Various ideas for this (from mailing lists):
Is or would it be possible to see the (numeric) position of the
mismatches in the fuzznuc output file.
E.g. the example output file shows mismatches, but not where there are located:
http://emboss.sourceforge.net/apps/release/6.4/emboss/apps/fuzznuc.html#output.4
# pat2 1 cg(2)c(3)taaccctagc(3)ta
605 624 + pat2: cg(2)c(3)taaccctagc(3)ta 1
cggccctaaccctaacccta
Clearly, we can find the position of mismatched by matching the
supplied pattern with the reported match, but would not be preferred.
> Thanks! It would indeed be great to have the option to seach on the
> ambiguity codes directly. Probably, I'd prefer the escape option, but
> you mean to implement both escaping and expansion to subsets?
Yes, we will implement both. Escaping is needed to find any ambiguity
codes in a sequence. Expansion allows S to find G, C and S.
> It might be good to report the pattern that was used in the matching.
> Would the (very high) speed of fuzznuc be affected by always exploding
> the to the subsets? For example, "N" would become "ACTGUMRWSYKVHDB".
N is not a problem - it matches anything. The 2-letter ambiguity codes
only expand to one extra letter, and 3-letter codes (B, D, H, V) are
only very rarely used.