Read Me

This package contains the source code and build files for dprimer, a PCR primer
picking utility.  This package should theoretically work on any modern system
supported by GNU's autotools (GNU/Linux, BSDs, Mac OSX, and others).  It should
have no dependencies other that the C and C++ standard libraries.  For
installation instructions see the INSTALL file included in this folder.

dprimer is developed for the purpose of designing broad-based, degenerate
PCR primers against a target composed of multiple aligned sequences.  The
typical useage is to design broad-based primers capable of amplifying ribosomal
DNA for a phylogenetic clade of organisms.  Alignments of amino acid sequences
are are automatically reverse translated.  In addition, a "background"
sequence can be specified than the primers should not hybridize to.  Thus, for
example, one could use this package to design primers against several families
of hemoparasites that wouldn't amplify host DNA.

dprimer relies on a multiple sequence alignment (.aln file) as generated by the 
popular program Clustal or its variants ClustalW and ClustalX.  Please see that 
package for details on generating a .aln file.

Once a suitable alignment has been obtained dprimer may be invoked as simply as:
$dprimer -i sequences.aln

A sample .aln file of apicomplexan parasites is included in this distribution
for testing purposes.

The output looks somethings like:
$dprimer -i apicomplexa.aln
$result in 0.02 seconds
$
$1009 ungapped primer sequences examined
$primers excluded from consideration:
$5	high degneracy
$542	high or low Tm
$431	high self complementarity
$31 primers met inclusion criteria
$
$465 primer pairs examined
$primers pairs excluded from consideration:
$125	high difference in Tm
$103	high pair complementarity
$95	short or long product
$142 primer pairs met inclusion criteria
$
$fw	Tm	pos	degen	rv	Tm	pos	degen	delTm	size	pair degen
$gsmbgcgatrwwtcattcaa	60.6843	266	96	ktttrrrtycccrtcatcca	60.949	486	64	0.264736	240	6144
$gsmbgcgatrwwtcattcaa	60.6843	266	96	gktttrrrtycccrtcatcc	60.9649	487	64	0.28067	241	6144
$gsmbgcgatrwwtcattcaa	60.6843	266	96	atacgaatgcccccactgyt	65.4927	827	2	4.80846	581	192
$gsmbgcgatrwwtcattcaa	60.6843	266	96	aatacgaatgcccccactgy	65.1531	828	2	4.46886	582	192
$gsmbgcgatrwwtcattcaa	60.6843	266	96	aaatacgaatgcccccactg	63.1208	829	1	2.43655	583	96
$...

The results are a tab delimited text best visialized in a spreadsheet
application.  By default results are printed on the screen but can be saved to
a file specified by the -o [FILE] option on the command line.  For example:
$dprimer -i sequences.aln -o output.csv

Or using the output redirction operator on a UNIX system like:
$dprimer -i sequences.aln > output.csv

Many options are available that allow control over primer picking criteria.
Run

$dprimer --help

for a full list of options.