|
From: David E. (gringer) <dav...@mp...> - 2011-07-15 11:28:17
|
On 15/07/11 12:47, David Eccles (gringer) wrote: > I'll have a look at what comes out if I break the circularity of this > DNA by removing sequence that includes the start and end pieces together. Done, sort of. Sorry, I think I forgot to link in the circular reads sequence in my previous email, so here are both of them: http://user.interface.org.nz/~gringer/hacking/head100k_interleaved_noN_phiX_region1101.fasta http://user.interface.org.nz/~gringer/hacking/linearised_head100k_interleaved_noN_phiX_region1101.fasta Curiously, Ray finds more seeds in another rank (rank 6) by removing this connecting sequence: $ mpirun -np 10 ../../code/Ray -i ~/illuminadata/110517_H134_0062_A816HKABXX/Data/Intensities/BaseCalls/fastq/ignore/linearised_head100k_interleaved_noN_phiX_region1101.fasta Rank 0 is extending seeds [0/0] (completed) Rank 5 is extending seeds [0/0] (completed) Rank 5 extended 0 seeds out of 0 (-nan%) Rank 4 is extending seeds [0/0] (completed) Rank 4 extended 0 seeds out of 0 (-nan%) Rank 7 is extending seeds [0/0] (completed) Rank 7 extended 0 seeds out of 0 (-nan%) Rank 2 is extending seeds [0/0] (completed) Rank 2 extended 0 seeds out of 0 (-nan%) Rank 3 is extending seeds [0/0] (completed) Rank 3 extended 0 seeds out of 0 (-nan%) Rank 1 is extending seeds [0/0] (completed) Rank 1 extended 0 seeds out of 0 (-nan%) Rank 8 is extending seeds [0/0] (completed) Rank 8 extended 0 seeds out of 0 (-nan%) Rank 6 is extending seeds [1/1] Rank 6 starts on a seed, length is 4063 [0/1] Rank 6 reached 0 vertices (GCAGGTTGGATACGCCAATCA) from seed 1 Rank 9 is extending seeds [1/1] Rank 9 starts on a seed, length is 1277 [0/1] Rank 9 reached 0 vertices (GTGTTAACAGTCGGGAGAGGA) from seed 1 Rank 0 extended 0 seeds out of 0 (-nan%) Rank 9 reached 1277 vertices from seed 1 (changing direction) Rank 9 reached 0 vertices (AGTTTTATCGCTTCCATGACG) from seed 1 Rank 9 reached 1279 vertices (CCTCTCCCGACTGTTAACACT) from seed 1 Rank 9 (extension done) Rank 9 is extending seeds [1/1] (completed) Rank 9 extended 1 seeds out of 1 (100.00%) Rank 6 reached 4063 vertices from seed 1 (changing direction) Rank 6 reached 0 vertices (CTGGTTATATTGACCATGCCG) from seed 1 Rank 6 reached 4064 vertices (TGATTGGCGTATCCAACCTGC) from seed 1 Rank 6 (extension done) Rank 6 is extending seeds [1/1] (completed) Rank 6 extended 1 seeds out of 1 (100.00%) ... Number of contigs: 2 Total length of contigs: 5383 Number of contigs >= 500 nt: 2 Total length of contigs >= 500 nt: 5383 Number of scaffolds: 1 Total length of scaffolds: 5652 Number of scaffolds >= 500 nt: 1 Total length of scaffolds >= 500: 5652 Why don't the other ranks find seeds? It's still successful at getting a sequence, but it's split into 2 contigs. This doesn't much surprise me, because I eliminated the joining segment, but kept end pairs that spanned either side of the joining segment. It's a little strange that the sequence of Ns that has been filled (about 274 Ns) in is not the same as what I would expect from an assembly of the circular genome (i.e. 2 Ns), but when a lot of repeated Ns appear in an assembled sequence, it's expected that the distance is unknown. -- David |
