#394 alignment of reverse strand feat reverses the genomic sequen

[Brian O.]

Sometimes when aligning reverse strand features the genomic sequence is coming up as forward strand sequence. The following is an example from game where this happens:

<computational_analysis>
<program>sim4</program>
<database>na_DGC.dros</database>
<property>
<type>qseq_type</type>
<value>genomic</value>
</property>
<property>
<type>type</type>
<value>Fly cDNA Sequences</value>
</property>
<date timestamp="1042592678000">Tue Jan 14 17:04:38 PST 2003</date>
<result_set id=":726237">
<name>SD14915.5prime-AE003603.Sept-na_DGC.dros-sim4</name>
<seq_relationship type="query" seq="3R:1080000-1110000">
<span>
<start>2371</start>
<end>1448</end>
</span>
</seq_relationship>
<result_span id=":1028152">
<type>sim4:na_DGC.dros</type>
<score>100.0</score>
<output>
<type>score</type>
<value>100.0</value>
</output>
<seq_relationship type="query" seq="3R:1080000-1110000">
<span>
<start>2371</start>
<end>1968</end>
</span>
<alignment>

TGGCCCTTCAGCTCTCCATTAGCGTAGCCCTGCGCCCAAATCAAGCCCTGCAGCGTTTTCATTGGCGTGACCTTCAGATCCTGATCAATTAAATAGCGCACAAAGCCTGCAATCAGATCTACATCCACTTCCGTAGGTGGACCACTTAACAGGGCCTTGTAGTCCGCATACTGGGGCACTTGCTGTAGATCCTGGACAATACGCTTTATATCATCTTCTTCCCACGAATCCCTCAGGAACTTTTCCACATTCTGCTTGGCGTAGGGAAACAGGACATCGTGCACAAAGCTAATCGAAGTGGTGGTGCCCTCGATGTCCACCAGCACCACTTTGGCCACTCGTTCACTGGACGACATTGCGCTTATTAGTGGGATTAAGTTATCACGAGGAACCAGTTGATTTTC
</alignment>
</seq_relationship>
<seq_relationship type="subject" seq="SD14915.5prime">
<span>
<start>1</start>
<end>404</end>
</span>
<alignment>

GAAAATCAACTGGTTCCTCGTGATAACTTAATCCCACTAATAAGCGCAATGTCGTCCAGTGAACGAGTGGCCAAAGTGGTGCTGGTGGACATCGAGGGCACCACCACTTCGATTAGCTTTGTGCACGATGTCCTGTTTCCCTACGCCAAGCAGAATGTGGAAAAGTTCCTGAGGGATTCGTGGGAAGAAGATGATATAAAGCGTATTGTCCAGGATCTACAGCAAGTGCCCCAGTATGCGGACTACAAGGCCCTGTTAAGTGGTCCACCTACGGAAGTGGATGTAGATCTGATTGCAGGCTTTGTGCGCTATTTAATTGATCAGGATCTGAAGGTCACGCCAATGAAAACGCTGCAGGGCTTGATTTGGGCGCAGGGCTACGCTAATGGAGAGCTGAAGGGCCA
</alignment>
</seq_relationship>
</result_span>

So notice the 2 alignment sequences look nothing alike. It turns out
they are reverse complements of each other. The subject alignment is
correct, and the query alignment sequence is forward not reverse strand sequence. But with start 2371 and end 1968 its a reverse strand feature. So should the query alignment sequence also be from the reverse strand? This seems like a data issue, not a jalview bug. I dont think jalview is suppose to be recomping the query align sequence. So would this be a bop bug or does this issue lie elsewhere? If this is the case, it would be good to fix this as it makes jalview unusable for these reverse strand features.