dprimer Code
Status: Beta
Brought to you by:
ccbailey
| File | Date | Author | Commit |
|---|---|---|---|
| docs | 2009-12-05 | ccbailey | [r1] |
| resources | 2009-12-22 | ccbailey | [r20] |
| src | 2010-04-26 | ccbailey | [r24] |
| AUTHORS | 2009-12-05 | ccbailey | [r1] |
| COPYING | 2009-12-05 | ccbailey | [r1] |
| ChangeLog | 2009-12-05 | ccbailey | [r1] |
| INSTALL | 2009-12-05 | ccbailey | [r1] |
| Makefile.am | 2009-12-05 | ccbailey | [r1] |
| Makefile.in | 2009-12-10 | ccbailey | [r13] |
| NEWS | 2009-12-05 | ccbailey | [r1] |
| README | 2009-12-05 | ccbailey | [r1] |
| TODO | 2009-12-05 | ccbailey | [r1] |
| aclocal.m4 | 2009-12-10 | ccbailey | [r13] |
| config.guess | 2009-12-05 | ccbailey | [r1] |
| config.sub | 2009-12-05 | ccbailey | [r1] |
| configure | 2009-12-10 | ccbailey | [r13] |
| configure.ac | 2009-12-05 | ccbailey | [r1] |
| depcomp | 2009-12-05 | ccbailey | [r1] |
| finddeps | 2009-12-05 | ccbailey | [r1] |
| install-sh | 2009-12-05 | ccbailey | [r1] |
| ltmain.sh | 2009-12-22 | ccbailey | [r20] |
| missing | 2009-12-05 | ccbailey | [r1] |
| mkinstalldirs | 2009-12-05 | ccbailey | [r1] |
This package contains the source code and build files for dprimer, a PCR primer picking utility. This package should theoretically work on any modern system supported by GNU's autotools (GNU/Linux, BSDs, Mac OSX, and others). It should have no dependencies other that the C and C++ standard libraries. For installation instructions see the INSTALL file included in this folder. dprimer is developed for the purpose of designing broad-based, degenerate PCR primers against a target composed of multiple aligned sequences. The typical useage is to design broad-based primers capable of amplifying ribosomal DNA for a phylogenetic clade of organisms. Alignments of amino acid sequences are are automatically reverse translated. In addition, a "background" sequence can be specified than the primers should not hybridize to. Thus, for example, one could use this package to design primers against several families of hemoparasites that wouldn't amplify host DNA. dprimer relies on a multiple sequence alignment (.aln file) as generated by the popular program Clustal or its variants ClustalW and ClustalX. Please see that package for details on generating a .aln file. Once a suitable alignment has been obtained dprimer may be invoked as simply as: $dprimer -i sequences.aln A sample .aln file of apicomplexan parasites is included in this distribution for testing purposes. The output looks somethings like: $dprimer -i apicomplexa.aln $result in 0.02 seconds $ $1009 ungapped primer sequences examined $primers excluded from consideration: $5 high degneracy $542 high or low Tm $431 high self complementarity $31 primers met inclusion criteria $ $465 primer pairs examined $primers pairs excluded from consideration: $125 high difference in Tm $103 high pair complementarity $95 short or long product $142 primer pairs met inclusion criteria $ $fw Tm pos degen rv Tm pos degen delTm size pair degen $gsmbgcgatrwwtcattcaa 60.6843 266 96 ktttrrrtycccrtcatcca 60.949 486 64 0.264736 240 6144 $gsmbgcgatrwwtcattcaa 60.6843 266 96 gktttrrrtycccrtcatcc 60.9649 487 64 0.28067 241 6144 $gsmbgcgatrwwtcattcaa 60.6843 266 96 atacgaatgcccccactgyt 65.4927 827 2 4.80846 581 192 $gsmbgcgatrwwtcattcaa 60.6843 266 96 aatacgaatgcccccactgy 65.1531 828 2 4.46886 582 192 $gsmbgcgatrwwtcattcaa 60.6843 266 96 aaatacgaatgcccccactg 63.1208 829 1 2.43655 583 96 $... The results are a tab delimited text best visialized in a spreadsheet application. By default results are printed on the screen but can be saved to a file specified by the -o [FILE] option on the command line. For example: $dprimer -i sequences.aln -o output.csv Or using the output redirction operator on a UNIX system like: $dprimer -i sequences.aln > output.csv Many options are available that allow control over primer picking criteria. Run $dprimer --help for a full list of options.