
>>>>we use a real version number, and create a new ExternalDatabaseRelease
>>>>row each time we load a new one in.
>>>>
>>>>one of the known weaknesses of the current GUS install process is that
>>>>we don't provide a bunch of standard databases as part of the data that
>>>>we load to get you off the ground.   but, paul mooney has been handing
>>>>out an xml file which you can load with the UpdateGusFromXML plugin.
>>>>his mail is pj...@sa...
>>>>
>>>>that file only works for databases that you will only maintain one
>>>>release of.   if you want to load multiple versions of a db (eg, pfam),
>>>>you will need to add new rows.
>>>>
>>>>        
>>>>
>>>>>3) --algoinvo=s: What is this? (I looked at the docs but they talk
>>>>>          
>>>>>
>>>about some invocation id. Is this to change the algorithm to be invoked?)
>>>      
>>>
>>>>>
>>>>>          
>>>>>
>>>>i see that michael answered this
>>>>
>>>>        
>>>>
>>>>>Any help will be really appreciated
>>>>>
>>>>>
>>>>>thanks
>>>>>--Jinal
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>
>>>>>-------------------------------------------------------
>>>>>This SF.Net email is sponsored by: SourceForge.net Broadband
>>>>>Sign-up now for SourceForge Broadband and get the fastest
>>>>>6.0/768 connection for only $19.95/mo for the first 3 months!
>>>>>http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
>>>>>_______________________________________________
>>>>>Gusdev-gusdev mailing list
>>>>>Gus...@li...
>>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>>>
>>>>>
>>>>>          
>>>>>
>>>>
>>>>-------------------------------------------------------
>>>>This SF.Net email is sponsored by: Oracle 10g
>>>>Get certified on the hottest thing ever to hit the market... Oracle 10g.
>>>>Take an Oracle 10g class now, and we'll give you the exam FREE.
>>>>http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
>>>>_______________________________________________
>>>>Gusdev-gusdev mailing list
>>>>Gus...@li...
>>>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>>
>>>>        
>>>>
>>-------------------------------------------------------
>>This SF.Net email is sponsored by: Oracle 10g
>>Get certified on the hottest thing ever to hit the market... Oracle 10g.
>>Take an Oracle 10g class now, and we'll give you the exam FREE.
>>http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
>>_______________________________________________
>>Gusdev-gusdev mailing list
>>Gus...@li...
>>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>
>>    
>>
>
>
>
>-------------------------------------------------------
>This SF.Net email is sponsored by: Oracle 10g
>Get certified on the hottest thing ever to hit the market... Oracle 10g. 
>Take an Oracle 10g class now, and we'll give you the exam FREE.
>http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] GBParser

[MICHAEL L. <lu...@cs...>]

Well, good thing I already loaded our data!  Guess we need to update CVS.

Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Thu, 20 May 2004, jinal jhaveri wrote:

> I am using CVS Version 1.30
>
> ----- Original Message -----
> From: MICHAEL LUCHTAN <lu...@cs...>
> Date: Thursday, May 20, 2004 6:21 am
> Subject: Re: [Gusdev-gusdev] GBParser
>
> > Actually I answered the second question.  But I was willing to give a try
> > at the third.  But upon looking at my GBParser module, there IS NO
> > arguement for algoinvo.  I have CVS version 1.17.  Jinal, what are you
> > running?  Unfortunately, I can't remember if we modified these here or
> > not, but I don't think that we did.  Here is our module, attached.
> >
> >
> > Michael Luchtan
> > http://www.cs.uga.edu/~luchtan
> >
> >
> > On Thu, 20 May 2004, Steve Fischer wrote:
> >
> > > jinal-
> > >
> > > see below
> > >
> > > jinal jhaveri wrote:
> > >
> > > >Hi,
> > > >
> > > >I have some questions regarding the GBParser module
> > > >
> > > >1) First required field  is --gbRel. As I understand this is genbank's
> > db realease id. Now where do I get this number from? ( genbanks
> > website????) Does anybody has idea about what is the release right now on web?
> > > >
> > > >
> > > yes, this is from the readme file .   it is stored in GUS in the
> > > created_rel_ver and updated_rel_ver attributes of the DoTS::NAEntry table:
> > > http://www.gusdb.org/cgi-
> > bin/schemaBrowser?db=CBILBLD&table=DoTS::NAEntry&path=DoTS::NAEntry>
> > > >2) --db_rel_id : As the documentation describes, this is external
> > database id. Do I create this id on my own? Do I need to keep this entry
> > in any other table? Does this id has one to one correspondence with the
> > project I am working on (and the one I described in my .gus.properties file?)
> > > >
> > > gus is strict about its data.   we track pretty much everything.  so,
> > > for example, in order to put data in from an external database, or, to
> > > mention source ids of an external database, the external database must
> > > be known by gus.   the two tables that hold this are:
> > > SRes.ExternalDatabase and SRes.ExternalDatabaseRelease.  The former
> > > describes the DB, the latter the particular release of the DB, and it
> > > points back to the former.   The GBParser is asking you for a primary
> > > key in the ExternalDatabaseRelease table so that all the data you load
> > > will be associated with it.
> > >
> > > in the case of GenBank, we at cbil only store one version of it, which
> > > we update periodically.  so, for it, we set the 'version' attribute to
> > > "continuous."   for other DBs, we store multiple copies.  in that case
> > > we use a real version number, and create a new ExternalDatabaseRelease
> > > row each time we load a new one in.
> > >
> > > one of the known weaknesses of the current GUS install process is that
> > > we don't provide a bunch of standard databases as part of the data that
> > > we load to get you off the ground.   but, paul mooney has been handing
> > > out an xml file which you can load with the UpdateGusFromXML plugin.
> > > his mail is pj...@sa...
> > >
> > > that file only works for databases that you will only maintain one
> > > release of.   if you want to load multiple versions of a db (eg, pfam),
> > > you will need to add new rows.
> > >
> > > >3) --algoinvo=s: What is this? (I looked at the docs but they talk
> > about some invocation id. Is this to change the algorithm to be invoked?)
> > > >
> > > >
> > > >
> > > i see that michael answered this
> > >
> > > >Any help will be really appreciated
> > > >
> > > >
> > > >thanks
> > > >--Jinal
> > > >
> > > >
> > > >
> > > >
> > > >
> > > >-------------------------------------------------------
> > > >This SF.Net email is sponsored by: SourceForge.net Broadband
> > > >Sign-up now for SourceForge Broadband and get the fastest
> > > >6.0/768 connection for only $19.95/mo for the first 3 months!
> > > >http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
> > > >_______________________________________________
> > > >Gusdev-gusdev mailing list
> > > >Gus...@li...
> > > >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > > >
> > > >
> > >
> > >
> > >
> > > -------------------------------------------------------
> > > This SF.Net email is sponsored by: Oracle 10g
> > > Get certified on the hottest thing ever to hit the market... Oracle 10g.
> > > Take an Oracle 10g class now, and we'll give you the exam FREE.
> > > http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> > > _______________________________________________
> > > Gusdev-gusdev mailing list
> > > Gus...@li...
> > > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > >
> >
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by: Oracle 10g
> Get certified on the hottest thing ever to hit the market... Oracle 10g.
> Take an Oracle 10g class now, and we'll give you the exam FREE.
> http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>

Re: [Gusdev-gusdev] GBParser

[jinal j. <jh...@us...>]

I am using CVS Version 1.30 

----- Original Message -----
From: MICHAEL LUCHTAN <lu...@cs...>
Date: Thursday, May 20, 2004 6:21 am
Subject: Re: [Gusdev-gusdev] GBParser

> Actually I answered the second question.  But I was willing to give a try
> at the third.  But upon looking at my GBParser module, there IS NO
> arguement for algoinvo.  I have CVS version 1.17.  Jinal, what are you
> running?  Unfortunately, I can't remember if we modified these here or
> not, but I don't think that we did.  Here is our module, attached.
> 
> 
> Michael Luchtan
> http://www.cs.uga.edu/~luchtan
> 
> 
> On Thu, 20 May 2004, Steve Fischer wrote:
> 
> > jinal-
> >
> > see below
> >
> > jinal jhaveri wrote:
> >
> > >Hi,
> > >
> > >I have some questions regarding the GBParser module
> > >
> > >1) First required field  is --gbRel. As I understand this is genbank's 
> db realease id. Now where do I get this number from? ( genbanks 
> website????) Does anybody has idea about what is the release right now on web?
> > >
> > >
> > yes, this is from the readme file .   it is stored in GUS in the
> > created_rel_ver and updated_rel_ver attributes of the DoTS::NAEntry table:
> > http://www.gusdb.org/cgi-
> bin/schemaBrowser?db=CBILBLD&table=DoTS::NAEntry&path=DoTS::NAEntry>
> > >2) --db_rel_id : As the documentation describes, this is external 
> database id. Do I create this id on my own? Do I need to keep this entry 
> in any other table? Does this id has one to one correspondence with the 
> project I am working on (and the one I described in my .gus.properties file?)
> > >
> > gus is strict about its data.   we track pretty much everything.  so,
> > for example, in order to put data in from an external database, or, to
> > mention source ids of an external database, the external database must
> > be known by gus.   the two tables that hold this are:
> > SRes.ExternalDatabase and SRes.ExternalDatabaseRelease.  The former
> > describes the DB, the latter the particular release of the DB, and it
> > points back to the former.   The GBParser is asking you for a primary
> > key in the ExternalDatabaseRelease table so that all the data you load
> > will be associated with it.
> >
> > in the case of GenBank, we at cbil only store one version of it, which
> > we update periodically.  so, for it, we set the 'version' attribute to
> > "continuous."   for other DBs, we store multiple copies.  in that case
> > we use a real version number, and create a new ExternalDatabaseRelease
> > row each time we load a new one in.
> >
> > one of the known weaknesses of the current GUS install process is that
> > we don't provide a bunch of standard databases as part of the data that
> > we load to get you off the ground.   but, paul mooney has been handing
> > out an xml file which you can load with the UpdateGusFromXML plugin.
> > his mail is pj...@sa...
> >
> > that file only works for databases that you will only maintain one
> > release of.   if you want to load multiple versions of a db (eg, pfam),
> > you will need to add new rows.
> >
> > >3) --algoinvo=s: What is this? (I looked at the docs but they talk 
> about some invocation id. Is this to change the algorithm to be invoked?)
> > >
> > >
> > >
> > i see that michael answered this
> >
> > >Any help will be really appreciated
> > >
> > >
> > >thanks
> > >--Jinal
> > >
> > >
> > >
> > >
> > >
> > >-------------------------------------------------------
> > >This SF.Net email is sponsored by: SourceForge.net Broadband
> > >Sign-up now for SourceForge Broadband and get the fastest
> > >6.0/768 connection for only $19.95/mo for the first 3 months!
> > >http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
> > >_______________________________________________
> > >Gusdev-gusdev mailing list
> > >Gus...@li...
> > >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> > >
> > >
> >
> >
> >
> > -------------------------------------------------------
> > This SF.Net email is sponsored by: Oracle 10g
> > Get certified on the hottest thing ever to hit the market... Oracle 10g.
> > Take an Oracle 10g class now, and we'll give you the exam FREE.
> > http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> > _______________________________________________
> > Gusdev-gusdev mailing list
> > Gus...@li...
> > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> 

Re: [Gusdev-gusdev] GBParser

[MICHAEL L. <lu...@cs...>]

Actually I answered the second question.  But I was willing to give a try
at the third.  But upon looking at my GBParser module, there IS NO
arguement for algoinvo.  I have CVS version 1.17.  Jinal, what are you
running?  Unfortunately, I can't remember if we modified these here or
not, but I don't think that we did.  Here is our module, attached.


Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Thu, 20 May 2004, Steve Fischer wrote:

> jinal-
>
> see below
>
> jinal jhaveri wrote:
>
> >Hi,
> >
> >I have some questions regarding the GBParser module
> >
> >1) First required field  is --gbRel. As I understand this is genbank's db realease id. Now where do I get this number from? ( genbanks website????) Does anybody has idea about what is the release right now on web?
> >
> >
> yes, this is from the readme file .   it is stored in GUS in the
> created_rel_ver and updated_rel_ver attributes of the DoTS::NAEntry table:
> http://www.gusdb.org/cgi-bin/schemaBrowser?db=CBILBLD&table=DoTS::NAEntry&path=DoTS::NAEntry
>
> >2) --db_rel_id : As the documentation describes, this is external database id. Do I create this id on my own? Do I need to keep this entry in any other table? Does this id has one to one correspondence with the project I am working on (and the one I described in my .gus.properties file?)
> >
> gus is strict about its data.   we track pretty much everything.  so,
> for example, in order to put data in from an external database, or, to
> mention source ids of an external database, the external database must
> be known by gus.   the two tables that hold this are:
> SRes.ExternalDatabase and SRes.ExternalDatabaseRelease.  The former
> describes the DB, the latter the particular release of the DB, and it
> points back to the former.   The GBParser is asking you for a primary
> key in the ExternalDatabaseRelease table so that all the data you load
> will be associated with it.
>
> in the case of GenBank, we at cbil only store one version of it, which
> we update periodically.  so, for it, we set the 'version' attribute to
> "continuous."   for other DBs, we store multiple copies.  in that case
> we use a real version number, and create a new ExternalDatabaseRelease
> row each time we load a new one in.
>
> one of the known weaknesses of the current GUS install process is that
> we don't provide a bunch of standard databases as part of the data that
> we load to get you off the ground.   but, paul mooney has been handing
> out an xml file which you can load with the UpdateGusFromXML plugin.
> his mail is pj...@sa...
>
> that file only works for databases that you will only maintain one
> release of.   if you want to load multiple versions of a db (eg, pfam),
> you will need to add new rows.
>
> >3) --algoinvo=s: What is this? (I looked at the docs but they talk about some invocation id. Is this to change the algorithm to be invoked?)
> >
> >
> >
> i see that michael answered this
>
> >Any help will be really appreciated
> >
> >
> >thanks
> >--Jinal
> >
> >
> >
> >
> >
> >-------------------------------------------------------
> >This SF.Net email is sponsored by: SourceForge.net Broadband
> >Sign-up now for SourceForge Broadband and get the fastest
> >6.0/768 connection for only $19.95/mo for the first 3 months!
> >http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> >
>
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by: Oracle 10g
> Get certified on the hottest thing ever to hit the market... Oracle 10g.
> Take an Oracle 10g class now, and we'll give you the exam FREE.
> http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>

Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[MICHAEL L. <lu...@cs...>]

I've encountered this SequenceType problem before also.  Some plug-ins
have database specific arguements in them regarding this table.
In my opinion it is another prime candidate for a "common" xml
instantiation file.
Maybe we should start making a list/asking for candidates of tables that
are common enough/generic enough to be used by everyone?

Michael Luchtan
http://www.cs.uga.edu/~luchtan


On Thu, 20 May 2004, Steve Fischer wrote:

> paul-
>
> the xml files would be very helpful.   a cbil, we are about to setup a
> new instance... on PostgreSQL.    this will be our first new instance in
> years, so we'll also be trying to compile docs and data.
>
> steve
>
> pj...@sa... wrote:
>
> >Madhura,
> >
> >Did you setup the DoTS.SequenceType tables?
> >I presume it can't find ds-DNA in there (and doesn't report it - I shall improve
> >the plugin).
> >See: GUS/Website/htdocs/documentation/installguide_UGA.html
> >and do a search for ds-DNA to find all the INSERT statements for ss-DNA, ds-DNA,
> >ss-RNA etc. I'm guessing we used those statements here at Sanger.
> >
> >All,
> >
> >On a slightly related note, I do have a collection of XML files that populate
> >dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. Someone
> >emailed the list and said it would be good to have this somewhere, perhaps CVS.
> >I agree, although we would need to have "common" and "center specific"
> >dirctories. I am in the process of setting up a new GUS instance so I will soon
> >be in a better position to propose something.
> >
> >Paul.
> >
> >Quoting Madhura Sharangpani <sma...@st...>:
> >
> >
> >
> >>Hi All
> >>
> >>I am trying to load EMBL files into GUS, but having some problems,
> >>when I try to execute the command :
> >>
> >>ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> >>-filepath=b.pertussis.embl -sequencetype=ds-DNA
> >>
> >>without commit, I get the following error:
> >>
> >>*********************************************************
> >>***COMMIT TURNED OFF***
> >>Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> >>
> >>embl file to parse, b.bronchiseptica.embl...
> >>ID line fine!!!
> >>source feature found, FT   source          1..5339179!!
> >>processing bioperl sequence, BB...
> >>sequence not in GUS yet
> >>can't find SequenceType, ds-DNA
> >>number of features = 5009
> >>organism, taxon id: Bordetella bronchiseptica,
> >>DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> >>("DOTS"."NASE
> >>QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> >>/afs/ir/users/s/m/
> >>smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> >>
> >>(after this along sequence is printed)
> >>
> >>ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
> >>TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, 1825282,
> >>0
> >>at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> >>18
> >>5
> >>
> >>***************************************************************************
> >>Can someone tell me why this error is occuring?
> >>
> >>Thanks!
> >>
> >>Madhura
> >>
> >>
> >>
> >
> >
> >
> >
> >
> >-------------------------------------------------------
> >This SF.Net email is sponsored by: Oracle 10g
> >Get certified on the hottest thing ever to hit the market... Oracle 10g.
> >Take an Oracle 10g class now, and we'll give you the exam FREE.
> >http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> >_______________________________________________
> >Gusdev-gusdev mailing list
> >Gus...@li...
> >https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> >
>

[Gusdev-gusdev] GUS Grant - need your help

[Steve F. <st...@pc...>]

Folks-

We have until tomorrow to submit a supplement describing recent progress 
with GUS.

I would like to include in the supplement major milestones of our 
users.   Can you please send me, as soon as possible, a description of 
important successes you have had, particularly in the last 3 months.

Thanks,
Steve

Re: [Gusdev-gusdev] amino acid data upload to GUS

[Bindu G. <bi...@pc...>]

hi Sucheta -
Sorry to say, but we do not have a plugin that is ready to use.
we use the plugin:  ImportPlasmoDBAAFeatures.pm
however, i must warn you that this is a in-house plugin, which is very
specific to plasmodium data, and not free from hard-coded values.
it takes tab-delimited text input i believe. also, this plugin has gone
further iterations since the last commit to sanger cvs.

Bindu


On May 20, 2004, at 8:02 AM, Sucheta Tripathy wrote:

> Hi Bindu,
>
> Thanks, Do you use any plugin for this or you do direct upload.
>
> Sucheta
>
>> HI Sucheta -
>> We load glimmer, phat and genefinder predictions of plasmodium in
>> dots.GeneFeature.
>>
>> Bindu
>>
>>
>> On May 19, 2004, at 4:46 PM, Sucheta Tripathy wrote:
>>
>>> Hello,
>>>
>>> One more question. Does anyone stores the outputs from each gene
>>> calling
>>> program e.g; genmark, glimmer, genscan, fgenesh etc.. If yes, which 
>>> is
>>> the
>>> right table for this?
>>>
>>> Sucheta
>>>
>>>> Take a look at InsertNewExternalSequences, it is quite flexible and
>>>> may do
>>>> what you want.
>>>>
>>>>                                                  Debbie
>>>>
>>>>
>>>>
>>>>
>>>> On Tue, 18 May 2004, Sucheta Tripathy wrote:
>>>>
>>>>> Hi Debbie,
>>>>>
>>>>> We have protein data after using the gene calls. These are present 
>>>>> in
>>>>> raw
>>>>> fasta format. To these sequences we did the signalP analysis and
>>>>> other
>>>>> annotation. I saw the table format and we can easily parse them 
>>>>> onto
>>>>> the
>>>>> column names, but I was wondering before that I need to put them 
>>>>> onto
>>>>> aasequenceImp table. So I thought if I can put my raw protein
>>>>> sequences
>>>>> to
>>>>> the table with some plugin.
>>>>>
>>>>> Thanks
>>>>>
>>>>> Sucheta
>>>>>> Hi Sucheta,
>>>>>>
>>>>>>
>>>>>> What is the data that you want to load? It is hard to answer the
>>>>> question
>>>>>> generally.
>>>>>>
>>>>>> As you probably know already we load data from the protein nr
>>>>>> database
>>>>>> files from NCBI and protein motif data from prodom and cdd. Those
>>>>>> are
>>>>>> loaded with LoadNRDB.pm (written specifically for NCBI nrdb 
>>>>>> protein
>>>>> data)
>>>>>> and InsertNewExternalSequences.
>>>>>>
>>>>>> We also load signal peptide and transmembrane results from the
>>>>> analysis
>>>>>> of our assemblies. Those plugins are not in cvs repository at 
>>>>>> Sanger
>>>>> and
>>>>>> may not be appropriate for your use.
>>>>>>
>>>>>>                                                         Debbie
>>>>>> On Tue, 18 May 2004, Sucheta Tripathy
>>>>>> wrote:
>>>>>>
>>>>>>>
>>>>>>> Hello All,
>>>>>>>
>>>>>>> Has anyone tried uploading amino acid related data to GUS(mainly 
>>>>>>> to
>>>>>>> aasequenceImp  and related tables). Is there a plugin for that? I
>>>>> have
>>>>>>> lots of amino acid related data like the signalP output and other
>>>>>>> annotations.
>>>>>>>
>>>>>>> Any suggestions?
>>>>>>>
>>>>>>> Thanks
>>>>>>>
>>>>>>> Sucheta
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>>
>>>>
>>>> -------------------------------------------------------
>>>> This SF.Net email is sponsored by: SourceForge.net Broadband
>>>> Sign-up now for SourceForge Broadband and get the fastest
>>>> 6.0/768 connection for only $19.95/mo for the first 3 months!
>>>> http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
>>>> _______________________________________________
>>>> Gusdev-gusdev mailing list
>>>> Gus...@li...
>>>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>>
>>>
>>>
>>> --
>>> Sucheta Tripathy
>>> Virginia Bioinformatics Institute Phase-I
>>> Washington street.
>>> Virginia Tech.
>>> Blacksburg,VA 24061-0447
>>> phone:(540)231-8138
>>> Fax:  (540) 231-2606
>>>
>>>
>>> -------------------------------------------------------
>>> This SF.Net email is sponsored by: SourceForge.net Broadband
>>> Sign-up now for SourceForge Broadband and get the fastest
>>> 6.0/768 connection for only $19.95/mo for the first 3 months!
>>> http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
>>> _______________________________________________
>>> Gusdev-gusdev mailing list
>>> Gus...@li...
>>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>
>
>
> -- 
> Sucheta Tripathy
> Virginia Bioinformatics Institute Phase-I
> Washington street.
> Virginia Tech.
> Blacksburg,VA 24061-0447
> phone:(540)231-8138
> Fax:  (540) 231-2606

Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[<pj...@sa...>]

Quoting Sucheta Tripathy <su...@vb...>:

> Hi,
> 
> Does it mean that GenericParser2GUS can upload data from signalP, TMHMM
> and other data?

As long as the data is in an EMBL file.
In theory it could be any file Bioperl understands though but this has not been
tested.

> Thanks
> 
> Sucheta
> >
> > Did you setup the DoTS.SequenceType tables?
> > I presume it can't find ds-DNA in there (and doesn't report it - I shall
> > improve
> > the plugin).
> > See: GUS/Website/htdocs/documentation/installguide_UGA.html
> > and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
> > ds-DNA,
> > ss-RNA etc. I'm guessing we used those statements here at Sanger.
> >
> > All,
> >
> > On a slightly related note, I do have a collection of XML files that
> > populate
> > dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
> > Someone
> > emailed the list and said it would be good to have this somewhere, perhaps
> > CVS.
> > I agree, although we would need to have "common" and "center specific"
> > dirctories. I am in the process of setting up a new GUS instance so I will
> > soon
> > be in a better position to propose something.
> >
> > Paul.
> >
> > Quoting Madhura Sharangpani <sma...@st...>:
> >
> >> Hi All
> >>
> >> I am trying to load EMBL files into GUS, but having some problems,
> >> when I try to execute the command :
> >>
> >> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> >> -filepath=b.pertussis.embl -sequencetype=ds-DNA
> >>
> >> without commit, I get the following error:
> >>
> >> *********************************************************
> >> ***COMMIT TURNED OFF***
> >> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> >>
> >> embl file to parse, b.bronchiseptica.embl...
> >> ID line fine!!!
> >> source feature found, FT   source          1..5339179!!
> >> processing bioperl sequence, BB...
> >> sequence not in GUS yet
> >> can't find SequenceType, ds-DNA
> >> number of features = 5009
> >> organism, taxon id: Bordetella bronchiseptica,
> >> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> >> ("DOTS"."NASE
> >> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> >> /afs/ir/users/s/m/
> >> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> >>
> >> (after this along sequence is printed)
> >>
> >>
> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
> >> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
> >> 1825282,
> >> 0
> >> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
> >> line
> >> 18
> >> 5
> >>
> >>
> ***************************************************************************
> >> Can someone tell me why this error is occuring?
> >>
> >> Thanks!
> >>
> >> Madhura
> >>
> >
> >
> >
> >
> >
> > -------------------------------------------------------
> > This SF.Net email is sponsored by: Oracle 10g
> > Get certified on the hottest thing ever to hit the market... Oracle 10g.
> > Take an Oracle 10g class now, and we'll give you the exam FREE.
> > http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> > _______________________________________________
> > Gusdev-gusdev mailing list
> > Gus...@li...
> > https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
> >
> 
> 
> -- 
> Sucheta Tripathy
> Virginia Bioinformatics Institute Phase-I
> Washington street.
> Virginia Tech.
> Blacksburg,VA 24061-0447
> phone:(540)231-8138
> Fax:  (540) 231-2606
> 

Re: [Gusdev-gusdev] GBParser

[Steve F. <st...@pc...>]

jinal-

see below

jinal jhaveri wrote:

>Hi,
>
>I have some questions regarding the GBParser module 
>
>1) First required field  is --gbRel. As I understand this is genbank's db realease id. Now where do I get this number from? ( genbanks website????) Does anybody has idea about what is the release right now on web?
>  
>
yes, this is from the readme file .   it is stored in GUS in the 
created_rel_ver and updated_rel_ver attributes of the DoTS::NAEntry table:
http://www.gusdb.org/cgi-bin/schemaBrowser?db=CBILBLD&table=DoTS::NAEntry&path=DoTS::NAEntry

>2) --db_rel_id : As the documentation describes, this is external database id. Do I create this id on my own? Do I need to keep this entry in any other table? Does this id has one to one correspondence with the project I am working on (and the one I described in my .gus.properties file?)
>
gus is strict about its data.   we track pretty much everything.  so, 
for example, in order to put data in from an external database, or, to 
mention source ids of an external database, the external database must 
be known by gus.   the two tables that hold this are: 
SRes.ExternalDatabase and SRes.ExternalDatabaseRelease.  The former 
describes the DB, the latter the particular release of the DB, and it 
points back to the former.   The GBParser is asking you for a primary 
key in the ExternalDatabaseRelease table so that all the data you load 
will be associated with it.

in the case of GenBank, we at cbil only store one version of it, which 
we update periodically.  so, for it, we set the 'version' attribute to 
"continuous."   for other DBs, we store multiple copies.  in that case 
we use a real version number, and create a new ExternalDatabaseRelease 
row each time we load a new one in.

one of the known weaknesses of the current GUS install process is that 
we don't provide a bunch of standard databases as part of the data that 
we load to get you off the ground.   but, paul mooney has been handing 
out an xml file which you can load with the UpdateGusFromXML plugin.   
his mail is pj...@sa...

that file only works for databases that you will only maintain one 
release of.   if you want to load multiple versions of a db (eg, pfam), 
you will need to add new rows.

>3) --algoinvo=s: What is this? (I looked at the docs but they talk about some invocation id. Is this to change the algorithm to be invoked?)
>
>  
>
i see that michael answered this

>Any help will be really appreciated
>
>
>thanks
>--Jinal
>
>
>
>
>
>-------------------------------------------------------
>This SF.Net email is sponsored by: SourceForge.net Broadband
>Sign-up now for SourceForge Broadband and get the fastest
>6.0/768 connection for only $19.95/mo for the first 3 months!
>http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[Sucheta T. <su...@vb...>]

Hi,

Does it mean that GenericParser2GUS can upload data from signalP, TMHMM
and other data?

Thanks

Sucheta
>
> Did you setup the DoTS.SequenceType tables?
> I presume it can't find ds-DNA in there (and doesn't report it - I shall
> improve
> the plugin).
> See: GUS/Website/htdocs/documentation/installguide_UGA.html
> and do a search for ds-DNA to find all the INSERT statements for ss-DNA,
> ds-DNA,
> ss-RNA etc. I'm guessing we used those statements here at Sanger.
>
> All,
>
> On a slightly related note, I do have a collection of XML files that
> populate
> dictionary tables such as ExternalDatabase, ExternalDatabaseRelease.
> Someone
> emailed the list and said it would be good to have this somewhere, perhaps
> CVS.
> I agree, although we would need to have "common" and "center specific"
> dirctories. I am in the process of setting up a new GUS instance so I will
> soon
> be in a better position to propose something.
>
> Paul.
>
> Quoting Madhura Sharangpani <sma...@st...>:
>
>> Hi All
>>
>> I am trying to load EMBL files into GUS, but having some problems,
>> when I try to execute the command :
>>
>> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
>> -filepath=b.pertussis.embl -sequencetype=ds-DNA
>>
>> without commit, I get the following error:
>>
>> *********************************************************
>> ***COMMIT TURNED OFF***
>> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
>>
>> embl file to parse, b.bronchiseptica.embl...
>> ID line fine!!!
>> source feature found, FT   source          1..5339179!!
>> processing bioperl sequence, BB...
>> sequence not in GUS yet
>> can't find SequenceType, ds-DNA
>> number of features = 5009
>> organism, taxon id: Bordetella bronchiseptica,
>> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
>> ("DOTS"."NASE
>> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
>> /afs/ir/users/s/m/
>> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
>>
>> (after this along sequence is printed)
>>
>> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
>> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86,
>> 1825282,
>> 0
>> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm
>> line
>> 18
>> 5
>>
>> ***************************************************************************
>> Can someone tell me why this error is occuring?
>>
>> Thanks!
>>
>> Madhura
>>
>
>
>
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by: Oracle 10g
> Get certified on the hottest thing ever to hit the market... Oracle 10g.
> Take an Oracle 10g class now, and we'll give you the exam FREE.
> http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>


-- 
Sucheta Tripathy
Virginia Bioinformatics Institute Phase-I
Washington street.
Virginia Tech.
Blacksburg,VA 24061-0447
phone:(540)231-8138
Fax:  (540) 231-2606

Re: [Gusdev-gusdev] amino acid data upload to GUS

[Sucheta T. <su...@vb...>]

Hi Bindu,

Thanks, Do you use any plugin for this or you do direct upload.

Sucheta

> HI Sucheta -
> We load glimmer, phat and genefinder predictions of plasmodium in
> dots.GeneFeature.
>
> Bindu
>
>
> On May 19, 2004, at 4:46 PM, Sucheta Tripathy wrote:
>
>> Hello,
>>
>> One more question. Does anyone stores the outputs from each gene
>> calling
>> program e.g; genmark, glimmer, genscan, fgenesh etc.. If yes, which is
>> the
>> right table for this?
>>
>> Sucheta
>>
>>> Take a look at InsertNewExternalSequences, it is quite flexible and
>>> may do
>>> what you want.
>>>
>>>                                                  Debbie
>>>
>>>
>>>
>>>
>>> On Tue, 18 May 2004, Sucheta Tripathy wrote:
>>>
>>>> Hi Debbie,
>>>>
>>>> We have protein data after using the gene calls. These are present in
>>>> raw
>>>> fasta format. To these sequences we did the signalP analysis and
>>>> other
>>>> annotation. I saw the table format and we can easily parse them onto
>>>> the
>>>> column names, but I was wondering before that I need to put them onto
>>>> aasequenceImp table. So I thought if I can put my raw protein
>>>> sequences
>>>> to
>>>> the table with some plugin.
>>>>
>>>> Thanks
>>>>
>>>> Sucheta
>>>>> Hi Sucheta,
>>>>>
>>>>>
>>>>> What is the data that you want to load? It is hard to answer the
>>>> question
>>>>> generally.
>>>>>
>>>>> As you probably know already we load data from the protein nr
>>>>> database
>>>>> files from NCBI and protein motif data from prodom and cdd. Those
>>>>> are
>>>>> loaded with LoadNRDB.pm (written specifically for NCBI nrdb protein
>>>> data)
>>>>> and InsertNewExternalSequences.
>>>>>
>>>>> We also load signal peptide and transmembrane results from the
>>>> analysis
>>>>> of our assemblies. Those plugins are not in cvs repository at Sanger
>>>> and
>>>>> may not be appropriate for your use.
>>>>>
>>>>>                                                         Debbie
>>>>> On Tue, 18 May 2004, Sucheta Tripathy
>>>>> wrote:
>>>>>
>>>>>>
>>>>>> Hello All,
>>>>>>
>>>>>> Has anyone tried uploading amino acid related data to GUS(mainly to
>>>>>> aasequenceImp  and related tables). Is there a plugin for that? I
>>>> have
>>>>>> lots of amino acid related data like the signalP output and other
>>>>>> annotations.
>>>>>>
>>>>>> Any suggestions?
>>>>>>
>>>>>> Thanks
>>>>>>
>>>>>> Sucheta
>>>>>>
>>>>>>
>>>>>>
>>>>>>
>>>>>
>>>>
>>>>
>>>>
>>>
>>>
>>>
>>> -------------------------------------------------------
>>> This SF.Net email is sponsored by: SourceForge.net Broadband
>>> Sign-up now for SourceForge Broadband and get the fastest
>>> 6.0/768 connection for only $19.95/mo for the first 3 months!
>>> http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
>>> _______________________________________________
>>> Gusdev-gusdev mailing list
>>> Gus...@li...
>>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>>
>>
>>
>> --
>> Sucheta Tripathy
>> Virginia Bioinformatics Institute Phase-I
>> Washington street.
>> Virginia Tech.
>> Blacksburg,VA 24061-0447
>> phone:(540)231-8138
>> Fax:  (540) 231-2606
>>
>>
>> -------------------------------------------------------
>> This SF.Net email is sponsored by: SourceForge.net Broadband
>> Sign-up now for SourceForge Broadband and get the fastest
>> 6.0/768 connection for only $19.95/mo for the first 3 months!
>> http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
>> _______________________________________________
>> Gusdev-gusdev mailing list
>> Gus...@li...
>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>


-- 
Sucheta Tripathy
Virginia Bioinformatics Institute Phase-I
Washington street.
Virginia Tech.
Blacksburg,VA 24061-0447
phone:(540)231-8138
Fax:  (540) 231-2606

Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[Steve F. <st...@pc...>]

paul-

the xml files would be very helpful.   a cbil, we are about to setup a 
new instance... on PostgreSQL.    this will be our first new instance in 
years, so we'll also be trying to compile docs and data.

steve

pj...@sa... wrote:

>Madhura,
>
>Did you setup the DoTS.SequenceType tables?
>I presume it can't find ds-DNA in there (and doesn't report it - I shall improve
>the plugin).
>See: GUS/Website/htdocs/documentation/installguide_UGA.html
>and do a search for ds-DNA to find all the INSERT statements for ss-DNA, ds-DNA,
>ss-RNA etc. I'm guessing we used those statements here at Sanger.
>
>All,
>
>On a slightly related note, I do have a collection of XML files that populate
>dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. Someone
>emailed the list and said it would be good to have this somewhere, perhaps CVS.
>I agree, although we would need to have "common" and "center specific"
>dirctories. I am in the process of setting up a new GUS instance so I will soon
>be in a better position to propose something.
>
>Paul.
>
>Quoting Madhura Sharangpani <sma...@st...>:
>
>  
>
>>Hi All
>>
>>I am trying to load EMBL files into GUS, but having some problems,
>>when I try to execute the command :
>>
>>ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
>>-filepath=b.pertussis.embl -sequencetype=ds-DNA
>>
>>without commit, I get the following error:
>>
>>*********************************************************
>>***COMMIT TURNED OFF***
>>Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
>>
>>embl file to parse, b.bronchiseptica.embl...
>>ID line fine!!!
>>source feature found, FT   source          1..5339179!!
>>processing bioperl sequence, BB...
>>sequence not in GUS yet
>>can't find SequenceType, ds-DNA
>>number of features = 5009
>>organism, taxon id: Bordetella bronchiseptica,
>>DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
>>("DOTS"."NASE
>>QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
>>/afs/ir/users/s/m/
>>smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
>>
>>(after this along sequence is printed)
>>
>>ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
>>TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, 1825282,
>>0
>>at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
>>18
>>5
>>        
>>***************************************************************************
>>Can someone tell me why this error is occuring?
>>
>>Thanks!
>>
>>Madhura
>>
>>    
>>
>
>
>
>
>
>-------------------------------------------------------
>This SF.Net email is sponsored by: Oracle 10g
>Get certified on the hottest thing ever to hit the market... Oracle 10g. 
>Take an Oracle 10g class now, and we'll give you the exam FREE.
>http://ads.osdn.com/?ad_id=3149&alloc_id=8166&op=click
>_______________________________________________
>Gusdev-gusdev mailing list
>Gus...@li...
>https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>  
>

Re: [Gusdev-gusdev] amino acid data upload to GUS

[Bindu G. <bi...@pc...>]

HI Sucheta -
We load glimmer, phat and genefinder predictions of plasmodium in 
dots.GeneFeature.

Bindu


On May 19, 2004, at 4:46 PM, Sucheta Tripathy wrote:

> Hello,
>
> One more question. Does anyone stores the outputs from each gene 
> calling
> program e.g; genmark, glimmer, genscan, fgenesh etc.. If yes, which is 
> the
> right table for this?
>
> Sucheta
>
>> Take a look at InsertNewExternalSequences, it is quite flexible and 
>> may do
>> what you want.
>>
>>                                                  Debbie
>>
>>
>>
>>
>> On Tue, 18 May 2004, Sucheta Tripathy wrote:
>>
>>> Hi Debbie,
>>>
>>> We have protein data after using the gene calls. These are present in
>>> raw
>>> fasta format. To these sequences we did the signalP analysis and 
>>> other
>>> annotation. I saw the table format and we can easily parse them onto 
>>> the
>>> column names, but I was wondering before that I need to put them onto
>>> aasequenceImp table. So I thought if I can put my raw protein 
>>> sequences
>>> to
>>> the table with some plugin.
>>>
>>> Thanks
>>>
>>> Sucheta
>>>> Hi Sucheta,
>>>>
>>>>
>>>> What is the data that you want to load? It is hard to answer the
>>> question
>>>> generally.
>>>>
>>>> As you probably know already we load data from the protein nr 
>>>> database
>>>> files from NCBI and protein motif data from prodom and cdd. Those 
>>>> are
>>>> loaded with LoadNRDB.pm (written specifically for NCBI nrdb protein
>>> data)
>>>> and InsertNewExternalSequences.
>>>>
>>>> We also load signal peptide and transmembrane results from the
>>> analysis
>>>> of our assemblies. Those plugins are not in cvs repository at Sanger
>>> and
>>>> may not be appropriate for your use.
>>>>
>>>>                                                         Debbie
>>>> On Tue, 18 May 2004, Sucheta Tripathy
>>>> wrote:
>>>>
>>>>>
>>>>> Hello All,
>>>>>
>>>>> Has anyone tried uploading amino acid related data to GUS(mainly to
>>>>> aasequenceImp  and related tables). Is there a plugin for that? I
>>> have
>>>>> lots of amino acid related data like the signalP output and other
>>>>> annotations.
>>>>>
>>>>> Any suggestions?
>>>>>
>>>>> Thanks
>>>>>
>>>>> Sucheta
>>>>>
>>>>>
>>>>>
>>>>>
>>>>
>>>
>>>
>>>
>>
>>
>>
>> -------------------------------------------------------
>> This SF.Net email is sponsored by: SourceForge.net Broadband
>> Sign-up now for SourceForge Broadband and get the fastest
>> 6.0/768 connection for only $19.95/mo for the first 3 months!
>> http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
>> _______________________________________________
>> Gusdev-gusdev mailing list
>> Gus...@li...
>> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev
>>
>
>
> -- 
> Sucheta Tripathy
> Virginia Bioinformatics Institute Phase-I
> Washington street.
> Virginia Tech.
> Blacksburg,VA 24061-0447
> phone:(540)231-8138
> Fax:  (540) 231-2606
>
>
> -------------------------------------------------------
> This SF.Net email is sponsored by: SourceForge.net Broadband
> Sign-up now for SourceForge Broadband and get the fastest
> 6.0/768 connection for only $19.95/mo for the first 3 months!
> http://ads.osdn.com/?ad_id=2562&alloc_id=6184&op=click
> _______________________________________________
> Gusdev-gusdev mailing list
> Gus...@li...
> https://lists.sourceforge.net/lists/listinfo/gusdev-gusdev

Re: [Gusdev-gusdev] Problem loading EMBL files into GUS

[<pj...@sa...>]

Madhura,

Did you setup the DoTS.SequenceType tables?
I presume it can't find ds-DNA in there (and doesn't report it - I shall improve
the plugin).
See: GUS/Website/htdocs/documentation/installguide_UGA.html
and do a search for ds-DNA to find all the INSERT statements for ss-DNA, ds-DNA,
ss-RNA etc. I'm guessing we used those statements here at Sanger.

All,

On a slightly related note, I do have a collection of XML files that populate
dictionary tables such as ExternalDatabase, ExternalDatabaseRelease. Someone
emailed the list and said it would be good to have this somewhere, perhaps CVS.
I agree, although we would need to have "common" and "center specific"
dirctories. I am in the process of setting up a new GUS instance so I will soon
be in a better position to propose something.

Paul.

Quoting Madhura Sharangpani <sma...@st...>:

> Hi All
> 
> I am trying to load EMBL files into GUS, but having some problems,
> when I try to execute the command :
> 
> ga GUS::Common::Plugin::GenericParser2Gus --filetype=embl
> -filepath=b.pertussis.embl -sequencetype=ds-DNA
> 
> without commit, I get the following error:
> 
> *********************************************************
> ***COMMIT TURNED OFF***
> Dumping log: $VAR1 = '/tmp//GenericParser2Gusdev.pid28608.log';
> 
> embl file to parse, b.bronchiseptica.embl...
> ID line fine!!!
> source feature found, FT   source          1..5339179!!
> processing bioperl sequence, BB...
> sequence not in GUS yet
> can't find SequenceType, ds-DNA
> number of features = 5009
> organism, taxon id: Bordetella bronchiseptica,
> DBD::Oracle::st execute failed: ORA-01400: cannot insert NULL into
> ("DOTS"."NASE
> QUENCEIMP"."SEQUENCE_TYPE_ID") (DBD ERROR: OCIStmtExecute) at
> /afs/ir/users/s/m/
> smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line 145.
> 
> (after this along sequence is printed)
> 
> ATCGTACGGATTACAGGGCTTACGATGTTTCACGTGAAACGCCGAACGAGGTGCCACTATAATGGCCTCGGAACGCTCTT
> TCATCTCTCCCCATC, 1, 1, 1, 5339179, 850606, 0, chr. 1, 853819, 1, 86, 1825282,
> 0
> at /afs/ir/users/s/m/smadhura/RA/GUS/lib/perl/GUS/ObjRelP/DbiDbHandle.pm line
> 18
> 5
>         
> ***************************************************************************
> Can someone tell me why this error is occuring?
> 
> Thanks!
> 
> Madhura
>