gmod-ajax — JBrowse list

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Garrett S. <ste...@gm...>]

I might be able to help with this. The format of the arc renderer is
different, so you'd have to have something like this for that display:

{
"type": "LinearArcDisplay",
"displayId": "K562_bulk_co_sites_arc_color",
"renderer": {
"type": "ArcRenderer",
"color": "jexl:get(parent(feature), 'itemRgb')"
}
}

Note the different renderer type and "color" instead of "color1".

Hope that helps,
Garrett

On Tue, Aug 2, 2022 at 11:01 PM Chen Xie <xi...@ev...> wrote:

> Hi Colin,
>
> Thank you very much for your quick reply! Your suggestion works, but not
> completely. If I do not add color configuration, such as:
>
>       "displays": [
>         {
>           "type": "LinearArcDisplay",
>           "displayId": "K562_bulk_co_sites_arc_color"
>         },
>         {
>           "type": "LinearBasicDisplay",
>           "displayId": "K562_bulk_co_sites_basic_color",
>           "renderer": {
>             "type": "SvgFeatureRenderer",
>             "color1": "jexl:get(parent(feature), 'itemRgb')"
>           }
>         }
>       ],
>
> It works. But when I add color configuration, it does not work. For
> example:
>
>       "displays": [
>         {
>           "type": "LinearArcDisplay",
>           "displayId": "K562_bulk_co_sites_arc_color",
>           "renderer": {
>             "type": "SvgFeatureRenderer",
>             "color1": "jexl:get(parent(feature), 'itemRgb')"
>           }
>         },
>         {
>           "type": "LinearBasicDisplay",
>           "displayId": "K562_bulk_co_sites_basic_color",
>           "renderer": {
>             "type": "SvgFeatureRenderer",
>             "color1": "jexl:get(parent(feature), 'itemRgb')"
>           }
>         }
>       ],
>
> I tried with both v1.7.10 and v2.1.0. Could you please help me on this?
> Thanks again!
>
> Best wishes,
> Chen
>
>
>
>
> ----- 原始邮件 -----
> 发件人: "Colin" <col...@gm...>
> 收件人: "Chen Xie" <xi...@ev...>
> 抄送: "gmod-ajax" <gmo...@li...>
> 发送时间: 星期二, 2022年 8 月 02日 下午 7:10:33
> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>
> Hi there, there was a bug in the v2.0.0 release that caused this issue, we
> will have it fixed in the next release
> https://github.com/GMOD/jbrowse-components/pull/3120
>
> To hardcode a displaytype as the default, it can be listed as first in the
> "displays" array in the config, example:
>
>
> { "type": "FeatureTrack", "trackId": "gff3tabix_genes", "name": "GFF3Tabix
> genes", "assemblyNames": [ "volvox" ], "adapter": { "type":
> "Gff3TabixAdapter", "gffGzLocation": { "uri": "volvox.sort.gff3.gz" },
> "index": { "location": { "uri": "volvox.sort.gff3.gz.tbi" } } },
> "displays": [
> { "type": "LinearArcDisplay", "displayId":
> "gff3tabix_genes-LinearArcDisplay" }, { "type": "LinearBasicDisplay",
> "displayId": "gff3tabix_genes-LinearBasicDisplay" } ] }
>
>
> -Colin
>
> On Mon, Aug 1, 2022 at 9:05 PM Chen Xie <xi...@ev...> wrote:
>
> > Hi Colin,
> >
> > Thank you for helping us on coloring tabix-indexed BED tracks. Here is a
> > related question. The JBrowse version we set up before was 1.7.10, and
> now
> > I notice that the lastest version is 2.1.0. However, when I upgraded our
> > JBrowse to 2.1.0, LinearArcDisplay did not work anymore, i.e., nothing
> > happened when I clicked "LinearArcDisplay". The reason that I would like
> to
> > upgrade and try LinearArcDisplay for tabix-indexed BED tracks is as you
> > mentioned, coloring tracks in LinearArcDisplay might be possible in the
> > newer versions. Thus, could you please also show me how to config this in
> > the "config.json" file? Thanks again!
> >
> > Best wishes,
> > Chen
> >
> >
> >
> >
> > ----- 原始邮件 -----
> > 发件人: "Chen Xie" <xi...@ev...>
> > 收件人: "Colin" <col...@gm...>
> > 抄送: "gmod-ajax" <gmo...@li...>
> > 发送时间: 星期五, 2022年 6 月 24日 下午 4:02:57
> > 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
> >
> > Hi Colin,
> >
> > It works! Thank you very much, and look forward to your updates on
> > LinearArcDisplay and bigInteract in future.
> >
> > Best wishes,
> > Chen
> >
> >
> >
> >
> > ----- 原始邮件 -----
> > 发件人: "Colin" <col...@gm...>
> > 收件人: "Chen Xie" <xi...@ev...>
> > 抄送: "gmod-ajax" <gmo...@li...>
> > 发送时间: 星期五, 2022年 6 月 24日 下午 2:07:36
> > 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
> >
> > If I am reading the screenshot correctly, this is helpful to see.
> >
> > The reason for the issue you are seeing is because jbrowse "synthesizes
> > child features" from the bigBed feature, and so you would actually want
> to
> > access the parent feature's itemRgb field.
> >
> > Here is an example
> >
> > get(parent(feature),'itemRgb')
> >
> > This get's the parent feature's itemRgv field. Another helpful thing for
> > debugging you can try is
> >
> > get(parent(log(feature)),'itemRgb')
> >
> > This is exactly the same as above, but it console.log's the feature so
> you
> > can inspect it in the chrome devtools :)
> >
> > Potentially we could transfer the parent feature data fields onto the
> child
> > feature to help with this case, or make a utility function that
> > automatically looks at current and parent feature or something like that.
> > Hope that helps though!
> >
> >
> > -Colin
> >
> > On Thu, Jun 23, 2022 at 11:01 PM Chen Xie <xi...@ev...> wrote:
> >
> > > Hi Colin,
> > >
> > > Thank you very much for your nice reply! But after trying a lot in the
> > > past days, I still have the same problem. As the example you can see in
> > the
> > > attached picture, everything is blue including the ones should be red.
> > The
> > > collumn name must be correct because I also tested with mouse over (see
> > the
> > > red rectangels). Could you please help me to figure out the reason?
> > Thanks
> > > again!
> > >
> > > Best wishes,
> > > Chen
> > >
> > >
> > >
> > >
> > > ----- 原始邮件 -----
> > > 发件人: "Colin" <col...@gm...>
> > > 收件人: "Chen Xie" <xi...@ev...>
> > > 抄送: "gmod-ajax" <gmo...@li...>
> > > 发送时间: 星期三, 2022年 6 月 22日 上午 2:02:04
> > > 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
> > >
> > > Hi Chen
> > > Great questions
> > >
> > > For the color callback, I think you have the right idea. The "field8"
> > would
> > > be an autoassigned name if the columns of your bed file do not have
> > names.
> > > If you have bigBed, you may have column names (they are often provided
> by
> > > an autoSql file). You can check the column names using bigBedInfo or
> the
> > > "About track" inside jbrowse 2. Then just swap out field8 for whatever
> > the
> > > column name is. Let me know if this still has issues
> > >
> > > For the other questions
> > >
> > > 1) Looks like currently LinearArcDisplay does not have a color
> callback,
> > we
> > > will add this!
> > > 2) I think bigInteract would be a great thing to try to make an example
> > of
> > > for our docs. I think if you wanted to, you could load a bigInteract
> > bigBed
> > > file, and use LinearArcDisplay, and it would generally work. The
> features
> > > of bigInteract that would be missing are the  "feet" (e.g. the lines at
> > > each end of arc here
> > > https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
> > > missing, and the interchromosomal indicators would not display
> > >
> > > -Colin
> > >
> > >
> > >
> > >
> > > On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
> > >
> > > > Dear Madam/Sir,
> > > >
> > > > We have installed your JBrowse 2 on our server to visualize our
> > > sequencing
> > > > data. Currently, we met a problem about coloring tabix-indexed BED or
> > > > bigBed tracks. We put RGB values at the 9th column, and tried by
> > > following "
> > > > https://github.com/GMOD/jbrowse-components/discussions/2561" and "
> > > > https://github.com/GMOD/jbrowse-components/discussions/2772", but it
> > did
> > > > not work. Our configuration in "config.json" is similar to (we tested
> > > with
> > > > many small changes):
> > > >
> > > >       "displays": [
> > > >         {
> > > >           "type": "LinearBasicDisplay",
> > > >           "displayId": "color_test",
> > > >           "renderer": {
> > > >             "type": "SvgFeatureRenderer",
> > > >             "color1": "jexl:get(feature,
> > > 'field8')=='255,0,0'?'red':'blue'"
> > > >           }
> > > >         }
> > > >       ],
> > > >
> > > > With the codes above, it always shows blue color, even when the
> itemRgb
> > > > column is '255,0,0', and we also tried with 'field9', but it did not
> > work
> > > > either. I guess that we did not put the correct name of the feature
> > > there.
> > > > Could you please help us on it?
> > > >
> > > > Here are two further quesions:
> > > >
> > > > 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we
> > also
> > > > color lines in this type of display?
> > > >
> > > > 2. We would like to visualize data in the format of UCSC interact ("
> > > > https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
> > > > actually similar to your LinearArcDisplay. Do you plan to support it?
> > > >
> > > > Thank you very much and look forward to your reply!
> > > >
> > > > Best wishes,
> > > > Chen Xie
> > > >
> > > >
> > > >
> > > >
> > > >
> > > > _______________________________________________
> > > > Gmod-ajax mailing list
> > > > Gmo...@li...
> > > > https://lists.sourceforge.net/lists/listinfo/gmod-ajax
> > > >
> >
>
>
> _______________________________________________
> Gmod-ajax mailing list
> Gmo...@li...
> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>

[Gmod-ajax] multibigwig feature

[Ke J. <bio...@gm...>]

Hi,

It was great to see the MultiBigWig feature get implemented. It was one of
few of the JBrowse1 features I missed most. Thanks for the hard work by the
developers! I do have a small problem when trying it out. Looks like the
adaptor could not deal with local BigWig files, even though the regular
single bigwig adaptor could. So when I use this path for my single BW track
it works:

data/reference/mRNASeq/XXXX_transcritpome/XXXX.bw

where the "data" directory is under the JBrowse home directory.

But the same path does not work for the multibigwig configuration.

For security reasons, we could not host the BW files via https, so it would
be best that local BW could be loaded, in the same way as the single BW
tracks. Any advice here?

Thanks!

Ke

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Chen X. <xi...@ev...>]

Hi Colin,

Thank you very much for your quick reply! Your suggestion works, but not completely. If I do not add color configuration, such as:

      "displays": [
        {
          "type": "LinearArcDisplay",
          "displayId": "K562_bulk_co_sites_arc_color"
        },
        {
          "type": "LinearBasicDisplay",
          "displayId": "K562_bulk_co_sites_basic_color",
          "renderer": {
            "type": "SvgFeatureRenderer",
            "color1": "jexl:get(parent(feature), 'itemRgb')"
          }
        }
      ],

It works. But when I add color configuration, it does not work. For example:

      "displays": [
        {
          "type": "LinearArcDisplay",
          "displayId": "K562_bulk_co_sites_arc_color",
          "renderer": {
            "type": "SvgFeatureRenderer",
            "color1": "jexl:get(parent(feature), 'itemRgb')"
          }
        },
        {
          "type": "LinearBasicDisplay",
          "displayId": "K562_bulk_co_sites_basic_color",
          "renderer": {
            "type": "SvgFeatureRenderer",
            "color1": "jexl:get(parent(feature), 'itemRgb')"
          }
        }
      ],

I tried with both v1.7.10 and v2.1.0. Could you please help me on this? Thanks again!

Best wishes,
Chen




----- 原始邮件 -----
发件人: "Colin" <col...@gm...>
收件人: "Chen Xie" <xi...@ev...>
抄送: "gmod-ajax" <gmo...@li...>
发送时间: 星期二, 2022年 8 月 02日 下午 7:10:33
主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

Hi there, there was a bug in the v2.0.0 release that caused this issue, we
will have it fixed in the next release
https://github.com/GMOD/jbrowse-components/pull/3120

To hardcode a displaytype as the default, it can be listed as first in the
"displays" array in the config, example:


{ "type": "FeatureTrack", "trackId": "gff3tabix_genes", "name": "GFF3Tabix
genes", "assemblyNames": [ "volvox" ], "adapter": { "type":
"Gff3TabixAdapter", "gffGzLocation": { "uri": "volvox.sort.gff3.gz" },
"index": { "location": { "uri": "volvox.sort.gff3.gz.tbi" } } },
"displays": [
{ "type": "LinearArcDisplay", "displayId":
"gff3tabix_genes-LinearArcDisplay" }, { "type": "LinearBasicDisplay",
"displayId": "gff3tabix_genes-LinearBasicDisplay" } ] }


-Colin

On Mon, Aug 1, 2022 at 9:05 PM Chen Xie <xi...@ev...> wrote:

> Hi Colin,
>
> Thank you for helping us on coloring tabix-indexed BED tracks. Here is a
> related question. The JBrowse version we set up before was 1.7.10, and now
> I notice that the lastest version is 2.1.0. However, when I upgraded our
> JBrowse to 2.1.0, LinearArcDisplay did not work anymore, i.e., nothing
> happened when I clicked "LinearArcDisplay". The reason that I would like to
> upgrade and try LinearArcDisplay for tabix-indexed BED tracks is as you
> mentioned, coloring tracks in LinearArcDisplay might be possible in the
> newer versions. Thus, could you please also show me how to config this in
> the "config.json" file? Thanks again!
>
> Best wishes,
> Chen
>
>
>
>
> ----- 原始邮件 -----
> 发件人: "Chen Xie" <xi...@ev...>
> 收件人: "Colin" <col...@gm...>
> 抄送: "gmod-ajax" <gmo...@li...>
> 发送时间: 星期五, 2022年 6 月 24日 下午 4:02:57
> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>
> Hi Colin,
>
> It works! Thank you very much, and look forward to your updates on
> LinearArcDisplay and bigInteract in future.
>
> Best wishes,
> Chen
>
>
>
>
> ----- 原始邮件 -----
> 发件人: "Colin" <col...@gm...>
> 收件人: "Chen Xie" <xi...@ev...>
> 抄送: "gmod-ajax" <gmo...@li...>
> 发送时间: 星期五, 2022年 6 月 24日 下午 2:07:36
> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>
> If I am reading the screenshot correctly, this is helpful to see.
>
> The reason for the issue you are seeing is because jbrowse "synthesizes
> child features" from the bigBed feature, and so you would actually want to
> access the parent feature's itemRgb field.
>
> Here is an example
>
> get(parent(feature),'itemRgb')
>
> This get's the parent feature's itemRgv field. Another helpful thing for
> debugging you can try is
>
> get(parent(log(feature)),'itemRgb')
>
> This is exactly the same as above, but it console.log's the feature so you
> can inspect it in the chrome devtools :)
>
> Potentially we could transfer the parent feature data fields onto the child
> feature to help with this case, or make a utility function that
> automatically looks at current and parent feature or something like that.
> Hope that helps though!
>
>
> -Colin
>
> On Thu, Jun 23, 2022 at 11:01 PM Chen Xie <xi...@ev...> wrote:
>
> > Hi Colin,
> >
> > Thank you very much for your nice reply! But after trying a lot in the
> > past days, I still have the same problem. As the example you can see in
> the
> > attached picture, everything is blue including the ones should be red.
> The
> > collumn name must be correct because I also tested with mouse over (see
> the
> > red rectangels). Could you please help me to figure out the reason?
> Thanks
> > again!
> >
> > Best wishes,
> > Chen
> >
> >
> >
> >
> > ----- 原始邮件 -----
> > 发件人: "Colin" <col...@gm...>
> > 收件人: "Chen Xie" <xi...@ev...>
> > 抄送: "gmod-ajax" <gmo...@li...>
> > 发送时间: 星期三, 2022年 6 月 22日 上午 2:02:04
> > 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
> >
> > Hi Chen
> > Great questions
> >
> > For the color callback, I think you have the right idea. The "field8"
> would
> > be an autoassigned name if the columns of your bed file do not have
> names.
> > If you have bigBed, you may have column names (they are often provided by
> > an autoSql file). You can check the column names using bigBedInfo or the
> > "About track" inside jbrowse 2. Then just swap out field8 for whatever
> the
> > column name is. Let me know if this still has issues
> >
> > For the other questions
> >
> > 1) Looks like currently LinearArcDisplay does not have a color callback,
> we
> > will add this!
> > 2) I think bigInteract would be a great thing to try to make an example
> of
> > for our docs. I think if you wanted to, you could load a bigInteract
> bigBed
> > file, and use LinearArcDisplay, and it would generally work. The features
> > of bigInteract that would be missing are the  "feet" (e.g. the lines at
> > each end of arc here
> > https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
> > missing, and the interchromosomal indicators would not display
> >
> > -Colin
> >
> >
> >
> >
> > On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
> >
> > > Dear Madam/Sir,
> > >
> > > We have installed your JBrowse 2 on our server to visualize our
> > sequencing
> > > data. Currently, we met a problem about coloring tabix-indexed BED or
> > > bigBed tracks. We put RGB values at the 9th column, and tried by
> > following "
> > > https://github.com/GMOD/jbrowse-components/discussions/2561" and "
> > > https://github.com/GMOD/jbrowse-components/discussions/2772", but it
> did
> > > not work. Our configuration in "config.json" is similar to (we tested
> > with
> > > many small changes):
> > >
> > >       "displays": [
> > >         {
> > >           "type": "LinearBasicDisplay",
> > >           "displayId": "color_test",
> > >           "renderer": {
> > >             "type": "SvgFeatureRenderer",
> > >             "color1": "jexl:get(feature,
> > 'field8')=='255,0,0'?'red':'blue'"
> > >           }
> > >         }
> > >       ],
> > >
> > > With the codes above, it always shows blue color, even when the itemRgb
> > > column is '255,0,0', and we also tried with 'field9', but it did not
> work
> > > either. I guess that we did not put the correct name of the feature
> > there.
> > > Could you please help us on it?
> > >
> > > Here are two further quesions:
> > >
> > > 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we
> also
> > > color lines in this type of display?
> > >
> > > 2. We would like to visualize data in the format of UCSC interact ("
> > > https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
> > > actually similar to your LinearArcDisplay. Do you plan to support it?
> > >
> > > Thank you very much and look forward to your reply!
> > >
> > > Best wishes,
> > > Chen Xie
> > >
> > >
> > >
> > >
> > >
> > > _______________________________________________
> > > Gmod-ajax mailing list
> > > Gmo...@li...
> > > https://lists.sourceforge.net/lists/listinfo/gmod-ajax
> > >
>

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Colin <col...@gm...>]

Hi there, there was a bug in the v2.0.0 release that caused this issue, we
will have it fixed in the next release
https://github.com/GMOD/jbrowse-components/pull/3120

To hardcode a displaytype as the default, it can be listed as first in the
"displays" array in the config, example:


{ "type": "FeatureTrack", "trackId": "gff3tabix_genes", "name": "GFF3Tabix
genes", "assemblyNames": [ "volvox" ], "adapter": { "type":
"Gff3TabixAdapter", "gffGzLocation": { "uri": "volvox.sort.gff3.gz" },
"index": { "location": { "uri": "volvox.sort.gff3.gz.tbi" } } },
"displays": [
{ "type": "LinearArcDisplay", "displayId":
"gff3tabix_genes-LinearArcDisplay" }, { "type": "LinearBasicDisplay",
"displayId": "gff3tabix_genes-LinearBasicDisplay" } ] }


-Colin

On Mon, Aug 1, 2022 at 9:05 PM Chen Xie <xi...@ev...> wrote:

> Hi Colin,
>
> Thank you for helping us on coloring tabix-indexed BED tracks. Here is a
> related question. The JBrowse version we set up before was 1.7.10, and now
> I notice that the lastest version is 2.1.0. However, when I upgraded our
> JBrowse to 2.1.0, LinearArcDisplay did not work anymore, i.e., nothing
> happened when I clicked "LinearArcDisplay". The reason that I would like to
> upgrade and try LinearArcDisplay for tabix-indexed BED tracks is as you
> mentioned, coloring tracks in LinearArcDisplay might be possible in the
> newer versions. Thus, could you please also show me how to config this in
> the "config.json" file? Thanks again!
>
> Best wishes,
> Chen
>
>
>
>
> ----- 原始邮件 -----
> 发件人: "Chen Xie" <xi...@ev...>
> 收件人: "Colin" <col...@gm...>
> 抄送: "gmod-ajax" <gmo...@li...>
> 发送时间: 星期五, 2022年 6 月 24日 下午 4:02:57
> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>
> Hi Colin,
>
> It works! Thank you very much, and look forward to your updates on
> LinearArcDisplay and bigInteract in future.
>
> Best wishes,
> Chen
>
>
>
>
> ----- 原始邮件 -----
> 发件人: "Colin" <col...@gm...>
> 收件人: "Chen Xie" <xi...@ev...>
> 抄送: "gmod-ajax" <gmo...@li...>
> 发送时间: 星期五, 2022年 6 月 24日 下午 2:07:36
> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>
> If I am reading the screenshot correctly, this is helpful to see.
>
> The reason for the issue you are seeing is because jbrowse "synthesizes
> child features" from the bigBed feature, and so you would actually want to
> access the parent feature's itemRgb field.
>
> Here is an example
>
> get(parent(feature),'itemRgb')
>
> This get's the parent feature's itemRgv field. Another helpful thing for
> debugging you can try is
>
> get(parent(log(feature)),'itemRgb')
>
> This is exactly the same as above, but it console.log's the feature so you
> can inspect it in the chrome devtools :)
>
> Potentially we could transfer the parent feature data fields onto the child
> feature to help with this case, or make a utility function that
> automatically looks at current and parent feature or something like that.
> Hope that helps though!
>
>
> -Colin
>
> On Thu, Jun 23, 2022 at 11:01 PM Chen Xie <xi...@ev...> wrote:
>
> > Hi Colin,
> >
> > Thank you very much for your nice reply! But after trying a lot in the
> > past days, I still have the same problem. As the example you can see in
> the
> > attached picture, everything is blue including the ones should be red.
> The
> > collumn name must be correct because I also tested with mouse over (see
> the
> > red rectangels). Could you please help me to figure out the reason?
> Thanks
> > again!
> >
> > Best wishes,
> > Chen
> >
> >
> >
> >
> > ----- 原始邮件 -----
> > 发件人: "Colin" <col...@gm...>
> > 收件人: "Chen Xie" <xi...@ev...>
> > 抄送: "gmod-ajax" <gmo...@li...>
> > 发送时间: 星期三, 2022年 6 月 22日 上午 2:02:04
> > 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
> >
> > Hi Chen
> > Great questions
> >
> > For the color callback, I think you have the right idea. The "field8"
> would
> > be an autoassigned name if the columns of your bed file do not have
> names.
> > If you have bigBed, you may have column names (they are often provided by
> > an autoSql file). You can check the column names using bigBedInfo or the
> > "About track" inside jbrowse 2. Then just swap out field8 for whatever
> the
> > column name is. Let me know if this still has issues
> >
> > For the other questions
> >
> > 1) Looks like currently LinearArcDisplay does not have a color callback,
> we
> > will add this!
> > 2) I think bigInteract would be a great thing to try to make an example
> of
> > for our docs. I think if you wanted to, you could load a bigInteract
> bigBed
> > file, and use LinearArcDisplay, and it would generally work. The features
> > of bigInteract that would be missing are the  "feet" (e.g. the lines at
> > each end of arc here
> > https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
> > missing, and the interchromosomal indicators would not display
> >
> > -Colin
> >
> >
> >
> >
> > On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
> >
> > > Dear Madam/Sir,
> > >
> > > We have installed your JBrowse 2 on our server to visualize our
> > sequencing
> > > data. Currently, we met a problem about coloring tabix-indexed BED or
> > > bigBed tracks. We put RGB values at the 9th column, and tried by
> > following "
> > > https://github.com/GMOD/jbrowse-components/discussions/2561" and "
> > > https://github.com/GMOD/jbrowse-components/discussions/2772", but it
> did
> > > not work. Our configuration in "config.json" is similar to (we tested
> > with
> > > many small changes):
> > >
> > >       "displays": [
> > >         {
> > >           "type": "LinearBasicDisplay",
> > >           "displayId": "color_test",
> > >           "renderer": {
> > >             "type": "SvgFeatureRenderer",
> > >             "color1": "jexl:get(feature,
> > 'field8')=='255,0,0'?'red':'blue'"
> > >           }
> > >         }
> > >       ],
> > >
> > > With the codes above, it always shows blue color, even when the itemRgb
> > > column is '255,0,0', and we also tried with 'field9', but it did not
> work
> > > either. I guess that we did not put the correct name of the feature
> > there.
> > > Could you please help us on it?
> > >
> > > Here are two further quesions:
> > >
> > > 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we
> also
> > > color lines in this type of display?
> > >
> > > 2. We would like to visualize data in the format of UCSC interact ("
> > > https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
> > > actually similar to your LinearArcDisplay. Do you plan to support it?
> > >
> > > Thank you very much and look forward to your reply!
> > >
> > > Best wishes,
> > > Chen Xie
> > >
> > >
> > >
> > >
> > >
> > > _______________________________________________
> > > Gmod-ajax mailing list
> > > Gmo...@li...
> > > https://lists.sourceforge.net/lists/listinfo/gmod-ajax
> > >
>

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Chen X. <xi...@ev...>]

Hi Colin,

Thank you for helping us on coloring tabix-indexed BED tracks. Here is a related question. The JBrowse version we set up before was 1.7.10, and now I notice that the lastest version is 2.1.0. However, when I upgraded our JBrowse to 2.1.0, LinearArcDisplay did not work anymore, i.e., nothing happened when I clicked "LinearArcDisplay". The reason that I would like to upgrade and try LinearArcDisplay for tabix-indexed BED tracks is as you mentioned, coloring tracks in LinearArcDisplay might be possible in the newer versions. Thus, could you please also show me how to config this in the "config.json" file? Thanks again!

Best wishes,
Chen




----- 原始邮件 -----
发件人: "Chen Xie" <xi...@ev...>
收件人: "Colin" <col...@gm...>
抄送: "gmod-ajax" <gmo...@li...>
发送时间: 星期五, 2022年 6 月 24日 下午 4:02:57
主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

Hi Colin,

It works! Thank you very much, and look forward to your updates on LinearArcDisplay and bigInteract in future.

Best wishes,
Chen




----- 原始邮件 -----
发件人: "Colin" <col...@gm...>
收件人: "Chen Xie" <xi...@ev...>
抄送: "gmod-ajax" <gmo...@li...>
发送时间: 星期五, 2022年 6 月 24日 下午 2:07:36
主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

If I am reading the screenshot correctly, this is helpful to see.

The reason for the issue you are seeing is because jbrowse "synthesizes
child features" from the bigBed feature, and so you would actually want to
access the parent feature's itemRgb field.

Here is an example

get(parent(feature),'itemRgb')

This get's the parent feature's itemRgv field. Another helpful thing for
debugging you can try is

get(parent(log(feature)),'itemRgb')

This is exactly the same as above, but it console.log's the feature so you
can inspect it in the chrome devtools :)

Potentially we could transfer the parent feature data fields onto the child
feature to help with this case, or make a utility function that
automatically looks at current and parent feature or something like that.
Hope that helps though!


-Colin

On Thu, Jun 23, 2022 at 11:01 PM Chen Xie <xi...@ev...> wrote:

> Hi Colin,
>
> Thank you very much for your nice reply! But after trying a lot in the
> past days, I still have the same problem. As the example you can see in the
> attached picture, everything is blue including the ones should be red. The
> collumn name must be correct because I also tested with mouse over (see the
> red rectangels). Could you please help me to figure out the reason? Thanks
> again!
>
> Best wishes,
> Chen
>
>
>
>
> ----- 原始邮件 -----
> 发件人: "Colin" <col...@gm...>
> 收件人: "Chen Xie" <xi...@ev...>
> 抄送: "gmod-ajax" <gmo...@li...>
> 发送时间: 星期三, 2022年 6 月 22日 上午 2:02:04
> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>
> Hi Chen
> Great questions
>
> For the color callback, I think you have the right idea. The "field8" would
> be an autoassigned name if the columns of your bed file do not have names.
> If you have bigBed, you may have column names (they are often provided by
> an autoSql file). You can check the column names using bigBedInfo or the
> "About track" inside jbrowse 2. Then just swap out field8 for whatever the
> column name is. Let me know if this still has issues
>
> For the other questions
>
> 1) Looks like currently LinearArcDisplay does not have a color callback, we
> will add this!
> 2) I think bigInteract would be a great thing to try to make an example of
> for our docs. I think if you wanted to, you could load a bigInteract bigBed
> file, and use LinearArcDisplay, and it would generally work. The features
> of bigInteract that would be missing are the  "feet" (e.g. the lines at
> each end of arc here
> https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
> missing, and the interchromosomal indicators would not display
>
> -Colin
>
>
>
>
> On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
>
> > Dear Madam/Sir,
> >
> > We have installed your JBrowse 2 on our server to visualize our
> sequencing
> > data. Currently, we met a problem about coloring tabix-indexed BED or
> > bigBed tracks. We put RGB values at the 9th column, and tried by
> following "
> > https://github.com/GMOD/jbrowse-components/discussions/2561" and "
> > https://github.com/GMOD/jbrowse-components/discussions/2772", but it did
> > not work. Our configuration in "config.json" is similar to (we tested
> with
> > many small changes):
> >
> >       "displays": [
> >         {
> >           "type": "LinearBasicDisplay",
> >           "displayId": "color_test",
> >           "renderer": {
> >             "type": "SvgFeatureRenderer",
> >             "color1": "jexl:get(feature,
> 'field8')=='255,0,0'?'red':'blue'"
> >           }
> >         }
> >       ],
> >
> > With the codes above, it always shows blue color, even when the itemRgb
> > column is '255,0,0', and we also tried with 'field9', but it did not work
> > either. I guess that we did not put the correct name of the feature
> there.
> > Could you please help us on it?
> >
> > Here are two further quesions:
> >
> > 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also
> > color lines in this type of display?
> >
> > 2. We would like to visualize data in the format of UCSC interact ("
> > https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
> > actually similar to your LinearArcDisplay. Do you plan to support it?
> >
> > Thank you very much and look forward to your reply!
> >
> > Best wishes,
> > Chen Xie
> >
> >
> >
> >
> >
> > _______________________________________________
> > Gmod-ajax mailing list
> > Gmo...@li...
> > https://lists.sourceforge.net/lists/listinfo/gmod-ajax
> >

Re: [Gmod-ajax] log4j removal in apollo

[Garrett S. <ste...@gm...>]

I don't know a good way to use the existing Docker image, you'd probably
have better luck cloning the Apollo repo, making some changes there, and
building your own docker image from scratch using the Dockerfile in the
repo.

As for what changes to make, you could possibly try the method under
"Alternative logging libraries" mentioned here
<https://grails.github.io/grails2-doc/2.5.x/guide/single.html#logging>.
Perhaps you can exclude the Log4J and not provide a replacement for it and
it still might build.

Best,
Garrett

On Wed, Jul 20, 2022 at 4:16 PM Justin Elser <jus...@or...>
wrote:

> Hi all,
>
> Our campus is requiring us to remove log4j from any sites before we make
> them public. I know that technically log4j 1.2 isn't vulnerable to the
> log4shell vulnerability, but they are still telling me the old version
> has different issues and must be removed.
>
> I know this was already discussed in
> https://github.com/GMOD/Apollo/issues/2640, so it looks like updating to
> log4j >=2.17 is not really being considered at this time, which I
> understand, looks like a lot of work.
>
> However, since we don't plan on using the logs in this way, we want to
> just remove it completely from our instance.
>
> I am hoping you can help me figure out the easiest/best way to remove it
> completely. Added complexity, we are using the docker image of it.
>
> This is a bit outside my wheelhouse, so I'm looking for help. I did try
> just removing the 3 log4j jar files I found, save it with a docker
> commit, but it appears to just re-install them the next time it is started.
> root@a90df9ffd565:/# locate log4j
> /var/lib/tomcat9/webapps/ROOT/WEB-INF/lib/grails-plugin-log4j-2.5.5.jar
> /var/lib/tomcat9/webapps/ROOT/WEB-INF/lib/log4j-1.2.17.jar
>
> /var/lib/tomcat9/webapps/ROOT/WEB-INF/lib/tomcat-embed-logging-log4j-7.0.70.jar
>
> So, how can I remove/disable log4j completely?
>
> Thanks,
> Justin
>
> --
> **********************************************************
> *                                                        *
> *  Justin Elser                                          *
> *  Computational Biology Research Associate              *
> *  Dept. of Botany and Plant Pathology                   *
> *  Jaiswal Lab                                           *
> *  Oregon State University                               *
> *                                                        *
> *  email: jus...@or...                   *
> *                                                        *
> **********************************************************
>
>
>
> _______________________________________________
> Gmod-ajax mailing list
> Gmo...@li...
> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>

[Gmod-ajax] log4j removal in apollo

[Justin E. <jus...@or...>]

Hi all,

Our campus is requiring us to remove log4j from any sites before we make 
them public. I know that technically log4j 1.2 isn't vulnerable to the 
log4shell vulnerability, but they are still telling me the old version 
has different issues and must be removed.

I know this was already discussed in 
https://github.com/GMOD/Apollo/issues/2640, so it looks like updating to 
log4j >=2.17 is not really being considered at this time, which I 
understand, looks like a lot of work.

However, since we don't plan on using the logs in this way, we want to 
just remove it completely from our instance.

I am hoping you can help me figure out the easiest/best way to remove it 
completely. Added complexity, we are using the docker image of it.

This is a bit outside my wheelhouse, so I'm looking for help. I did try 
just removing the 3 log4j jar files I found, save it with a docker 
commit, but it appears to just re-install them the next time it is started.
root@a90df9ffd565:/# locate log4j
/var/lib/tomcat9/webapps/ROOT/WEB-INF/lib/grails-plugin-log4j-2.5.5.jar
/var/lib/tomcat9/webapps/ROOT/WEB-INF/lib/log4j-1.2.17.jar
/var/lib/tomcat9/webapps/ROOT/WEB-INF/lib/tomcat-embed-logging-log4j-7.0.70.jar

So, how can I remove/disable log4j completely?

Thanks,
Justin

-- 
**********************************************************
*                                                        *
*  Justin Elser                                          *
*  Computational Biology Research Associate              *
*  Dept. of Botany and Plant Pathology                   *
*  Jaiswal Lab                                           *
*  Oregon State University                               *
*                                                        *
*  email: jus...@or...                   *
*                                                        *
**********************************************************

[Gmod-ajax] Position open working on Apollo at Glasgow

[Robert B. <rb...@gm...>]

Hi all,

There is a position open for a software engineer to work with me, the
JBrowse team, and colleagues at the EBI on the new Apollo, which will be
based on JBrowse 2 and written entirely in Typescript and React.

Please forward to any UK-based software engineers you think might be
interested!

https://www.cwjobs.co.uk/job/software-engineer/university-of-glasgow-job98115535?v=1657823347688

Rob

Re: [Gmod-ajax] Loading Bismark Methylation CRAM files to JBrowse2

[Colin <col...@gm...>]

I am not aware of a way to get Bismark to output the MM tag currently, I
found an existing thread regarding the matter and it wasn't too conclusive
https://github.com/FelixKrueger/Bismark/issues/500

I could not provide any ETA or anything regarding the development of this
feature. I had attempted WGBS support early on while developing the MM tag
but didn't get it completed.

Visualizing the cpg coverage BED file or whatever other text format it is
in currently may also be good, I have not looked at this data format
though, if you have pointers to example files let me know


-Colin

On Fri, Jul 8, 2022 at 4:06 PM Hans Vasquez-Gross <hva...@un...>
wrote:

> Hi Colin,
>
> Is there a way to get the data mapped with Bismark to visualize the data?
> What if I converted the cpg coverage text file into a bed format?  Also, is
> the development for bisulfite sequencing BAM/CRAM support on the road map?
> Is there an ETA when it may be supported?
>
> Sorry for all these questions. Thank you for all this information.
>
> Best,
> -Hans
> ------------------------------
> *From:* Colin <col...@gm...>
> *Sent:* Friday, July 8, 2022 3:02 PM
> *To:* Hans Vasquez-Gross <hva...@un...>
> *Cc:* gmo...@li... <gmo...@li...>
> *Subject:* Re: [Gmod-ajax] Loading Bismark Methylation CRAM files to
> JBrowse2
>
> Hi Hans,
> Unfortunately don't support visualizing 'bisulfite sequencing' BAM/CRAM
> files (yet). The data format that we DO support for drawing methylation is
> based on the "MM" tag standard recently introduced to hts-specs, which has
> primarily been used for methylation called from nanopore reads. We can try
> to  look into improving that error message when loading WGBS though, or add
> true WGBS support :)
>
>
> -Colin
>
>
> On Fri, Jul 8, 2022 at 3:57 PM Hans Vasquez-Gross <hva...@un...>
> wrote:
>
> Hello JBrowse2 team,
>
> I am working on a new project and need to load BAM/CRAM files to JBrowse2
> to visualize the methylation data.  I have mapped the reads with bismark,
> then converted the sorted.bam file to cram and added the track.
>
> However, when I go to the track and Pileup Settings ->  the color-scheme
> ->  Methylation, the cram file fails to load with the error:
> "Error:operation timed out, worker process stopped responding, Error:
> Timeout exceeded for RPC method "ping"."
>
>
> However, the pileup visualization works fine in normal view.  See example
> screenshot below:
>
>
>
> Looking back at the documentation, I noticed that the instructions say
> there needs to be MM tags for the methylation functionality to work.
> However, looking at the bismark bam/cram output files, I don't see an MM
> tag.
>
>
> 3 Example CRAM lines:
> J00113:351:HMW3GBBXX:2:2123:15432:48104_1:N:0:TATAAT    16      Chr01
> 470     32      100M    *       0       0
> AATAACCAAAAACAAACTCATATTCCTAATTAACAACCACTTACTATCAAAAATTACTACACATATCCTAAAAATTAATCTAACACAAATACTTTAACCA
>
>  JJJJFJJJJJJJJJJFJJJFJJJJJJJJJJJJFJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA
>
>  XM:Z:hh.hh..z.h.........z.h.....x...hh..x......h..x....h....h..x.............h....h.........x..h....hh..z
>       XR:Z:CT XG:Z:GA
> MD:Z:0G0G1G0G2G1G9G1G5G3G0G2G6G2G4G4G2G13G4G9G2G4G0G2G0 NM:i:24
> J00113:351:HMW3GBBXX:2:2224:6167:3143_1:N:0:TATAAT      16      Chr01
> 470     15      100M    *       0       0
> AATAACCAAAAACAAACTCATATTCCTAATTAACAACCACTTACTATCAAAAACTACTACACATATCCTAAAAATTAATCTAACACAAATACTTTAACCA
>
>  JJJJJJJJJJFAFFA<JJJFJJJJJJJFJJJJJFF<JF7JJJJJJJJJJF<FAJJFJF-F7F7JJJJJJJJFFAJJFAJFA7JFFJJJJF-J<JJFFFAA
>
>  XM:Z:hh.hh..z.h.........z.h.....x...hh..x......h..x....h....h..x.............h....h.........x..h....hh..z
>       XR:Z:CT XG:Z:GA
> MD:Z:0G0G1G0G2G1G9G1G5G3G0G2G6G2G4G2T1G2G13G4G9G2G4G0G2G0       NM:i:25
> J00113:351:HMW3GBBXX:2:1203:16944:41721_1:N:0:TATAAT    16      Chr01
> 663     32      100M    *       0       0
> ACTCACCTTAAAAACACTTACCATACACAACAAAAACAAACTTCTAACCTTAATTAACTAATTCTTACCACCAAAACCTACATCTATAAAAAAAAACCCA
>
>  JJJJFJJJJJJJJFFFJJJJJJJJJJJJJJJJJFJFJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAFFFAA
>
>  XM:Z:.........h.........h....h.z.zx...............xh....h...hh..xh.....h.......h....x.........h...h.....z
>       XR:Z:CT XG:Z:GA MD:Z:9G9G4G1G1G0G15G0G4G3G0G2G0G5G7G4G9G3G5G0
> NM:i:19
>
>
> Any advice would be greatly appreciated.
>
> Thank you,
> -Hans
>
>
> --
>
>
>
> [image: signature_998258195]
>
> *Hans Vasquez-Gross, Ph.D*
>
> Bioinformatics Scientist,
> Nevada Bioinformatics Center
>
> https://www.unr.edu/bioinformatics
>
> hva...@un...
>
> _______________________________________________
> Gmod-ajax mailing list
> Gmo...@li...
> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
> <https://nam04.safelinks.protection.outlook.com/?url=https%3A%2F%2Flists.sourceforge.net%2Flists%2Flistinfo%2Fgmod-ajax&data=05%7C01%7Chvasquezgross%40unr.edu%7Cb0a647013b4547de801308da612d97a1%7C523b4bfc0ebd4c03b2b96f6a17fd31d8%7C0%7C0%7C637929145697437910%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=bZKA4Ggh2qvspN4UWbVxa%2BE7yzBUGRt8J%2F1TxOZmRQU%3D&reserved=0>
>
>

Re: [Gmod-ajax] Loading Bismark Methylation CRAM files to JBrowse2

[Hans Vasquez-G. <hva...@un...>]

Hi Colin,

Is there a way to get the data mapped with Bismark to visualize the data? What if I converted the cpg coverage text file into a bed format?  Also, is the development for bisulfite sequencing BAM/CRAM support on the road map? Is there an ETA when it may be supported?

Sorry for all these questions. Thank you for all this information.

Best,
-Hans
________________________________
From: Colin <col...@gm...>
Sent: Friday, July 8, 2022 3:02 PM
To: Hans Vasquez-Gross <hva...@un...>
Cc: gmo...@li... <gmo...@li...>
Subject: Re: [Gmod-ajax] Loading Bismark Methylation CRAM files to JBrowse2

Hi Hans,
Unfortunately don't support visualizing 'bisulfite sequencing' BAM/CRAM files (yet). The data format that we DO support for drawing methylation is based on the "MM" tag standard recently introduced to hts-specs, which has primarily been used for methylation called from nanopore reads. We can try to  look into improving that error message when loading WGBS though, or add true WGBS support :)


-Colin


On Fri, Jul 8, 2022 at 3:57 PM Hans Vasquez-Gross <hva...@un...<mailto:hva...@un...>> wrote:
Hello JBrowse2 team,

I am working on a new project and need to load BAM/CRAM files to JBrowse2 to visualize the methylation data.  I have mapped the reads with bismark, then converted the sorted.bam file to cram and added the track.

However, when I go to the track and Pileup Settings ->  the color-scheme ->  Methylation, the cram file fails to load with the error: "Error:operation timed out, worker process stopped responding, Error: Timeout exceeded for RPC method "ping"."


However, the pileup visualization works fine in normal view.  See example screenshot below:
[cid:181dfd21192a58902e1]


Looking back at the documentation, I noticed that the instructions say there needs to be MM tags for the methylation functionality to work.  However, looking at the bismark bam/cram output files, I don't see an MM tag.


3 Example CRAM lines:
J00113:351:HMW3GBBXX:2:2123:15432:48104_1:N:0:TATAAT    16      Chr01   470     32      100M    *       0       0       AATAACCAAAAACAAACTCATATTCCTAATTAACAACCACTTACTATCAAAAATTACTACACATATCCTAAAAATTAATCTAACACAAATACTTTAACCA    JJJJFJJJJJJJJJJFJJJFJJJJJJJJJJJJFJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA    XM:Z:hh.hh..z.h.........z.h.....x...hh..x......h..x....h....h..x.............h....h.........x..h....hh..z       XR:Z:CT XG:Z:GA MD:Z:0G0G1G0G2G1G9G1G5G3G0G2G6G2G4G4G2G13G4G9G2G4G0G2G0 NM:i:24
J00113:351:HMW3GBBXX:2:2224:6167:3143_1:N:0:TATAAT      16      Chr01   470     15      100M    *       0       0       AATAACCAAAAACAAACTCATATTCCTAATTAACAACCACTTACTATCAAAAACTACTACACATATCCTAAAAATTAATCTAACACAAATACTTTAACCA    JJJJJJJJJJFAFFA<JJJFJJJJJJJFJJJJJFF<JF7JJJJJJJJJJF<FAJJFJF-F7F7JJJJJJJJFFAJJFAJFA7JFFJJJJF-J<JJFFFAA    XM:Z:hh.hh..z.h.........z.h.....x...hh..x......h..x....h....h..x.............h....h.........x..h....hh..z       XR:Z:CT XG:Z:GA MD:Z:0G0G1G0G2G1G9G1G5G3G0G2G6G2G4G2T1G2G13G4G9G2G4G0G2G0       NM:i:25
J00113:351:HMW3GBBXX:2:1203:16944:41721_1:N:0:TATAAT    16      Chr01   663     32      100M    *       0       0       ACTCACCTTAAAAACACTTACCATACACAACAAAAACAAACTTCTAACCTTAATTAACTAATTCTTACCACCAAAACCTACATCTATAAAAAAAAACCCA    JJJJFJJJJJJJJFFFJJJJJJJJJJJJJJJJJFJFJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAFFFAA    XM:Z:.........h.........h....h.z.zx...............xh....h...hh..xh.....h.......h....x.........h...h.....z       XR:Z:CT XG:Z:GA MD:Z:9G9G4G1G1G0G15G0G4G3G0G2G0G5G7G4G9G3G5G0   NM:i:19


Any advice would be greatly appreciated.

Thank you,
-Hans



--



[signature_998258195]

Hans Vasquez-Gross, Ph.D

Bioinformatics Scientist,
Nevada Bioinformatics Center

https://www.unr.edu/bioinformatics

hva...@un...<mailto:hva...@un...>

_______________________________________________
Gmod-ajax mailing list
Gmo...@li...<mailto:Gmo...@li...>
https://lists.sourceforge.net/lists/listinfo/gmod-ajax<https://nam04.safelinks.protection.outlook.com/?url=https%3A%2F%2Flists.sourceforge.net%2Flists%2Flistinfo%2Fgmod-ajax&data=05%7C01%7Chvasquezgross%40unr.edu%7Cb0a647013b4547de801308da612d97a1%7C523b4bfc0ebd4c03b2b96f6a17fd31d8%7C0%7C0%7C637929145697437910%7CUnknown%7CTWFpbGZsb3d8eyJWIjoiMC4wLjAwMDAiLCJQIjoiV2luMzIiLCJBTiI6Ik1haWwiLCJXVCI6Mn0%3D%7C3000%7C%7C%7C&sdata=bZKA4Ggh2qvspN4UWbVxa%2BE7yzBUGRt8J%2F1TxOZmRQU%3D&reserved=0>

Re: [Gmod-ajax] Loading Bismark Methylation CRAM files to JBrowse2

[Colin <col...@gm...>]

Hi Hans,
Unfortunately don't support visualizing 'bisulfite sequencing' BAM/CRAM
files (yet). The data format that we DO support for drawing methylation is
based on the "MM" tag standard recently introduced to hts-specs, which has
primarily been used for methylation called from nanopore reads. We can try
to  look into improving that error message when loading WGBS though, or add
true WGBS support :)


-Colin


On Fri, Jul 8, 2022 at 3:57 PM Hans Vasquez-Gross <hva...@un...>
wrote:

> Hello JBrowse2 team,
>
> I am working on a new project and need to load BAM/CRAM files to JBrowse2
> to visualize the methylation data.  I have mapped the reads with bismark,
> then converted the sorted.bam file to cram and added the track.
>
> However, when I go to the track and Pileup Settings ->  the color-scheme
> ->  Methylation, the cram file fails to load with the error:
> "Error:operation timed out, worker process stopped responding, Error:
> Timeout exceeded for RPC method "ping"."
>
>
> However, the pileup visualization works fine in normal view.  See example
> screenshot below:
>
>
>
> Looking back at the documentation, I noticed that the instructions say
> there needs to be MM tags for the methylation functionality to work.
> However, looking at the bismark bam/cram output files, I don't see an MM
> tag.
>
>
> 3 Example CRAM lines:
> J00113:351:HMW3GBBXX:2:2123:15432:48104_1:N:0:TATAAT    16      Chr01
> 470     32      100M    *       0       0
> AATAACCAAAAACAAACTCATATTCCTAATTAACAACCACTTACTATCAAAAATTACTACACATATCCTAAAAATTAATCTAACACAAATACTTTAACCA
>
>  JJJJFJJJJJJJJJJFJJJFJJJJJJJJJJJJFJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA
>
>  XM:Z:hh.hh..z.h.........z.h.....x...hh..x......h..x....h....h..x.............h....h.........x..h....hh..z
>       XR:Z:CT XG:Z:GA
> MD:Z:0G0G1G0G2G1G9G1G5G3G0G2G6G2G4G4G2G13G4G9G2G4G0G2G0 NM:i:24
> J00113:351:HMW3GBBXX:2:2224:6167:3143_1:N:0:TATAAT      16      Chr01
> 470     15      100M    *       0       0
> AATAACCAAAAACAAACTCATATTCCTAATTAACAACCACTTACTATCAAAAACTACTACACATATCCTAAAAATTAATCTAACACAAATACTTTAACCA
>
>  JJJJJJJJJJFAFFA<JJJFJJJJJJJFJJJJJFF<JF7JJJJJJJJJJF<FAJJFJF-F7F7JJJJJJJJFFAJJFAJFA7JFFJJJJF-J<JJFFFAA
>
>  XM:Z:hh.hh..z.h.........z.h.....x...hh..x......h..x....h....h..x.............h....h.........x..h....hh..z
>       XR:Z:CT XG:Z:GA
> MD:Z:0G0G1G0G2G1G9G1G5G3G0G2G6G2G4G2T1G2G13G4G9G2G4G0G2G0       NM:i:25
> J00113:351:HMW3GBBXX:2:1203:16944:41721_1:N:0:TATAAT    16      Chr01
> 663     32      100M    *       0       0
> ACTCACCTTAAAAACACTTACCATACACAACAAAAACAAACTTCTAACCTTAATTAACTAATTCTTACCACCAAAACCTACATCTATAAAAAAAAACCCA
>
>  JJJJFJJJJJJJJFFFJJJJJJJJJJJJJJJJJFJFJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAFFFAA
>
>  XM:Z:.........h.........h....h.z.zx...............xh....h...hh..xh.....h.......h....x.........h...h.....z
>       XR:Z:CT XG:Z:GA MD:Z:9G9G4G1G1G0G15G0G4G3G0G2G0G5G7G4G9G3G5G0
> NM:i:19
>
>
> Any advice would be greatly appreciated.
>
> Thank you,
> -Hans
>
>
> --
>
>
>
> [image: signature_998258195]
>
> *Hans Vasquez-Gross, Ph.D*
>
> Bioinformatics Scientist,
> Nevada Bioinformatics Center
>
> https://www.unr.edu/bioinformatics
>
> hva...@un...
>
> _______________________________________________
> Gmod-ajax mailing list
> Gmo...@li...
> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>

[Gmod-ajax] Loading Bismark Methylation CRAM files to JBrowse2

[Hans Vasquez-G. <hva...@un...>]

Hello JBrowse2 team,

I am working on a new project and need to load BAM/CRAM files to JBrowse2 to visualize the methylation data.  I have mapped the reads with bismark, then converted the sorted.bam file to cram and added the track.

However, when I go to the track and Pileup Settings ->  the color-scheme ->  Methylation, the cram file fails to load with the error: "Error:operation timed out, worker process stopped responding, Error: Timeout exceeded for RPC method "ping"."


However, the pileup visualization works fine in normal view.  See example screenshot below:
[cid:d6fecea8-22cd-46a8-8e0b-341c946dcdfe]


Looking back at the documentation, I noticed that the instructions say there needs to be MM tags for the methylation functionality to work.  However, looking at the bismark bam/cram output files, I don't see an MM tag.


3 Example CRAM lines:
J00113:351:HMW3GBBXX:2:2123:15432:48104_1:N:0:TATAAT    16      Chr01   470     32      100M    *       0       0       AATAACCAAAAACAAACTCATATTCCTAATTAACAACCACTTACTATCAAAAATTACTACACATATCCTAAAAATTAATCTAACACAAATACTTTAACCA    JJJJFJJJJJJJJJJFJJJFJJJJJJJJJJJJFJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFAA    XM:Z:hh.hh..z.h.........z.h.....x...hh..x......h..x....h....h..x.............h....h.........x..h....hh..z       XR:Z:CT XG:Z:GA MD:Z:0G0G1G0G2G1G9G1G5G3G0G2G6G2G4G4G2G13G4G9G2G4G0G2G0 NM:i:24
J00113:351:HMW3GBBXX:2:2224:6167:3143_1:N:0:TATAAT      16      Chr01   470     15      100M    *       0       0       AATAACCAAAAACAAACTCATATTCCTAATTAACAACCACTTACTATCAAAAACTACTACACATATCCTAAAAATTAATCTAACACAAATACTTTAACCA    JJJJJJJJJJFAFFA<JJJFJJJJJJJFJJJJJFF<JF7JJJJJJJJJJF<FAJJFJF-F7F7JJJJJJJJFFAJJFAJFA7JFFJJJJF-J<JJFFFAA    XM:Z:hh.hh..z.h.........z.h.....x...hh..x......h..x....h....h..x.............h....h.........x..h....hh..z       XR:Z:CT XG:Z:GA MD:Z:0G0G1G0G2G1G9G1G5G3G0G2G6G2G4G2T1G2G13G4G9G2G4G0G2G0       NM:i:25
J00113:351:HMW3GBBXX:2:1203:16944:41721_1:N:0:TATAAT    16      Chr01   663     32      100M    *       0       0       ACTCACCTTAAAAACACTTACCATACACAACAAAAACAAACTTCTAACCTTAATTAACTAATTCTTACCACCAAAACCTACATCTATAAAAAAAAACCCA    JJJJFJJJJJJJJFFFJJJJJJJJJJJJJJJJJFJFJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJAFFFAA    XM:Z:.........h.........h....h.z.zx...............xh....h...hh..xh.....h.......h....x.........h...h.....z       XR:Z:CT XG:Z:GA MD:Z:9G9G4G1G1G0G15G0G4G3G0G2G0G5G7G4G9G3G5G0   NM:i:19


Any advice would be greatly appreciated.

Thank you,
-Hans



--



[signature_998258195]

Hans Vasquez-Gross, Ph.D

Bioinformatics Scientist,
Nevada Bioinformatics Center

https://www.unr.edu/bioinformatics

hva...@un...<mailto:hva...@un...>

Re: [Gmod-ajax] GFF Sequence information?

[Colin <col...@gm...>]

Glad to see you got the first issues fixed. I think the duplicated features
are because the mRNA does not have the gene feature as it's parent, so it
thinks the gene and mRNA are separate features



-Colin

On Fri, Jun 24, 2022 at 2:07 PM Hans Vasquez-Gross <hva...@un...>
wrote:

> I figured out the solution for both problems. The first no sequence on
> feature issue was because Prokka only outputs CDS by default.  I added
> "addmrnas" and "addgenes" option to include that in the gff output.
> However, now I have two features rendered in JBrowse for each real gene.
> Additionally, only the "_mRNA" features have sequence information
> accessible. The "_gene" features do not include the sequence information.
>
>
>
>
>
> Could the doubling be because of the order of the GFF3 entries? Here is an
> excerpt.
>
>
> NODE_1_length_179360_cov_384.200694     Prodigal:2.6    CDS     115
> 531     .       +       0
> ID=legionella_00001;Parent=legionella_00001_gene,legionella_00001_mRNA;Name=fur;gene=fur;inference=ab
> initio prediction:Prodigal:2.6,similar to AA
> sequence:GCF_004564155.1_ASM456415v1_2.gb:QBR83193.1;locus_tag=legionella_00001;product=ferric
> iron uptake transcriptional regulator
> NODE_1_length_179360_cov_384.200694     prokka  gene    115     531     .
>       +       .
> ID=legionella_00001_gene;Name=fur;gene=fur;locus_tag=legionella_00001
> NODE_1_length_179360_cov_384.200694     prokka  mRNA    115     531     .
>       +       .
> ID=legionella_00001_mRNA;Name=fur;gene=fur;locus_tag=legionella_00001
> NODE_1_length_179360_cov_384.200694     Prodigal:2.6    CDS     549
> 2003    .       -       0
> ID=legionella_00002;Parent=legionella_00002_gene,legionella_00002_mRNA;inference=ab
> initio prediction:Prodigal:2.6,similar to AA
> sequence:GCF_004564155.1_ASM456415v1_2.gb:QBR85014.1;locus_tag=legionella_00002;product=adenylate/guanylate
> cyclase domain-containing protein
> NODE_1_length_179360_cov_384.200694     prokka  gene    549     2003    .
>       -       .       ID=legionella_00002_gene;locus_tag=legionella_00002
> NODE_1_length_179360_cov_384.200694     prokka  mRNA    549     2003    .
>       -       .       ID=legionella_00002_mRNA;locus_tag=legionella_00002
> NODE_1_length_179360_cov_384.200694     Prodigal:2.6    CDS     2133
>  2897    .       +       0
> ID=legionella_00003;Parent=legionella_00003_gene,legionella_00003_mRNA;inference=ab
> initio prediction:Prodigal:2.6,similar to AA
> sequence:GCF_004564155.1_ASM456415v1_2.gb:QBR85013.1;locus_tag=legionella_00003;product=MBL
> fold metallo-hydrolase
> NODE_1_length_179360_cov_384.200694     prokka  gene    2133    2897    .
>       +       .       ID=legionella_00003_gene;locus_tag=legionella_00003
> NODE_1_length_179360_cov_384.200694     prokka  mRNA    2133    2897    .
>       +       .       ID=legionella_00003_mRNA;locus_tag=legionella_00003
>
>
> The 403 error on the Sorghum genome had incorrect permissions on the
> webserver which was easily fixed.
>
> Thank you,
> -Hans
> ------------------------------
> *From:* Hans Vasquez-Gross <hva...@un...>
> *Sent:* Friday, June 24, 2022 9:47 AM
> *To:* gmo...@li... <gmo...@li...>
> *Subject:* [Gmod-ajax] GFF Sequence information?
>
> I am using jbrowse2 to setup a new bacterial genome assembly.  However, I
> noticed when I click on a GFF feature, I don't have the option to
> download/copy the sequence.
>
>
> I went to check the behavior on another genome I loaded. This genome has a
> 403 forbidden error.
>
>
>
> Any ideas why these two issues would be occurring?
>
> Thank you,
> -Hans
>
>
> --
>
>
>
> [image: signature_998258195]
>
> *Hans Vasquez-Gross, Ph.D*
>
> Bioinformatics Scientist,
> Nevada Bioinformatics Center
>
> https://www.unr.edu/bioinformatics
>
> hva...@un...
>
> _______________________________________________
> Gmod-ajax mailing list
> Gmo...@li...
> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>

Re: [Gmod-ajax] GFF Sequence information?

[Hans Vasquez-G. <hva...@un...>]

I figured out the solution for both problems. The first no sequence on feature issue was because Prokka only outputs CDS by default.  I added "addmrnas" and "addgenes" option to include that in the gff output.  However, now I have two features rendered in JBrowse for each real gene. Additionally, only the "_mRNA" features have sequence information accessible. The "_gene" features do not include the sequence information.


[cid:8c19c51c-b77c-4062-b7c2-eb6fe0d4ae57]


Could the doubling be because of the order of the GFF3 entries? Here is an excerpt.


NODE_1_length_179360_cov_384.200694     Prodigal:2.6    CDS     115     531     .       +       0       ID=legionella_00001;Parent=legionella_00001_gene,legionella_00001_mRNA;Name=fur;gene=fur;inference=ab initio prediction:Prodigal:2.6,similar to AA sequence:GCF_004564155.1_ASM456415v1_2.gb:QBR83193.1;locus_tag=legionella_00001;product=ferric iron uptake transcriptional regulator
NODE_1_length_179360_cov_384.200694     prokka  gene    115     531     .       +       .       ID=legionella_00001_gene;Name=fur;gene=fur;locus_tag=legionella_00001
NODE_1_length_179360_cov_384.200694     prokka  mRNA    115     531     .       +       .       ID=legionella_00001_mRNA;Name=fur;gene=fur;locus_tag=legionella_00001
NODE_1_length_179360_cov_384.200694     Prodigal:2.6    CDS     549     2003    .       -       0       ID=legionella_00002;Parent=legionella_00002_gene,legionella_00002_mRNA;inference=ab initio prediction:Prodigal:2.6,similar to AA sequence:GCF_004564155.1_ASM456415v1_2.gb:QBR85014.1;locus_tag=legionella_00002;product=adenylate/guanylate cyclase domain-containing protein
NODE_1_length_179360_cov_384.200694     prokka  gene    549     2003    .       -       .       ID=legionella_00002_gene;locus_tag=legionella_00002
NODE_1_length_179360_cov_384.200694     prokka  mRNA    549     2003    .       -       .       ID=legionella_00002_mRNA;locus_tag=legionella_00002
NODE_1_length_179360_cov_384.200694     Prodigal:2.6    CDS     2133    2897    .       +       0       ID=legionella_00003;Parent=legionella_00003_gene,legionella_00003_mRNA;inference=ab initio prediction:Prodigal:2.6,similar to AA sequence:GCF_004564155.1_ASM456415v1_2.gb:QBR85013.1;locus_tag=legionella_00003;product=MBL fold metallo-hydrolase
NODE_1_length_179360_cov_384.200694     prokka  gene    2133    2897    .       +       .       ID=legionella_00003_gene;locus_tag=legionella_00003
NODE_1_length_179360_cov_384.200694     prokka  mRNA    2133    2897    .       +       .       ID=legionella_00003_mRNA;locus_tag=legionella_00003


The 403 error on the Sorghum genome had incorrect permissions on the webserver which was easily fixed.

Thank you,
-Hans
________________________________
From: Hans Vasquez-Gross <hva...@un...>
Sent: Friday, June 24, 2022 9:47 AM
To: gmo...@li... <gmo...@li...>
Subject: [Gmod-ajax] GFF Sequence information?

I am using jbrowse2 to setup a new bacterial genome assembly.  However, I noticed when I click on a GFF feature, I don't have the option to download/copy the sequence.

[cid:627c23d8-28e3-4224-8372-bb9271ff4105]

I went to check the behavior on another genome I loaded. This genome has a 403 forbidden error.

[cid:c7ae85c1-4e5b-46a6-b9ae-0561e7be19a0]

Any ideas why these two issues would be occurring?

Thank you,
-Hans



--



[signature_998258195]

Hans Vasquez-Gross, Ph.D

Bioinformatics Scientist,
Nevada Bioinformatics Center

https://www.unr.edu/bioinformatics

hva...@un...<mailto:hva...@un...>

[Gmod-ajax] GFF Sequence information?

[Hans Vasquez-G. <hva...@un...>]

I am using jbrowse2 to setup a new bacterial genome assembly.  However, I noticed when I click on a GFF feature, I don't have the option to download/copy the sequence.

[cid:627c23d8-28e3-4224-8372-bb9271ff4105]

I went to check the behavior on another genome I loaded. This genome has a 403 forbidden error.

[cid:c7ae85c1-4e5b-46a6-b9ae-0561e7be19a0]

Any ideas why these two issues would be occurring?

Thank you,
-Hans



--



[signature_998258195]

Hans Vasquez-Gross, Ph.D

Bioinformatics Scientist,
Nevada Bioinformatics Center

https://www.unr.edu/bioinformatics

hva...@un...<mailto:hva...@un...>

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Chen X. <xi...@ev...>]

Hi Colin,

It works! Thank you very much, and look forward to your updates on LinearArcDisplay and bigInteract in future.

Best wishes,
Chen




----- 原始邮件 -----
发件人: "Colin" <col...@gm...>
收件人: "Chen Xie" <xi...@ev...>
抄送: "gmod-ajax" <gmo...@li...>
发送时间: 星期五, 2022年 6 月 24日 下午 2:07:36
主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

If I am reading the screenshot correctly, this is helpful to see.

The reason for the issue you are seeing is because jbrowse "synthesizes
child features" from the bigBed feature, and so you would actually want to
access the parent feature's itemRgb field.

Here is an example

get(parent(feature),'itemRgb')

This get's the parent feature's itemRgv field. Another helpful thing for
debugging you can try is

get(parent(log(feature)),'itemRgb')

This is exactly the same as above, but it console.log's the feature so you
can inspect it in the chrome devtools :)

Potentially we could transfer the parent feature data fields onto the child
feature to help with this case, or make a utility function that
automatically looks at current and parent feature or something like that.
Hope that helps though!


-Colin

On Thu, Jun 23, 2022 at 11:01 PM Chen Xie <xi...@ev...> wrote:

> Hi Colin,
>
> Thank you very much for your nice reply! But after trying a lot in the
> past days, I still have the same problem. As the example you can see in the
> attached picture, everything is blue including the ones should be red. The
> collumn name must be correct because I also tested with mouse over (see the
> red rectangels). Could you please help me to figure out the reason? Thanks
> again!
>
> Best wishes,
> Chen
>
>
>
>
> ----- 原始邮件 -----
> 发件人: "Colin" <col...@gm...>
> 收件人: "Chen Xie" <xi...@ev...>
> 抄送: "gmod-ajax" <gmo...@li...>
> 发送时间: 星期三, 2022年 6 月 22日 上午 2:02:04
> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>
> Hi Chen
> Great questions
>
> For the color callback, I think you have the right idea. The "field8" would
> be an autoassigned name if the columns of your bed file do not have names.
> If you have bigBed, you may have column names (they are often provided by
> an autoSql file). You can check the column names using bigBedInfo or the
> "About track" inside jbrowse 2. Then just swap out field8 for whatever the
> column name is. Let me know if this still has issues
>
> For the other questions
>
> 1) Looks like currently LinearArcDisplay does not have a color callback, we
> will add this!
> 2) I think bigInteract would be a great thing to try to make an example of
> for our docs. I think if you wanted to, you could load a bigInteract bigBed
> file, and use LinearArcDisplay, and it would generally work. The features
> of bigInteract that would be missing are the  "feet" (e.g. the lines at
> each end of arc here
> https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
> missing, and the interchromosomal indicators would not display
>
> -Colin
>
>
>
>
> On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
>
> > Dear Madam/Sir,
> >
> > We have installed your JBrowse 2 on our server to visualize our
> sequencing
> > data. Currently, we met a problem about coloring tabix-indexed BED or
> > bigBed tracks. We put RGB values at the 9th column, and tried by
> following "
> > https://github.com/GMOD/jbrowse-components/discussions/2561" and "
> > https://github.com/GMOD/jbrowse-components/discussions/2772", but it did
> > not work. Our configuration in "config.json" is similar to (we tested
> with
> > many small changes):
> >
> >       "displays": [
> >         {
> >           "type": "LinearBasicDisplay",
> >           "displayId": "color_test",
> >           "renderer": {
> >             "type": "SvgFeatureRenderer",
> >             "color1": "jexl:get(feature,
> 'field8')=='255,0,0'?'red':'blue'"
> >           }
> >         }
> >       ],
> >
> > With the codes above, it always shows blue color, even when the itemRgb
> > column is '255,0,0', and we also tried with 'field9', but it did not work
> > either. I guess that we did not put the correct name of the feature
> there.
> > Could you please help us on it?
> >
> > Here are two further quesions:
> >
> > 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also
> > color lines in this type of display?
> >
> > 2. We would like to visualize data in the format of UCSC interact ("
> > https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
> > actually similar to your LinearArcDisplay. Do you plan to support it?
> >
> > Thank you very much and look forward to your reply!
> >
> > Best wishes,
> > Chen Xie
> >
> >
> >
> >
> >
> > _______________________________________________
> > Gmod-ajax mailing list
> > Gmo...@li...
> > https://lists.sourceforge.net/lists/listinfo/gmod-ajax
> >

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Colin <col...@gm...>]

We also have considered making it use itemRgb field for coloring by default
too, if interested you can check out
https://github.com/GMOD/jbrowse-components/issues/1734

-Colin

On Fri, Jun 24, 2022 at 12:07 AM Colin <col...@gm...> wrote:

> If I am reading the screenshot correctly, this is helpful to see.
>
> The reason for the issue you are seeing is because jbrowse "synthesizes
> child features" from the bigBed feature, and so you would actually want to
> access the parent feature's itemRgb field.
>
> Here is an example
>
> get(parent(feature),'itemRgb')
>
> This get's the parent feature's itemRgv field. Another helpful thing for
> debugging you can try is
>
> get(parent(log(feature)),'itemRgb')
>
> This is exactly the same as above, but it console.log's the feature so you
> can inspect it in the chrome devtools :)
>
> Potentially we could transfer the parent feature data fields onto the
> child feature to help with this case, or make a utility function that
> automatically looks at current and parent feature or something like that.
> Hope that helps though!
>
>
> -Colin
>
> On Thu, Jun 23, 2022 at 11:01 PM Chen Xie <xi...@ev...> wrote:
>
>> Hi Colin,
>>
>> Thank you very much for your nice reply! But after trying a lot in the
>> past days, I still have the same problem. As the example you can see in the
>> attached picture, everything is blue including the ones should be red. The
>> collumn name must be correct because I also tested with mouse over (see the
>> red rectangels). Could you please help me to figure out the reason? Thanks
>> again!
>>
>> Best wishes,
>> Chen
>>
>>
>>
>>
>> ----- 原始邮件 -----
>> 发件人: "Colin" <col...@gm...>
>> 收件人: "Chen Xie" <xi...@ev...>
>> 抄送: "gmod-ajax" <gmo...@li...>
>> 发送时间: 星期三, 2022年 6 月 22日 上午 2:02:04
>> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>>
>> Hi Chen
>> Great questions
>>
>> For the color callback, I think you have the right idea. The "field8"
>> would
>> be an autoassigned name if the columns of your bed file do not have names.
>> If you have bigBed, you may have column names (they are often provided by
>> an autoSql file). You can check the column names using bigBedInfo or the
>> "About track" inside jbrowse 2. Then just swap out field8 for whatever the
>> column name is. Let me know if this still has issues
>>
>> For the other questions
>>
>> 1) Looks like currently LinearArcDisplay does not have a color callback,
>> we
>> will add this!
>> 2) I think bigInteract would be a great thing to try to make an example of
>> for our docs. I think if you wanted to, you could load a bigInteract
>> bigBed
>> file, and use LinearArcDisplay, and it would generally work. The features
>> of bigInteract that would be missing are the  "feet" (e.g. the lines at
>> each end of arc here
>> https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
>> missing, and the interchromosomal indicators would not display
>>
>> -Colin
>>
>>
>>
>>
>> On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
>>
>> > Dear Madam/Sir,
>> >
>> > We have installed your JBrowse 2 on our server to visualize our
>> sequencing
>> > data. Currently, we met a problem about coloring tabix-indexed BED or
>> > bigBed tracks. We put RGB values at the 9th column, and tried by
>> following "
>> > https://github.com/GMOD/jbrowse-components/discussions/2561" and "
>> > https://github.com/GMOD/jbrowse-components/discussions/2772", but it
>> did
>> > not work. Our configuration in "config.json" is similar to (we tested
>> with
>> > many small changes):
>> >
>> >       "displays": [
>> >         {
>> >           "type": "LinearBasicDisplay",
>> >           "displayId": "color_test",
>> >           "renderer": {
>> >             "type": "SvgFeatureRenderer",
>> >             "color1": "jexl:get(feature,
>> 'field8')=='255,0,0'?'red':'blue'"
>> >           }
>> >         }
>> >       ],
>> >
>> > With the codes above, it always shows blue color, even when the itemRgb
>> > column is '255,0,0', and we also tried with 'field9', but it did not
>> work
>> > either. I guess that we did not put the correct name of the feature
>> there.
>> > Could you please help us on it?
>> >
>> > Here are two further quesions:
>> >
>> > 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also
>> > color lines in this type of display?
>> >
>> > 2. We would like to visualize data in the format of UCSC interact ("
>> > https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
>> > actually similar to your LinearArcDisplay. Do you plan to support it?
>> >
>> > Thank you very much and look forward to your reply!
>> >
>> > Best wishes,
>> > Chen Xie
>> >
>> >
>> >
>> >
>> >
>> > _______________________________________________
>> > Gmod-ajax mailing list
>> > Gmo...@li...
>> > https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>> >
>
>

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Colin <col...@gm...>]

If I am reading the screenshot correctly, this is helpful to see.

The reason for the issue you are seeing is because jbrowse "synthesizes
child features" from the bigBed feature, and so you would actually want to
access the parent feature's itemRgb field.

Here is an example

get(parent(feature),'itemRgb')

This get's the parent feature's itemRgv field. Another helpful thing for
debugging you can try is

get(parent(log(feature)),'itemRgb')

This is exactly the same as above, but it console.log's the feature so you
can inspect it in the chrome devtools :)

Potentially we could transfer the parent feature data fields onto the child
feature to help with this case, or make a utility function that
automatically looks at current and parent feature or something like that.
Hope that helps though!


-Colin

On Thu, Jun 23, 2022 at 11:01 PM Chen Xie <xi...@ev...> wrote:

> Hi Colin,
>
> Thank you very much for your nice reply! But after trying a lot in the
> past days, I still have the same problem. As the example you can see in the
> attached picture, everything is blue including the ones should be red. The
> collumn name must be correct because I also tested with mouse over (see the
> red rectangels). Could you please help me to figure out the reason? Thanks
> again!
>
> Best wishes,
> Chen
>
>
>
>
> ----- 原始邮件 -----
> 发件人: "Colin" <col...@gm...>
> 收件人: "Chen Xie" <xi...@ev...>
> 抄送: "gmod-ajax" <gmo...@li...>
> 发送时间: 星期三, 2022年 6 月 22日 上午 2:02:04
> 主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks
>
> Hi Chen
> Great questions
>
> For the color callback, I think you have the right idea. The "field8" would
> be an autoassigned name if the columns of your bed file do not have names.
> If you have bigBed, you may have column names (they are often provided by
> an autoSql file). You can check the column names using bigBedInfo or the
> "About track" inside jbrowse 2. Then just swap out field8 for whatever the
> column name is. Let me know if this still has issues
>
> For the other questions
>
> 1) Looks like currently LinearArcDisplay does not have a color callback, we
> will add this!
> 2) I think bigInteract would be a great thing to try to make an example of
> for our docs. I think if you wanted to, you could load a bigInteract bigBed
> file, and use LinearArcDisplay, and it would generally work. The features
> of bigInteract that would be missing are the  "feet" (e.g. the lines at
> each end of arc here
> https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
> missing, and the interchromosomal indicators would not display
>
> -Colin
>
>
>
>
> On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
>
> > Dear Madam/Sir,
> >
> > We have installed your JBrowse 2 on our server to visualize our
> sequencing
> > data. Currently, we met a problem about coloring tabix-indexed BED or
> > bigBed tracks. We put RGB values at the 9th column, and tried by
> following "
> > https://github.com/GMOD/jbrowse-components/discussions/2561" and "
> > https://github.com/GMOD/jbrowse-components/discussions/2772", but it did
> > not work. Our configuration in "config.json" is similar to (we tested
> with
> > many small changes):
> >
> >       "displays": [
> >         {
> >           "type": "LinearBasicDisplay",
> >           "displayId": "color_test",
> >           "renderer": {
> >             "type": "SvgFeatureRenderer",
> >             "color1": "jexl:get(feature,
> 'field8')=='255,0,0'?'red':'blue'"
> >           }
> >         }
> >       ],
> >
> > With the codes above, it always shows blue color, even when the itemRgb
> > column is '255,0,0', and we also tried with 'field9', but it did not work
> > either. I guess that we did not put the correct name of the feature
> there.
> > Could you please help us on it?
> >
> > Here are two further quesions:
> >
> > 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also
> > color lines in this type of display?
> >
> > 2. We would like to visualize data in the format of UCSC interact ("
> > https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
> > actually similar to your LinearArcDisplay. Do you plan to support it?
> >
> > Thank you very much and look forward to your reply!
> >
> > Best wishes,
> > Chen Xie
> >
> >
> >
> >
> >
> > _______________________________________________
> > Gmod-ajax mailing list
> > Gmo...@li...
> > https://lists.sourceforge.net/lists/listinfo/gmod-ajax
> >

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Chen X. <xi...@ev...>]

Hi Colin,

Thank you very much for your nice reply! But after trying a lot in the past days, I still have the same problem. As the example you can see in the attached picture, everything is blue including the ones should be red. The collumn name must be correct because I also tested with mouse over (see the red rectangels). Could you please help me to figure out the reason? Thanks again!

Best wishes,
Chen




----- 原始邮件 -----
发件人: "Colin" <col...@gm...>
收件人: "Chen Xie" <xi...@ev...>
抄送: "gmod-ajax" <gmo...@li...>
发送时间: 星期三, 2022年 6 月 22日 上午 2:02:04
主题: Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

Hi Chen
Great questions

For the color callback, I think you have the right idea. The "field8" would
be an autoassigned name if the columns of your bed file do not have names.
If you have bigBed, you may have column names (they are often provided by
an autoSql file). You can check the column names using bigBedInfo or the
"About track" inside jbrowse 2. Then just swap out field8 for whatever the
column name is. Let me know if this still has issues

For the other questions

1) Looks like currently LinearArcDisplay does not have a color callback, we
will add this!
2) I think bigInteract would be a great thing to try to make an example of
for our docs. I think if you wanted to, you could load a bigInteract bigBed
file, and use LinearArcDisplay, and it would generally work. The features
of bigInteract that would be missing are the  "feet" (e.g. the lines at
each end of arc here
https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
missing, and the interchromosomal indicators would not display

-Colin




On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:

> Dear Madam/Sir,
>
> We have installed your JBrowse 2 on our server to visualize our sequencing
> data. Currently, we met a problem about coloring tabix-indexed BED or
> bigBed tracks. We put RGB values at the 9th column, and tried by following "
> https://github.com/GMOD/jbrowse-components/discussions/2561" and "
> https://github.com/GMOD/jbrowse-components/discussions/2772", but it did
> not work. Our configuration in "config.json" is similar to (we tested with
> many small changes):
>
>       "displays": [
>         {
>           "type": "LinearBasicDisplay",
>           "displayId": "color_test",
>           "renderer": {
>             "type": "SvgFeatureRenderer",
>             "color1": "jexl:get(feature, 'field8')=='255,0,0'?'red':'blue'"
>           }
>         }
>       ],
>
> With the codes above, it always shows blue color, even when the itemRgb
> column is '255,0,0', and we also tried with 'field9', but it did not work
> either. I guess that we did not put the correct name of the feature there.
> Could you please help us on it?
>
> Here are two further quesions:
>
> 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also
> color lines in this type of display?
>
> 2. We would like to visualize data in the format of UCSC interact ("
> https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
> actually similar to your LinearArcDisplay. Do you plan to support it?
>
> Thank you very much and look forward to your reply!
>
> Best wishes,
> Chen Xie
>
>
>
>
>
> _______________________________________________
> Gmod-ajax mailing list
> Gmo...@li...
> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Scott C. <sc...@sc...>]

About the interchromosomal interactions: it would be really cool if the
circular view could be adapted to display those!

On Tue, Jun 21, 2022 at 4:40 PM Colin <col...@gm...> wrote:

> Small correction, you can actually specify the color callback for
> LinearArcDisplay in the config.json in current versions, but it just isn't
> visible as a callback in the UI
>
> Will be fixed in next version now
>
> -Colin
>
> On Tue, Jun 21, 2022 at 12:02 PM Colin <col...@gm...> wrote:
>
>> Hi Chen
>> Great questions
>>
>> For the color callback, I think you have the right idea. The "field8"
>> would be an autoassigned name if the columns of your bed file do not have
>> names. If you have bigBed, you may have column names (they are often
>> provided by an autoSql file). You can check the column names using
>> bigBedInfo or the "About track" inside jbrowse 2. Then just swap out field8
>> for whatever the column name is. Let me know if this still has issues
>>
>> For the other questions
>>
>> 1) Looks like currently LinearArcDisplay does not have a color callback,
>> we will add this!
>> 2) I think bigInteract would be a great thing to try to make an example
>> of for our docs. I think if you wanted to, you could load a bigInteract
>> bigBed file, and use LinearArcDisplay, and it would generally work. The
>> features of bigInteract that would be missing are the  "feet" (e.g. the
>> lines at each end of arc here
>> https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
>> missing, and the interchromosomal indicators would not display
>>
>> -Colin
>>
>>
>>
>>
>> On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
>>
>>> Dear Madam/Sir,
>>>
>>> We have installed your JBrowse 2 on our server to visualize our
>>> sequencing data. Currently, we met a problem about coloring tabix-indexed
>>> BED or bigBed tracks. We put RGB values at the 9th column, and tried by
>>> following "https://github.com/GMOD/jbrowse-components/discussions/2561"
>>> and "https://github.com/GMOD/jbrowse-components/discussions/2772", but
>>> it did not work. Our configuration in "config.json" is similar to (we
>>> tested with many small changes):
>>>
>>>       "displays": [
>>>         {
>>>           "type": "LinearBasicDisplay",
>>>           "displayId": "color_test",
>>>           "renderer": {
>>>             "type": "SvgFeatureRenderer",
>>>             "color1": "jexl:get(feature,
>>> 'field8')=='255,0,0'?'red':'blue'"
>>>           }
>>>         }
>>>       ],
>>>
>>> With the codes above, it always shows blue color, even when the itemRgb
>>> column is '255,0,0', and we also tried with 'field9', but it did not work
>>> either. I guess that we did not put the correct name of the feature there.
>>> Could you please help us on it?
>>>
>>> Here are two further quesions:
>>>
>>> 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also
>>> color lines in this type of display?
>>>
>>> 2. We would like to visualize data in the format of UCSC interact ("
>>> https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
>>> actually similar to your LinearArcDisplay. Do you plan to support it?
>>>
>>> Thank you very much and look forward to your reply!
>>>
>>> Best wishes,
>>> Chen Xie
>>>
>>>
>>>
>>>
>>>
>>> _______________________________________________
>>> Gmod-ajax mailing list
>>> Gmo...@li...
>>> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>>>
>> _______________________________________________
> Gmod-ajax mailing list
> Gmo...@li...
> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>


-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                                  scott
at scottcain dot net
GMOD Project Manager (http://gmod.org/)
216-392-3087
WormBase Developer (http://wormbase.org/)
Alliance of Genome Resources Group Leader (http://alliancegenome.org/)
VirusSeq Project Manager (https://virusseq-dataportal.ca/)
Human Cancer Models Initiative Project Manager (
https://hcmi-searchable-catalog.nci.nih.gov/)

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Colin <col...@gm...>]

Small correction, you can actually specify the color callback for
LinearArcDisplay in the config.json in current versions, but it just isn't
visible as a callback in the UI

Will be fixed in next version now

-Colin

On Tue, Jun 21, 2022 at 12:02 PM Colin <col...@gm...> wrote:

> Hi Chen
> Great questions
>
> For the color callback, I think you have the right idea. The "field8"
> would be an autoassigned name if the columns of your bed file do not have
> names. If you have bigBed, you may have column names (they are often
> provided by an autoSql file). You can check the column names using
> bigBedInfo or the "About track" inside jbrowse 2. Then just swap out field8
> for whatever the column name is. Let me know if this still has issues
>
> For the other questions
>
> 1) Looks like currently LinearArcDisplay does not have a color callback,
> we will add this!
> 2) I think bigInteract would be a great thing to try to make an example of
> for our docs. I think if you wanted to, you could load a bigInteract bigBed
> file, and use LinearArcDisplay, and it would generally work. The features
> of bigInteract that would be missing are the  "feet" (e.g. the lines at
> each end of arc here
> https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
> missing, and the interchromosomal indicators would not display
>
> -Colin
>
>
>
>
> On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:
>
>> Dear Madam/Sir,
>>
>> We have installed your JBrowse 2 on our server to visualize our
>> sequencing data. Currently, we met a problem about coloring tabix-indexed
>> BED or bigBed tracks. We put RGB values at the 9th column, and tried by
>> following "https://github.com/GMOD/jbrowse-components/discussions/2561"
>> and "https://github.com/GMOD/jbrowse-components/discussions/2772", but
>> it did not work. Our configuration in "config.json" is similar to (we
>> tested with many small changes):
>>
>>       "displays": [
>>         {
>>           "type": "LinearBasicDisplay",
>>           "displayId": "color_test",
>>           "renderer": {
>>             "type": "SvgFeatureRenderer",
>>             "color1": "jexl:get(feature,
>> 'field8')=='255,0,0'?'red':'blue'"
>>           }
>>         }
>>       ],
>>
>> With the codes above, it always shows blue color, even when the itemRgb
>> column is '255,0,0', and we also tried with 'field9', but it did not work
>> either. I guess that we did not put the correct name of the feature there.
>> Could you please help us on it?
>>
>> Here are two further quesions:
>>
>> 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also
>> color lines in this type of display?
>>
>> 2. We would like to visualize data in the format of UCSC interact ("
>> https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
>> actually similar to your LinearArcDisplay. Do you plan to support it?
>>
>> Thank you very much and look forward to your reply!
>>
>> Best wishes,
>> Chen Xie
>>
>>
>>
>>
>>
>> _______________________________________________
>> Gmod-ajax mailing list
>> Gmo...@li...
>> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>>
>

Re: [Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Colin <col...@gm...>]

Hi Chen
Great questions

For the color callback, I think you have the right idea. The "field8" would
be an autoassigned name if the columns of your bed file do not have names.
If you have bigBed, you may have column names (they are often provided by
an autoSql file). You can check the column names using bigBedInfo or the
"About track" inside jbrowse 2. Then just swap out field8 for whatever the
column name is. Let me know if this still has issues

For the other questions

1) Looks like currently LinearArcDisplay does not have a color callback, we
will add this!
2) I think bigInteract would be a great thing to try to make an example of
for our docs. I think if you wanted to, you could load a bigInteract bigBed
file, and use LinearArcDisplay, and it would generally work. The features
of bigInteract that would be missing are the  "feet" (e.g. the lines at
each end of arc here
https://genome.ucsc.edu/images/interactUnderstanding2.png) would be
missing, and the interchromosomal indicators would not display

-Colin




On Tue, Jun 21, 2022 at 12:52 AM Chen Xie <xi...@ev...> wrote:

> Dear Madam/Sir,
>
> We have installed your JBrowse 2 on our server to visualize our sequencing
> data. Currently, we met a problem about coloring tabix-indexed BED or
> bigBed tracks. We put RGB values at the 9th column, and tried by following "
> https://github.com/GMOD/jbrowse-components/discussions/2561" and "
> https://github.com/GMOD/jbrowse-components/discussions/2772", but it did
> not work. Our configuration in "config.json" is similar to (we tested with
> many small changes):
>
>       "displays": [
>         {
>           "type": "LinearBasicDisplay",
>           "displayId": "color_test",
>           "renderer": {
>             "type": "SvgFeatureRenderer",
>             "color1": "jexl:get(feature, 'field8')=='255,0,0'?'red':'blue'"
>           }
>         }
>       ],
>
> With the codes above, it always shows blue color, even when the itemRgb
> column is '255,0,0', and we also tried with 'field9', but it did not work
> either. I guess that we did not put the correct name of the feature there.
> Could you please help us on it?
>
> Here are two further quesions:
>
> 1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also
> color lines in this type of display?
>
> 2. We would like to visualize data in the format of UCSC interact ("
> https://genome.ucsc.edu/goldenPath/help/interact.html"), which is
> actually similar to your LinearArcDisplay. Do you plan to support it?
>
> Thank you very much and look forward to your reply!
>
> Best wishes,
> Chen Xie
>
>
>
>
>
> _______________________________________________
> Gmod-ajax mailing list
> Gmo...@li...
> https://lists.sourceforge.net/lists/listinfo/gmod-ajax
>

[Gmod-ajax] About coloring tabix-indexed BED or bigBed tracks

[Chen X. <xi...@ev...>]

Dear Madam/Sir,

We have installed your JBrowse 2 on our server to visualize our sequencing data. Currently, we met a problem about coloring tabix-indexed BED or bigBed tracks. We put RGB values at the 9th column, and tried by following "https://github.com/GMOD/jbrowse-components/discussions/2561" and "https://github.com/GMOD/jbrowse-components/discussions/2772", but it did not work. Our configuration in "config.json" is similar to (we tested with many small changes):

      "displays": [
        {
          "type": "LinearBasicDisplay",
          "displayId": "color_test",
          "renderer": {
            "type": "SvgFeatureRenderer",
            "color1": "jexl:get(feature, 'field8')=='255,0,0'?'red':'blue'"
          }
        }
      ],

With the codes above, it always shows blue color, even when the itemRgb column is '255,0,0', and we also tried with 'field9', but it did not work either. I guess that we did not put the correct name of the feature there. Could you please help us on it?

Here are two further quesions:

1. It is great to have this "LinearArcDisplay" in JBrowse 2, can we also color lines in this type of display?

2. We would like to visualize data in the format of UCSC interact ("https://genome.ucsc.edu/goldenPath/help/interact.html"), which is actually similar to your LinearArcDisplay. Do you plan to support it?

Thank you very much and look forward to your reply!

Best wishes,
Chen Xie

Re: [Gmod-ajax] Dataset selector in apollo

[Justin E. <jus...@or...>]

<html><head>
<meta http-equiv="Content-Type" content="text/html; charset=utf-8">
  </head>
  <body>
    So, it definitely seems to be alphanumeric by the dataset_id. I
    temporarily changed the Minghui63 id to 556 in both jbrowse.conf and
    data/minghui63/tracks.conf and it is in the order I want. But, of
    course, that breaks apollo.<br>
    <br>
    Because you asked though, here is the relevant bits of jbrowse.conf:<br>
    <font face="monospace">[datasets.34]<br>
      url = ?data=data/nipponbare<br>
      name = Nipponbare<br>
      [datasets.51]<br>
      url = ?data=data/arc<br>
      name = ARC<br>
      [datasets.101]<br>
      url = ?data=data/azucena<br>
      name = Azucena<br>
      [datasets.141]<br>
      url = ?data=data/chaomeo<br>
      name = Chao meo<br>
      [datasets.225]<br>
      url = ?data=data/gobolsailbalam<br>
      name = Gobol Sail Balam<br>
      [datasets.253]<br>
      url = ?data=data/ir64<br>
      name = IR64<br>
      [datasets.276]<br>
      url = ?data=data/ketan_nangka<br>
      name = Ketan Nangka<br>
      [datasets.304]<br>
      url = ?data=data/khao_yai_guang<br>
      name = Khao Yai Guang<br>
      [datasets.332]<br>
      url = ?data=data/larhamugad<br>
      name = Larha Mugad<br>
      [datasets.377]<br>
      url = ?data=data/lima<br>
      name = Lima<br>
      [datasets.473]<br>
      url = ?data=data/liuxu<br>
      name = Liu Xu<br>
      [datasets.1256]<br>
      url = ?data=data/minghui63<br>
      name = Minghui63<br>
      [datasets.1051]<br>
      url = ?data=data/nagina22<br>
      name = Nagina 22<br>
      [datasets.1159]<br>
      url = ?data=data/natelboro<br>
      name = Natel Boro<br>
      [datasets.1181]<br>
      url = ?data=data/pr106<br>
      name = PR106<br>
      [datasets.1224]<br>
      url = ?data=data/zhenshan97<br>
      name = Zhenshan97<br>
      <br>
    </font>And data/minghui63/tracks.conf:<br>
    <font face="monospace">[general]<br>
      dataset_id = 1256</font><br>
    <font face="monospace"></font><br>
    So, I guess the only way I can think of to change this is if it is
    possible to change the apollo id from 1256 to something between 473
    and 1051. But I'm guessing the reason that it jumps is that those
    IDs are being used for something else internally.<br>
    <br>
    This is only a superficial issue, just something I was hoping to
    clean up.<br>
    <br>
    I should also point out, Apollo has the dropdown selector in the top
    left, and that matches the order they are in jbrowse, but on the
    right side, they are purely in alphabetical order, so the order
    doesn't match.<br>
    <img src="cid:par...@or..." alt=""><br>
    <br>
    <img src="cid:par...@or..." alt=""><br>
    <br>
    Thanks,<br>
    Justin<br>
    <br>
    <div class="moz-cite-prefix">On 6/1/22 3:52 PM, Colin wrote:<br>
    </div>
    <blockquote type="cite" cite="mid:CA+ZENaL=U_0...@ma...">
      
      <p><span style="color:#D73F09;">[This email originated from
          outside of OSU. Use caution with links and attachments.]</span></p>
      <div>
        <div dir="ltr">From my quick testing, I think the order in which
          they are specified in the jbrowse.conf is the order in which
          they will be listed in the Genome menu. I cannot guarantee
          this would be the same situation for Apollo and am not aware
          of any custom config to help this ordering in Apollo.
          <div><br>
          </div>
          <div>If you have an example jbrowse.conf config where it
            doesn't seem to be doing this in JBrowse though, feel free
            to post</div>
          <div><br>
          </div>
          <div><br>
          </div>
          <div>-Colin</div>
        </div>
        <br>
        <div class="gmail_quote">
          <div dir="ltr" class="gmail_attr">On Wed, Jun 1, 2022 at 12:30
            PM Justin Elser &lt;<a href="mailto:jus...@or..." moz-do-not-send="true" class="moz-txt-link-freetext">jus...@or...</a>&gt;
            wrote:<br>
          </div>
          <blockquote class="gmail_quote" style="margin:0px 0px 0px
            0.8ex;border-left:1px solid
            rgb(204,204,204);padding-left:1ex">
            <div>So, this is hopefully an easy question, and I may have
              just missed it in the documentation, but is there a way to
              change the order in which the datasets show up in the
              genome selector?<br>
              <br>
              It looks like they get added in the order in which they
              were added, or possibly alphanumeric by dataset_id?<br>
              <br>
              In the below screenshot, I'd like Minghui63 to be between
              Liu Xu and Nagina 22, but since it is the last one I
              added, it shows up last. I have it where I want it in the
              jbrowse.conf file, but it still shows up last. I don't
              totally want them in alphabetical order, as I would like
              Nipponbare to be first.<br>
              <img src="cid:par...@or..." alt="" class="" width="926" height="559"><br>
              Is it possible to change this?<br>
              <br>
              Thanks,<br>
              Justin<br>
              <br>
              <div>On 5/26/22 2:05 PM, Colin wrote:<br>
              </div>
              <blockquote type="cite">
                <p><span style="color:rgb(215,63,9)">[This email
                    originated from outside of OSU. Use caution with
                    links and attachments.]</span></p>
                <div>
                  <div dir="ltr">&gt;Everything works as expected now! I
                    see both Nipponbare and ARC in the &quot;Genome&quot;
                    dropdown, and apollo is showing all data.<br>
                    <div><br>
                    </div>
                    <div>Excellent:)</div>
                    <div><br>
                    </div>
                    <div>&gt;So, I guess apollo is only using the
                      numeric ID for the dataset instead of using what I
                      tried to set the dataset id? In other words, if I
                      had [datasets.nipponbare] in jbrowse.conf and
                      dataset_id=nipponbare in
                      data/nipponbare/tracks.conf, that is fine for
                      jbrowse, but apollo is only using it's internal ID
                      of 34?</div>
                    <div><br>
                    </div>
                    <div>You can inspect the database for the IDs, or
                      you can get the ID from inside the URL clicking
                      the link icon, see screenshot attachment here. I
                      don't think you can change the organism ID to
                      something else like a readable name unfortunately.</div>
                    <div><br>
                    </div>
                    <div>-Colin</div>
                  </div>
                  <br>
                  <div class="gmail_quote">
                    <div dir="ltr" class="gmail_attr">On Thu, May 26,
                      2022 at 12:24 PM Justin Elser &lt;<a href="mailto:jus...@or..." target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">jus...@or...</a>&gt;
                      wrote:<br>
                    </div>
                    <blockquote class="gmail_quote" style="margin:0px
                      0px 0px 0.8ex;border-left:1px solid
                      rgb(204,204,204);padding-left:1ex">
                      <div>Ok, I think I get it. At least, I think I can
                        get it working but I am a bit confused.<br>
                        <br>
                        So, I noticed in the apollo docker logs that I
                        see this:<br>
                        2022-05-26 18:10:34,589 [http-nio-8080-exec-4]
                        DEBUG apollo.PreferenceService&nbsp; - found organism
                        in session org.bbop.apollo.Organism : 34 so
                        returning<br>
                        2022-05-26 18:10:34,589 [http-nio-8080-exec-4]
                        DEBUG apollo.JbrowseController&nbsp; - got organism
                        org.bbop.apollo.Organism : 34 for client token
                        137967108160676781264638533<br>
                        2022-05-26 18:10:34,649 [http-nio-8080-exec-1]
                        DEBUG apollo.AnnotationEditorController&nbsp; -
                        handleOperation annotationEditor
                        get_sequence_alterations -&gt;
                        getSequenceAlterations<br>
                        2022-05-26 18:10:34,650 [http-nio-8080-exec-1]
                        DEBUG apollo.PermissionService&nbsp; - dataObject
                        does not contain organism (may not be needed)<br>
                        2022-05-26 18:10:34,652 [http-nio-8080-exec-1]
                        DEBUG apollo.PreferenceService&nbsp; - found
                        in-memory preference:
{&quot;id&quot;:96,&quot;organism&quot;:{&quot;id&quot;:34,&quot;commonName&quot;:&quot;Nipponbare&quot;,&quot;directory&quot;:&quot;/data/nipponbare&quot;,&quot;annotationCount&quot;:null,&quot;variantEffectCount&quot;:null,&quot;officialGeneSetTrack&quot;:null},&quot;currentOrganism&quot;:true,&quot;nativeTrackList&quot;:true,&quot;sequence&quot;:{&quot;id&quot;:36,&quot;name&quot;:&quot;chr1&quot;,&quot;organism&quot;:{&quot;id&quot;:34,&quot;commonName&quot;:&quot;Nipponbare&quot;,&quot;directory&quot;:&quot;/data/nipponbare&quot;,&quot;annotationCount&quot;:null,&quot;variantEffectCount&quot;:null,&quot;officialGeneSetTrack&quot;:null},&quot;length&quot;:43270923,&quot;start&quot;:0,&quot;end&quot;:43270923},&quot;startbp&quot;:6587035,&quot;endbp&quot;:7241056,&quot;clientToken&quot;:&quot;137967108160676781264638533&quot;,&quot;user&quot;:{&quot;id&quot;:32,&quot;username&quot;:<a href="mailto:admin@local.host" target="_blank" moz-do-not-send="true">&quot;admin@local.host&quot;</a>}}<br>
                        <br>
                        So, it looks like the apollo &quot;id&quot; is 34 for
                        Nipponbare, and similarly 51 for ARC.<br>
                        <br>
                        So, I changed the jbrowse.conf to have:<br>
                        [datasets.34]<br>
                        url = ?data=data/nipponbare<br>
                        name = Nipponbare<br>
                        [datasets.51]<br>
                        url = ?data=data/arc<br>
                        name = ARC<br>
                        and data/nipponbare/tracks.conf to have:<br>
                        [general]<br>
                        dataset_id = 34<br>
                        <br>
                        and similar change for data/arc/tracks.conf.<br>
                        <br>
                        Everything works as expected now! I see both
                        Nipponbare and ARC in the &quot;Genome&quot; dropdown, and
                        apollo is showing all data.<br>
                        <br>
                        So, I guess apollo is only using the numeric ID
                        for the dataset instead of using what I tried to
                        set the dataset id? In other words, if I had
                        [datasets.nipponbare] in jbrowse.conf and
                        dataset_id=nipponbare in
                        data/nipponbare/tracks.conf, that is fine for
                        jbrowse, but apollo is only using it's internal
                        ID of 34?<br>
                        <br>
                        I guess I just don't understand why apollo isn't
                        seeing the dataset_id I'm trying to set in
                        jbrowse instead of seeing it's own ID.<br>
                        <br>
                        How can I see what ID apollo is going to use
                        without just checking the logs and seeing what
                        it looks for? Or can I force it somehow to use
                        nipponbare instead of 34?<br>
                        <br>
                        Thanks for the info on JBrowse2/Apollo3, I'll
                        watch for updates.<br>
                        <br>
                        Justin<br>
                        <br>
                        <div>On 5/26/22 11:00 AM, Colin wrote:<br>
                        </div>
                        <blockquote type="cite">
                          <p><span style="color:rgb(215,63,9)">[This
                              email originated from outside of OSU. Use
                              caution with links and attachments.]</span></p>
                          <div>
                            <div dir="ltr">
                              <div>The code that is crashing is probably
                                this, seeing renderDatasetSelector in
                                the stack trace</div>
                              <div><br>
                              </div>
                              <div><a href="https://github.com/GMOD/jbrowse/blob/fd7ebb8a0802db9e09ac34c70689e7a9cfccc615/src/JBrowse/Browser.js#L1214-L1216" originalsrc="https://github.com/GMOD/jbrowse/blob/fd7ebb8a0802db9e09ac34c70689e7a9cfccc615/src/JBrowse/Browser.js#L1214-L1216" shash="E4rBCDhvntfYmcPLoA4bTRk0ALPynaASLVv6ifsQS5i2x6Y8E7mmrc/N4PDm+R4+CwAUa2Or0bTagCEJzatbGOL0+mMDQhZSSMWieHxW6yoWVWM+H+nlNKo6Bq5yEdevnABEM6dVzFpOgxnoc7xUAiqaXEZWgcY+njYStd3UJsY=" title="Unmangled Microsoft Safelink" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">https://github.com/GMOD/jbrowse/blob/fd7ebb8a0802db9e09ac34c70689e7a9cfccc615/src/JBrowse/Browser.js#L1214-L1216</a><br>
                              </div>
                              <div><br>
                              </div>
                              Since it is crashing there, I think maybe
                              your manually configured datasets&nbsp;are not
                              matching the Apollo configuration of the
                              datasets.
                              <div><br>
                              </div>
                              <div>If you make them match up, it might
                                fix it, and to do that, you may be able
                                to make the dataset ID be the organism
                                ID that Apollo gives. Would have to
                                update both the datasets and the
                                dataset_id</div>
                              <div><br>
                              </div>
                              <div>This is where Apollo sets the
                                dataset_id, uses organism ID&nbsp;<a href="https://github.com/GMOD/Apollo/blob/1728c280f9a18bd22e07f8b4b9f00a8e24432358/grails-app/controllers/org/bbop/apollo/JbrowseController.groovy#L435-L440" originalsrc="https://github.com/GMOD/Apollo/blob/1728c280f9a18bd22e07f8b4b9f00a8e24432358/grails-app/controllers/org/bbop/apollo/JbrowseController.groovy#L435-L440" shash="vKbL9PbscdUO7l35HXh/JqaQeIlLTE1h9+z4oHYYI47fZabwq7kuTX3Ig9niURlQxgmE6FKRRsXb8jNlcssa+gZ4yLmG4+iLG/9NCQwSCvHI4PtvdiyjMvaiO2IkxNLRfMz6i0zY2DFlBH7JOg386BPsMK/YPrWrYdXVPq6F80A=" title="Unmangled Microsoft Safelink" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">https://github.com/GMOD/Apollo/blob/1728c280f9a18bd22e07f8b4b9f00a8e24432358/grails-app/controllers/org/bbop/apollo/JbrowseController.groovy#L435-L440</a><br>
                                <div><br>
                                </div>
                                <div>To be clear, the dataset ID is what
                                  is after the . in the conf format e.g.</div>
                                <div><br>
                                </div>
                                <div>[datasets.make_this_match_the_organismID]<br>
                                  url = ?data=data/nipponbare<br>
                                  name = Nipponbare<br>
                                </div>
                                <div><br>
                                </div>
                                <div><br>
                                </div>
                                <div>Also, the current generation of
                                  Apollo (Apollo 2) does not work with
                                  JBrowse 2, but we are working on a new
                                  Apollo version that will be integrated
                                  with JBrowse 2. It's not ready for use
                                  yet but you can keep an eye on&nbsp;<a href="https://github.com/GMOD/Apollo3" originalsrc="https://github.com/GMOD/Apollo3" shash="AgxOQvu5V1a6LPyQ2RkcjtIyow61Y/EnHlkyDlhQVvD1te6y8DflzHrrPXFUvEUQP2HWHcrAqIRcCKO3kr0auFit7rYkCZVFhplamnvwIPskskni+mZevmf/eNC2HYK94MvycXSTwLt827D3RuxmkJ4ypz3u7icElJCnEp7bvxY=" title="Unmangled Microsoft Safelink" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">https://github.com/GMOD/Apollo3</a>
                                  if interested</div>
                                <div><br>
                                </div>
                                <div>-Colin</div>
                                <div><br>
                                </div>
                                <div><br>
                                </div>
                              </div>
                            </div>
                            <br>
                            <div class="gmail_quote">
                              <div dir="ltr" class="gmail_attr">On Thu,
                                May 26, 2022 at 9:56 AM Justin Elser
                                &lt;<a href="mailto:jus...@or..." target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">jus...@or...</a>&gt;
                                wrote:<br>
                              </div>
                              <blockquote class="gmail_quote" style="margin:0px 0px 0px
                                0.8ex;border-left:1px solid
                                rgb(204,204,204);padding-left:1ex">
                                <div>I'm attaching the output from the
                                  chrome console. I don't think it's the
                                  non-minified version of the JS though.
                                  How would I get that with the docker
                                  version of apollo?<br>
                                  <br>
                                  Also, I've been asked to ask if Apollo
                                  works with JBrowse2? Would it be
                                  better to use that instead of
                                  JBrowse1?<br>
                                  <br>
                                  Thank you for taking the time to help
                                  me.<br>
                                  <br>
                                  Justin<br>
                                  <br>
                                  <div>On 5/25/22 4:51 PM, Colin wrote:<br>
                                  </div>
                                  <blockquote type="cite">
                                    <p><span style="color:rgb(215,63,9)">[This
                                        email originated from outside of
                                        OSU. Use caution with links and
                                        attachments.]</span></p>
                                    <div>
                                      <div dir="auto">The logs that are
                                        probably most helpful are the
                                        &quot;JavaScript console&quot; or
                                        developer console from chrome or
                                        firefox e.g.
                                        <a href="https://balsamiq.com/support/faqs/browserconsole/" originalsrc="https://balsamiq.com/support/faqs/browserconsole/" shash="PI4oU9UZOXMgBHhYJ3y1MSpDM0qF8WdVy2MWaCXhWDXT9HuWUKo7fqTP8aQSBNEmnQY2j4PT0QXEVUMIc3D0PDmee6WLeaAHMF/V4+mHcSZux+u26h++/Vi5Zw4Vr74ff8zjOVvITe9qPRpK+1IHLkXHsqGhnxeRR6ls8Ny0vbY=" rel="noreferrer" title="Unmangled Microsoft
                                          Safelink" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">
https://balsamiq.com/support/faqs/browserconsole/</a></div>
                                      <br>
                                      <div class="gmail_quote">
                                        <div dir="ltr" class="gmail_attr">On Wed, May
                                          25, 2022, 4:33 PM Justin Elser
                                          &lt;<a href="mailto:jus...@or..." rel="noreferrer noreferrer" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">jus...@or...</a>&gt;
                                          wrote:<br>
                                        </div>
                                        <blockquote class="gmail_quote" style="margin:0px 0px 0px
                                          0.8ex;border-left:1px solid
                                          rgb(204,204,204);padding-left:1ex">
                                          <div>We may just use Apollo to
                                            serve both, but thought I
                                            might give it a try to see
                                            about JBrowse.<br>
                                            <br>
                                            I am attaching the output I
                                            get when I run the docker
                                            container with &quot;-e
                                            WEBAPOLLO_DEBUG=true&quot;.<br>
                                            <br>
                                            The blank lines are in
                                            between it working and not
                                            working. IE, lines 1-483 are
                                            the initial startup and
                                            navigating to the site with
                                            Apollo working as expected.
                                            Lines 487 on are after
                                            changing
                                            data/nipponbare/tracks.conf
                                            to have:<br>
                                            [general]<br>
                                            dataset_id = nipponbare<br>
                                            <br>
                                            I do notice that after the
                                            change it is trying to open
/data/temporary/apollo_data/34-Nipponbare/sample_data/json/volvox/successfully_run
                                            (line 579) where it isn't
                                            before. I don't understand
                                            why it would be looking for
                                            the sample data at all. I
                                            never loaded it as a track
                                            or anything.<br>
                                            <br>
                                            I also notice for the
                                            initial load where it works
                                            that it is complaining about
                                            the mime_type for .bam
                                            files. I did alter the
                                            .htaccess for the jbrowse
                                            but not apollo, so I think
                                            those are fixable and
                                            unrelated. Weirdly enough,
                                            the bam track does load fine
                                            in Apollo where it didn't in
                                            JBrowse until I made the
                                            change to .htaccess.<br>
                                            <br>
                                            If you meant some other
                                            logs, please let me know how
                                            to get those and I will send
                                            them to you.<br>
                                            <br>
                                            Thanks,<br>
                                            Justin<br>
                                            <br>
                                            <div>On 5/25/22 2:18 PM,
                                              Colin wrote:<br>
                                            </div>
                                            <blockquote type="cite">
                                              <p><span style="color:rgb(215,63,9)">[This
                                                  email originated from
                                                  outside of OSU. Use
                                                  caution with links and
                                                  attachments.]</span></p>
                                              <div>
                                                <div dir="ltr">One
                                                  option is to use
                                                  Apollo to serve your
                                                  jbrowse instances,
                                                  Apollo can serve
                                                  public jbrowse
                                                  instances so you may
                                                  not need to configure
                                                  jbrowse separately
                                                  <div><br>
                                                  </div>
                                                  <div><br>
                                                    <div>If you do want
                                                      it separate, then
                                                      we would probably
                                                      need to debug that
                                                      error. If you have
                                                      the stack trace
                                                      from the developer
                                                      console, it might
                                                      narrow down
                                                      exactly where the
                                                      error comes from.
                                                      If the stack trace
                                                      is minified and
                                                      hard to read, can
                                                      possibly use a
                                                      &quot;dev&quot; version of
                                                      jbrowse if it is
                                                      too unreadable
                                                      since it does not
                                                      minify the builds!
                                                      <div><br>
                                                      </div>
                                                      <div><br>
                                                      </div>
                                                      <div><br>
                                                      </div>
                                                      <div>-Colin</div>
                                                    </div>
                                                  </div>
                                                </div>
                                                <br>
                                                <div class="gmail_quote">
                                                  <div dir="ltr" class="gmail_attr">On
                                                    Wed, May 25, 2022 at
                                                    1:03 PM Justin Elser
                                                    &lt;<a href="mailto:jus...@or..." rel="noreferrer
                                                      noreferrer
                                                      noreferrer" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">jus...@or...</a>&gt;
                                                    wrote:<br>
                                                  </div>
                                                  <blockquote class="gmail_quote" style="margin:0px
                                                    0px 0px
                                                    0.8ex;border-left:1px
                                                    solid
                                                    rgb(204,204,204);padding-left:1ex">
                                                    <div>Yeah, so I
                                                      guess the problem
                                                      is that if I don't
                                                      add the
                                                      &quot;dataset_id&quot; to
                                                      each
                                                      data/(species)/tracks.conf
                                                      file, apollo works
                                                      fine, but then I
                                                      can't get the
                                                      dataset selector
                                                      in jbrowse. As I
                                                      have it right now,
                                                      Apollo is fine,
                                                      but I have no way
                                                      to switch to a
                                                      different dataset
                                                      in JBrowse.<br>
                                                      <img alt="" moz-do-not-send="true" width="1073" height="648"><br>
                                                      <br>
                                                      I was messing
                                                      around with
                                                      jbrowse.conf,
                                                      data/tracks.conf,
                                                      and
                                                      data/(species)/tracks.conf,
                                                      and was able to
                                                      get a list of the
                                                      species under the
                                                      &quot;Genome&quot; tab. But
                                                      if I don't have
                                                      anything in
                                                      data/(species)/tracks.conf,
                                                      I don't. However,
                                                      if I do add it
                                                      like in the
                                                      documentation, the
                                                      species are listed
                                                      under there:<br>
                                                      <img alt="" moz-do-not-send="true" width="1021" height="616"><br>
                                                      But then, apollo
                                                      breaks:<br>
                                                      <img alt="" moz-do-not-send="true" width="972" height="587"><br>
                                                      <br>
                                                      So, I guess I need
                                                      to get the
                                                      dataset_selector
                                                      working in
                                                      JBrowse, while not
                                                      breaking Apollo.<br>
                                                      <br>
                                                      I hope that clears
                                                      it up more.<br>
                                                      <br>
                                                      Thanks,<br>
                                                      Justin<br>
                                                      <br>
                                                      <div>On 5/25/22
                                                        11:50 AM, Colin
                                                        wrote:<br>
                                                      </div>
                                                      <blockquote type="cite">
                                                        <p><span style="color:rgb(215,63,9)">[This
                                                          email
                                                          originated
                                                          from outside
                                                          of OSU. Use
                                                          caution with
                                                          links and
                                                          attachments.]</span></p>
                                                        <div>
                                                          <div dir="ltr">
                                                          <div>I haven't
                                                          evaluated the
                                                          whole post
                                                          here, but note
                                                          that Apollo
                                                          automatically
                                                          creates a
                                                          dataset
                                                          selector from
                                                          assemblies
                                                          that you
                                                          configure
                                                          through that
                                                          Apollo
                                                          interface</div>
                                                          <div><br>
                                                          </div>
                                                          <div>
                                                          <div><br>
                                                          </div>
                                                          <div>-Colin</div>
                                                          </div>
                                                          </div>
                                                          <br>
                                                          <div class="gmail_quote">
                                                          <div dir="ltr" class="gmail_attr">On Wed, May 25, 2022 at 12:21 PM Justin Elser &lt;<a href="mailto:jus...@or..." rel="noreferrer noreferrer
                                                          noreferrer" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">jus...@or...</a>&gt;
                                                          wrote:<br>
                                                          </div>
                                                          <blockquote class="gmail_quote" style="margin:0px 0px 0px 0.8ex;border-left:1px solid
                                                          rgb(204,204,204);padding-left:1ex">
                                                          Hi all,<br>
                                                          <br>
                                                          I have set up
                                                          a jbrowse
                                                          1.16.11
                                                          instance
                                                          (sorry, not
                                                          publicly
                                                          available) <br>
                                                          and added 2
                                                          species (well,
                                                          different
                                                          cultivars) by
                                                          doing the
                                                          following:<br>
                                                          bin/<a href="http://prepare-refseqs.pl/" originalsrc="http://prepare-refseqs.pl/" shash="eKfzIvGOov0xH/TztMmSjKrQpagJMfaZpnyIcUjkh7a17jXlYKzcYJTAT5Bxhhvmd21OXPZZIeY9zOHBE8u91QxK8XoDYGaFnq+6BWC2gcMlbwzjhrZuyu75OcNUEKGnbRM/pYlAE925HG11dxTWRftQnYorTx1aNnEEuCISFhs=" rel="noreferrer noreferrer noreferrer noreferrer" title="Unmangled
                                                          Microsoft
                                                          Safelink" target="_blank" moz-do-not-send="true">prepare-refseqs.pl</a> --out data/nipponbare
                                                          --fasta <br>
source_files/RAPDB-Reference-Nipponbare_chr_fixed.fasta<br>
                                                          bin/<a href="http://flatfile-to-json.pl/" originalsrc="http://flatfile-to-json.pl/" shash="tcXk3DVnk7wf4j/Trwbns8JwOHzHdX/2h2rm4acpYihs6opONa0mjFAN2qVtm8a+4+6HQPrbdmrmglDHIHz+fgeoER1cX6/vGpRewQrgKUIP6F1SzLE3QzXPqGImqL66ePPerqZ2QiER/UB4c+Wh1gyWyNCvv2g2Wd0VSHCPGQQ=" rel="noreferrer noreferrer noreferrer noreferrer" title="Unmangled
                                                          Microsoft
                                                          Safelink" target="_blank" moz-do-not-send="true">flatfile-to-json.pl</a> --out data/nipponbare
                                                          --trackType
                                                          CanvasFeatures
                                                          <br>
                                                          --trackLabel
                                                          MSU7.0 -gff
                                                          source_files/MSU7.0.gff3<br>
                                                          bin/<a href="http://generate-names.pl/" originalsrc="http://generate-names.pl/" shash="k1460HP/ir4tRnQRm8QXtl7L1nL/FH1vQSyA2G8a5uvGjGkNvSgC9E+rPqK4EaY0i0J/ak2LsP9wSJtl9pfqBNBVvdds1ds1eDMvhLvir5ENmawbzw1yv/wfAfpJNWam7oplw8O6zMmTLHqKNEmZNhKaBRSWJckUWvtMxkAS5dY=" rel="noreferrer noreferrer noreferrer noreferrer" title="Unmangled
                                                          Microsoft
                                                          Safelink" target="_blank" moz-do-not-send="true">generate-names.pl</a> --out data/nipponbare<br>
                                                          <br>
                                                          bin/<a href="http://prepare-refseqs.pl/" originalsrc="http://prepare-refseqs.pl/" shash="eKfzIvGOov0xH/TztMmSjKrQpagJMfaZpnyIcUjkh7a17jXlYKzcYJTAT5Bxhhvmd21OXPZZIeY9zOHBE8u91QxK8XoDYGaFnq+6BWC2gcMlbwzjhrZuyu75OcNUEKGnbRM/pYlAE925HG11dxTWRftQnYorTx1aNnEEuCISFhs=" rel="noreferrer noreferrer noreferrer noreferrer" title="Unmangled
                                                          Microsoft
                                                          Safelink" target="_blank" moz-do-not-send="true">prepare-refseqs.pl</a> --out data/arc --fasta <br>
source_files/magic_16/oryza_sativa_arc.fa<br>
                                                          bin/<a href="http://flatfile-to-json.pl/" originalsrc="http://flatfile-to-json.pl/" shash="tcXk3DVnk7wf4j/Trwbns8JwOHzHdX/2h2rm4acpYihs6opONa0mjFAN2qVtm8a+4+6HQPrbdmrmglDHIHz+fgeoER1cX6/vGpRewQrgKUIP6F1SzLE3QzXPqGImqL66ePPerqZ2QiER/UB4c+Wh1gyWyNCvv2g2Wd0VSHCPGQQ=" rel="noreferrer noreferrer noreferrer noreferrer" title="Unmangled
                                                          Microsoft
                                                          Safelink" target="_blank" moz-do-not-send="true">flatfile-to-json.pl</a> --out data/arc
                                                          --trackType
                                                          CanvasFeatures
                                                          <br>
                                                          --trackLabel
                                                          Genes -gff
                                                          source_files/magic_16/oryza_sativa_arc.gff<br>
                                                          bin/<a href="http://generate-names.pl/" originalsrc="http://generate-names.pl/" shash="k1460HP/ir4tRnQRm8QXtl7L1nL/FH1vQSyA2G8a5uvGjGkNvSgC9E+rPqK4EaY0i0J/ak2LsP9wSJtl9pfqBNBVvdds1ds1eDMvhLvir5ENmawbzw1yv/wfAfpJNWam7oplw8O6zMmTLHqKNEmZNhKaBRSWJckUWvtMxkAS5dY=" rel="noreferrer noreferrer noreferrer noreferrer" title="Unmangled
                                                          Microsoft
                                                          Safelink" target="_blank" moz-do-not-send="true">generate-names.pl</a> --out data/arc<br>
                                                          <br>
                                                          Then I edited
                                                          the
                                                          jbrowse.conf
                                                          file as
                                                          explained in <br>
                                                          <a href="https://jbrowse.org/docs/dataset_selector.html" originalsrc="https://jbrowse.org/docs/dataset_selector.html" shash="qRZdKZN2NokNLP4IemLR4xIRv9iMhhlJEGU6IbWXJEbIMuT1T8PeH5+UOJWe7xDb/YXoJjYVvSXNVdE9W4zUsRtITCClHFNZP9KvdJ1TGyg1XdI9uMxQiGTdDvoaFK2/nziq2wk2ChDnRFtir9T4/FNC+bSl49NTVjaQ3s4m/pk=" rel="noreferrer noreferrer noreferrer noreferrer" title="Unmangled
                                                          Microsoft
                                                          Safelink" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">https://jbrowse.org/docs/dataset_selector.html</a>
                                                          to have:<br>
                                                          dataRoot =
                                                          data/nipponbare<br>
[datasets.nipponbare]<br>
                                                          url =
                                                          ?data=data/nipponbare<br>
                                                          name =
                                                          Nipponbare<br>
                                                          [datasets.arc]<br>
                                                          url =
                                                          ?data=data/arc<br>
                                                          name = ARC<br>
                                                          <br>
                                                          And all seems
                                                          to work fine,
                                                          except that I
                                                          don't see the
                                                          dropdown to <br>
                                                          switch
                                                          datasets, so I
                                                          can't actually
                                                          see the ARC
                                                          dataset.
                                                          Although I <br>
                                                          have by
                                                          messing around
                                                          with
                                                          jbrowse.conf
                                                          and
                                                          tracks.conf
                                                          gotten it to <br>
                                                          work, but at
                                                          this point
                                                          I've left it
                                                          out.<br>
                                                          <br>
                                                          However, the
                                                          issue I'm
                                                          having is
                                                          actually with
                                                          Apollo. I have
                                                          the docker <br>
                                                          instance of
                                                          apollo running
                                                          and it seems
                                                          to be fine as
                                                          configured in
                                                          a <br>
                                                          systemd unit
                                                          file:<br>
ExecStart=/usr/bin/docker run --rm --name %n \<br>
                                                          &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; -e
                                                          APOLLO_PATH=apollo
                                                          \<br>
                                                          &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; -v
                                                          /data/www/panoryza/jbrowse/<a rel="noreferrer noreferrer noreferrer" moz-do-not-send="true">data:/data</a>
                                                          \<br>
                                                          &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; -v
                                                          /data/www/panoryza/apollo/postgres:/var/lib/postgresql
                                                          \<br>
                                                          &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; -v <br>
/data/www/panoryza/apollo/apollo_<a rel="noreferrer noreferrer
                                                          noreferrer" moz-do-not-send="true">data:/data/temporary/apollo_data</a>
                                                          \<br>
                                                          &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; -p
                                                          8887:8080 \<br>
                                                          &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;
                                                          gmod/apollo:latest<br>
                                                          <br>
                                                          Adding
                                                          Nipponbare as
                                                          an organism
                                                          with
                                                          &quot;Directory&quot;
                                                          /data/nipponbare
                                                          works <br>
                                                          fine and I can
                                                          see the tracks
                                                          I've added.<br>
                                                          <br>
                                                          Now, here is
                                                          where the
                                                          issue I have
                                                          starts. If I
                                                          edit the <br>
data/nipponbare/tracks.conf file as shown in the dataset selector <br>
                                                          documentation
                                                          above:<br>
                                                          [general]<br>
                                                          dataset_id =
                                                          nipponbare<br>
                                                          <br>
                                                          Apollo then
                                                          shows the
                                                          following
                                                          error:<br>
                                                          Error
                                                          message(s):<br>
                                                          &nbsp;&nbsp;&nbsp;&nbsp;
                                                          TypeError:
                                                          Cannot read
                                                          properties of
                                                          undefined
                                                          (reading
                                                          'name').<br>
                                                          <br>
                                                          Clearing out
                                                          the
                                                          data/nipponbare/tracks.conf
                                                          file allows
                                                          apollo to
                                                          work.<br>
                                                          Now, the error
                                                          only appears
                                                          in apollo,
                                                          jbrowse works
                                                          fine with the
                                                          edits.<br>
                                                          <br>
                                                          I'm a bit
                                                          confused about
                                                          how this
                                                          should be
                                                          configured to
                                                          work. I <br>
                                                          actually have
                                                          14 more
                                                          &quot;species&quot; to
                                                          add, but
                                                          waiting till I
                                                          at least get <br>
                                                          it working
                                                          with one. The
                                                          documentation
                                                          isn't clear to
                                                          me on the <br>
                                                          difference
                                                          between adding
                                                          the datasets
                                                          to
                                                          jbrowse.conf
                                                          vs <br>
data/tracks.conf vs data/(species)/tracks.conf.<br>
                                                          <br>
                                                          Please let me
                                                          know if you
                                                          need any more
                                                          information.<br>
                                                          <br>
                                                          Thanks,<br>
                                                          Justin<br>
                                                          <br>
                                                          -- <br>
**********************************************************<br>
                                                          *&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          *<br>
                                                          *&nbsp; Justin
                                                          Elser&nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; *<br>
                                                          *&nbsp;
                                                          Computational
                                                          Biology
                                                          Research
                                                          Associate&nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; *<br>
                                                          *&nbsp; Dept. of
                                                          Botany and
                                                          Plant
                                                          Pathology&nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;*<br>
                                                          *&nbsp; Jaiswal
                                                          Lab&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp;*<br>
                                                          *&nbsp; Oregon
                                                          State
                                                          University&nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;*<br>
                                                          *&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          *<br>
                                                          *&nbsp; email: <a href="mailto:jus...@or..." rel="noreferrer noreferrer
                                                          noreferrer" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">
jus...@or...</a>&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;*<br>
                                                          *&nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp; &nbsp;
                                                          *<br>
**********************************************************<br>
                                                          <br>
                                                          <br>
                                                          <br>
_______________________________________________<br>
                                                          Gmod-ajax
                                                          mailing list<br>
                                                          <a href="mailto:Gmo...@li..." rel="noreferrer noreferrer noreferrer" target="_blank" moz-do-not-send="true" class="moz-txt-link-freetext">Gmo...@li...</a><br>
                                                          <a href="https://lists...
 
[truncated message content]

Re: [Gmod-ajax] [apollo] Find annotation in tracks

[Nathan D. <nd...@gm...>]

I would download and install JBrowse 1 and generate the names with that perl script and then point your Apollo organism directory there.

That’s been more reliable for me in general. 

Nathan	


> On Jun 1, 2022, at 9:20 PM, Johannes Debler <joh...@gm...> wrote:
> 
> Thanks Nathan,
> 
> I can't really figure out how to run it, or what the input is meant to be. 
> I have a file called 'trackList.json' which contains all the tracks.
> 
> But when I run this command:
> generate-names.pl <http://generate-names.pl/> --tracks trackList.json
> 
> I get a bunch of errors:
> syntax error in /home/data/apollo_data/36-AlKewell/data/trackList.json: malformed JSON string, neither tag, array, object, number, string or atom, at character offset 0 (before "(end of string)") at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 32.
>  at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 7.
>         Bio::JBrowse::ConfigurationManager::__ANON__("malformed JSON string, neither tag, array, object, number, st"...) called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 32
>         eval {...} called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 32
>         Bio::JBrowse::ConfigurationManager::slurpJSON("/home/data/apollo_data/36-AlKewell/data/trackList.json") called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 145
>         Bio::JBrowse::ConfigurationManager::_load_include(Bio::JBrowse::ConfigurationManager=HASH(0x55984670a900), HASH(0x55984670af60), "data") called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 71
>         Bio::JBrowse::ConfigurationManager::_load_includes(Bio::JBrowse::ConfigurationManager=HASH(0x55984670a900), HASH(0x559845add2c8)) called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 41
>         Bio::JBrowse::ConfigurationManager::get_final_config(Bio::JBrowse::ConfigurationManager=HASH(0x55984670a900)) called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/GenomeDB.pm line 261
>         GenomeDB::refSeqs(GenomeDB=HASH(0x55984670b518)) called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/Cmd/IndexNames.pm line 77
>         Bio::JBrowse::Cmd::IndexNames::run(Bio::JBrowse::Cmd::IndexNames=HASH(0x559845b08060)) called at /opt/Apollo-2.6.5/jbrowse/bin/generate-names.pl <http://generate-names.pl/> line 8
>  at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 7.
>         Bio::JBrowse::ConfigurationManager::__ANON__("syntax error in /home/data/apollo_data/36-AlKewell/data/track"...) called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 33
>         Bio::JBrowse::ConfigurationManager::slurpJSON("/home/data/apollo_data/36-AlKewell/data/trackList.json") called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 145
>         Bio::JBrowse::ConfigurationManager::_load_include(Bio::JBrowse::ConfigurationManager=HASH(0x55984670a900), HASH(0x55984670af60), "data") called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 71
>         Bio::JBrowse::ConfigurationManager::_load_includes(Bio::JBrowse::ConfigurationManager=HASH(0x55984670a900), HASH(0x559845add2c8)) called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/ConfigurationManager.pm line 41
>         Bio::JBrowse::ConfigurationManager::get_final_config(Bio::JBrowse::ConfigurationManager=HASH(0x55984670a900)) called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/GenomeDB.pm line 261
>         GenomeDB::refSeqs(GenomeDB=HASH(0x55984670b518)) called at /opt/Apollo-2.6.5/jbrowse/bin/../src/perl5/Bio/JBrowse/Cmd/IndexNames.pm line 77
>         Bio::JBrowse::Cmd::IndexNames::run(Bio::JBrowse::Cmd::IndexNames=HASH(0x559845b08060)) called at /opt/Apollo-2.6.5/jbrowse/bin/generate-names.pl <http://generate-names.pl/> line 8
> 
> Not sure if this is the correct way to run the script in the first place, but the help doesn't go into much detail unfortunately. 
> 
> Cheers,
> Johannes
> 
> On Thu, 2 Jun 2022 at 11:37, Nathan Dunn <nd...@gm... <mailto:nd...@gm...>> wrote:
> 
> If you use generate-names: https://jbrowse.org/docs/generate-names.pl.html <https://jbrowse.org/docs/generate-names.pl.html>
> 
> You should be able to search for genes, etc. in the location box.  
> 
> e.g., https://jbrowse.org/jbrowse1.html <https://jbrowse.org/jbrowse1.html> use the search box to look for Apple3.  
> 
> Nathan
> 
>> On Jun 1, 2022, at 8:28 PM, Johannes Debler <joh...@gm... <mailto:joh...@gm...>> wrote:
>> 
>> Hi,
>> I was wondering if it is possible to search annotations in tracks other than 'User-created Annotations'.
>> I have finished annotating my genome and would now like to get rid of all the models in the 'User-created Annotations' track and only display my final annotations track. 
>> 
>> Currently if I try to search for a gene name in the 'Annotations' tab, it only finds things in the 'User-created Annotations' track. Is there a way to make the other tracks searchable, or alternatively, remove all annotations from the 'User....' track and upload my final annotations to that track.
>> 
>> Cheers,
>> Johannes
>> 
>> -- 
>> To unsubscribe from this group and stop receiving emails from it, send an email to apo...@lb... <mailto:apo...@lb...>.
>