Menu
▾
▴
cg-pipeline-users — Help with CG-Pipeline may be available from users on this mailing list
You can subscribe to this list here.
| 2011 |
Jan
|
Feb
(6) |
Mar
|
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2012 |
Jan
(1) |
Feb
|
Mar
|
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
(8) |
| 2013 |
Jan
|
Feb
|
Mar
|
Apr
|
May
|
Jun
(12) |
Jul
(14) |
Aug
(9) |
Sep
(1) |
Oct
(2) |
Nov
|
Dec
|
| 2014 |
Jan
|
Feb
|
Mar
(2) |
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
|
| 2015 |
Jan
|
Feb
|
Mar
(1) |
Apr
|
May
|
Jun
|
Jul
|
Aug
|
Sep
|
Oct
|
Nov
|
Dec
|
|
From: Lee K. <ls...@gm...> - 2013-07-02 15:08:21
|
Sure. When developing the strategy for gene prediction, we decided to accept the longest orf possible. Therefore, we always capture the whole gene (if the locus is correctly identified as a gene because there are undoubtedly some false positives), but the 5' region might be a false positive. In other words, a downstream start codon might be the true start in CGP-predicted genes. I believe in our publication, we correctly identified genes 95% of the time, but we predicted the correct start 85% of the time (and the true start site would have been downstream in 15% of the predictions). On Tue, Jul 2, 2013 at 5:14 AM, kokwei <kok...@gm...> wrote: > Thanks for your information. I am thinking the reference proteins I used > as database are conserved in their gene model, so hoping that with the > blast result against database will predict the "real start" (with > reference) instead of based on ab initio which might have false prediction > for start codon. With the current protein blast alignment, it will pinned > to the closest start codon upstream, but the "real start" might be even > more upstream. > > Can I have your opinion on this based on your experience with the > optimization? Thanks. > > > On 2/7/2013 3:36 AM, Lee Katz wrote: > > It looks like you are correct. Over the last couple of years, I optimized > a few different things and I guess I obviated that subroutine! > > Yes, run_prediction will run GeneMark and Glimmer3, and combine with > blast, making a high-confidence set of genes. To see a graphical > representation and explanation of our combining strategy, please see our > 2010 paper: > http://bioinformatics.oxfordjournals.org/content/26/15/1819.full > > > On Mon, Jul 1, 2013 at 12:49 PM, kokwei <kok...@gm...> wrote: > >> >> Hi, >> >> I noticed that during execution of pipeline with command <run_pipeline >> predict -p project>, the module "sub blastSeqs($$$) {" at line 1817 is >> not executed. Is that normal or only happen in my case? Attached the log >> of the prediction for your reference. >> >> I guess that module will do the blast of the contig/scaffolds sequences >> against the database selected and output the homology based gene model >> to combine with other ab initio gene model by glimmer and genemark, >> which is what I need and hope that this can be solved. >> >> Thanks. >> >> >> >> >> >> > > > -- > Lee Katz, Ph.D. > > > -- Lee Katz, Ph.D. |
|
From: kokwei <kok...@gm...> - 2013-07-02 09:14:33
|
Thanks for your information. I am thinking the reference proteins I used as database are conserved in their gene model, so hoping that with the blast result against database will predict the "real start" (with reference) instead of based on ab initio which might have false prediction for start codon. With the current protein blast alignment, it will pinned to the closest start codon upstream, but the "real start" might be even more upstream. Can I have your opinion on this based on your experience with the optimization? Thanks. On 2/7/2013 3:36 AM, Lee Katz wrote: > It looks like you are correct. Over the last couple of years, I > optimized a few different things and I guess I obviated that subroutine! > > Yes, run_prediction will run GeneMark and Glimmer3, and combine with > blast, making a high-confidence set of genes. To see a graphical > representation and explanation of our combining strategy, please see > our 2010 paper: > http://bioinformatics.oxfordjournals.org/content/26/15/1819.full > > > On Mon, Jul 1, 2013 at 12:49 PM, kokwei <kok...@gm... > <mailto:kok...@gm...>> wrote: > > > Hi, > > I noticed that during execution of pipeline with command <run_pipeline > predict -p project>, the module "sub blastSeqs($$$) {" at line 1817 is > not executed. Is that normal or only happen in my case? Attached > the log > of the prediction for your reference. > > I guess that module will do the blast of the contig/scaffolds > sequences > against the database selected and output the homology based gene model > to combine with other ab initio gene model by glimmer and genemark, > which is what I need and hope that this can be solved. > > Thanks. > > > > > > > > > -- > Lee Katz, Ph.D. |
|
From: Lee K. <ls...@gm...> - 2013-07-01 19:36:32
|
It looks like you are correct. Over the last couple of years, I optimized a few different things and I guess I obviated that subroutine! Yes, run_prediction will run GeneMark and Glimmer3, and combine with blast, making a high-confidence set of genes. To see a graphical representation and explanation of our combining strategy, please see our 2010 paper: http://bioinformatics.oxfordjournals.org/content/26/15/1819.full On Mon, Jul 1, 2013 at 12:49 PM, kokwei <kok...@gm...> wrote: > > Hi, > > I noticed that during execution of pipeline with command <run_pipeline > predict -p project>, the module "sub blastSeqs($$$) {" at line 1817 is > not executed. Is that normal or only happen in my case? Attached the log > of the prediction for your reference. > > I guess that module will do the blast of the contig/scaffolds sequences > against the database selected and output the homology based gene model > to combine with other ab initio gene model by glimmer and genemark, > which is what I need and hope that this can be solved. > > Thanks. > > > > > > -- Lee Katz, Ph.D. |
|
From: kokwei <kok...@gm...> - 2013-07-01 16:49:56
|
Hi,
I noticed that during execution of pipeline with command <run_pipeline
predict -p project>, the module "sub blastSeqs($$$) {" at line 1817 is
not executed. Is that normal or only happen in my case? Attached the log
of the prediction for your reference.
I guess that module will do the blast of the contig/scaffolds sequences
against the database selected and output the homology based gene model
to combine with other ab initio gene model by glimmer and genemark,
which is what I need and hope that this can be solved.
Thanks.
|
|
From: Lee K. <ls...@gm...> - 2013-06-26 19:20:44
|
I'm not really sure what to make out of this yet, except the error is complaining about a source tag. Is there a line in the CARD output file with the stop site as 25250? If so, could you send it to me? I will bet that it just needs to be removed from the file, but I'm not completely sure. You could back up the sql file and then remove the aforementioned line from it and try again. On Wed, Jun 26, 2013 at 8:41 AM, Laure QUINTRIC <Lau...@if...>wrote: > Here are the first lines of the file /mnt/data2/home1/lquintri/** > cgtest/annotation/aa.fasta.**card_hits.sql > > cgtest_0001|NC_011595.7058613.p01|1.6|12.16|**/home12/caparmor/bioinfo/** > softs/sources/cgp/data/CARD.**faa|43.59|445|MacA. [M] COG0845 > Membrane-fusion protein. Encoded by gene ABBFA_003018. Homology: Secretion > protein HlyD (HMMPfam: PF00529, score: 9.1e-08). ARO:1000001 process or > component of antibiotic biology or chemistry. ARO:3000533 macA. > [Acinetobacter baumannii AB307-0294]|1|55|25.8|56.** > 4102564102564|NC_011595.**7058613.p01|NC_011595.7058613.**p01 > cgtest_0001|NC_010410.6003290.**p01|10.0|22.97|/home12/** > caparmor/bioinfo/softs/**sources/cgp/data/CARD.faa|20.**55|483|putative > Outer membrane efflux protein. Evidence 3 : Function proposed based on > presence of conserved amino acid motif, structural feature or limited > homology; Product type pm : putative membrane component. Encoded by gene > ABAYE1172. Homology: Outer membrane efflux protein (HMMPfam: PF02321, > score: 7.6e-26). ARO:1000001 process or component of antibiotic biology or > chemistry. ARO:3000779 adeH. [Acinetobacter baumannii AYE]|2|49|23.5|45.** > 2054794520548|NC_010410.**6003290.p01|NC_010410.6003290.**p01 > cgtest_0002|AJ250203.gene.p01|**0.62|25.97|/home12/caparmor/** > bioinfo/softs/sources/cgp/**data/CARD.faa|31.34|410|tet31 protein. > Encoded by gene tet31. ARO:3000476 tet31. ARO:1000001 process or component > of antibiotic biology or chemistry. [Aeromonas salmonicida]|1|57|26.6|43.* > *2835820895522|AJ250203.gene.**p01|AJ250203.gene.p01 > cgtest_0003|NC_005054.2598278.**p01|7.6|9.73|/home12/caparmor/** > bioinfo/softs/sources/cgp/**data/CARD.faa|61.11|384|sensor histidine > kinase VanS. Homology: Signal transduction histidine kinase-related > protein, C-terminal (FPrintScan: PR00344, score: 7.5e-10). similar to > PIR:B41838, and PIR:B41838; identified by sequence similarity; putative. > Homology: ATPase-like, ATP-binding domain (HMMPfam: PF02518, score: > 5.5e-22) (Gene3D: G3DSA:3.30.565.10, score: 5.7e-28). Homology: Signal > transduction histidine kinase, subgroup 1, dimerisation/phosphoacceptor > domain (HMMPfam: PF00512, score: 7.7e-12). Encoded by gene vanS. > ARO:1000001 process or component of antibiotic biology or chemistry. > ARO:3000071 vanS. [Staphylococcus aureus]|1|48|23.1|72.** > 2222222222222|NC_005054.**2598278.p01|NC_005054.2598278.**p01 > cgtest_0003|NC_014475.1.orf1.**gene.p01|7.9|9.73|/home12/** > caparmor/bioinfo/softs/**sources/cgp/data/CARD.faa|61.**11|364|VanS. > Encoded by gene vanS. ARO:1000001 process or component of antibiotic > biology or chemistry. ARO:3000071 vanS. [Enterococcus > faecalis]|2|47|22.7|72.**2222222222222|NC_014475.1.** > orf1.gene.p01|NC_014475.1.**orf1.gene.p01 > cgtest_0005|NC_002758.1119966.**p01|0.55|11.01|/home12/** > caparmor/bioinfo/softs/**sources/cgp/data/CARD.faa|41.**03|889|DNA gyrase > subunit A. Encoded by gene gyrA. Homology: DNA topoisomerase, type IIA, > subunit A/ C-terminal, alpha-beta (Gene3D: G3DSA:3.90.199.10, score: > 8.6e-114). Homology: DNA gyrase/topoisomerase IV, subunit A, C-terminal > beta-pinwheel (HMMPfam: PF03989, score: 1.6e-11). Homology: DNA > topoisomerase, type IIA, subunit A, alpha-helical (Gene3D: > G3DSA:1.10.268.10, score: 2.1e-31). Homology: DNA topoisomerase, type IIA, > subunit A/C-terminal (HMMPfam: PF00521, score: 2.1e-157). ARO:1000001 > process or component of antibiotic biology or chemistry. ARO:3000618 > fluoroquinolone resistant gyrA. [Staphylococcus aureus subsp. aureus > Mu50]|5|60|27.7|51.**2820512820513|NC_002758.** > 1119966.p01|NC_002758.1119966.**p01 > cgtest_0005|NC_002951.3236187.**p01|0.55|11.01|/home12/** > caparmor/bioinfo/softs/**sources/cgp/data/CARD.faa|41.**03|887|DNA > gyrase, A subunit. Encoded by gene gyrA. Homology: DNA topoisomerase, type > IIA, subunit A/ C-terminal, alpha-beta (Gene3D: G3DSA:3.90.199.10, score: > 4.2e-114). Homology: DNA topoisomerase, type IIA, subunit A/C-terminal > (HMMPfam: PF00521, score: 8.3e-158). Homology: DNA topoisomerase, type IIA, > subunit A, alpha-helical (Gene3D: G3DSA:1.10.268.10, score: 1.5e-31). > identified by similarity to SP:P20831; match to protein family HMM PF00521; > match to protein family HMM PF03989; match to protein family HMM TIGR01063. > Homology: DNA gyrase/topoisomerase IV, subunit A, C-terminal beta-pinwheel > (HMMPfam: PF03989, score: 1.6e-11). ARO:1000001 process or component of > antibiotic biology or chemistry. ARO:3000618 fluoroquinolone resistant > gyrA. [Staphylococcus aureus subsp. aureus COL]|2|60|27.7|51.** > 2820512820513|NC_002951.**3236187.p01|NC_002951.3236187.**p01 > > Le 26/06/2013 14:11, Lee Katz a écrit : > >> This might be a bug that I introduced if you are using the SVN version. >> Could you show me the first few lines of this file? >> >> /mnt/data2/home1/lquintri/**cgtest/annotation/aa.fasta.**card_hits.sql >> >> >> On Wed, Jun 26, 2013 at 5:09 AM, Laure QUINTRIC >> <Lau...@if... <mailto:Laure.Quintric@**ifremer.fr<Lau...@if...>>> >> wrote: >> >> Hello, >> >> do you plan to update cg-pipeline in order to handle interproscan5 xml >> output, which is different from interproscan4 ? >> >> I also have the error below, do you have an idea of the problem ? >> ANNOTATION GENBANK FILE CREATION START on cgtest Tue Jun 25 19:20:04 >> (CG-Pipeline v0.4.0.0) >> COMMAND >> run_annotation_genbank.pl <http://run_annotation_**genbank.pl<http://run_annotation_genbank.pl> >> > >> --organism=cgtest >> --prediction=/mnt/data2/home1/**lquintri/cgtest/prediction.gb >> <http://prediction.gb> >> --inputdir=/mnt/data2/home1/**lquintri/cgtest/annotation >> --gb=/mnt/data2/home1/**lquintri/cgtest/annotation.gb >> <http://annotation.gb> 2>&1 |tee --append >> cgtest/log/genbank.txt >> run_annotation_genbank.pl <http://run_annotation_**genbank.pl<http://run_annotation_genbank.pl> >> >: >> >> main::main: Putting all annotations in >> /mnt/data2/home1/lquintri/**cgtest/annotation into memory >> run_annotation_genbank.pl <http://run_annotation_**genbank.pl<http://run_annotation_genbank.pl> >> >: >> >> main::main: Transforming the prediction >> genbank into a set of features >> run_annotation_genbank.pl <http://run_annotation_**genbank.pl<http://run_annotation_genbank.pl> >> >: >> >> main::readSqlFile: TID3 >> /mnt/data2/home1/lquintri/**cgtest/annotation/aa.fasta.** >> card_hits.sql >> >> --------------------- WARNING --------------------- >> MSG: exception while parsing location line [1..25250] in reading >> EMBL/GenBank/SwissProt, ignoring feature source >> (seqid=NODE_100_length_25148_**cov_343.557709): Eval-group not >> allowed at >> runtime, use re 'eval' in regex m/(.*?)\(((?x-ism: >> (?> >> [^()]+ >> | >> \( >> (??{.../ at >> /home12/caparmor/bioinfo/**softs/perlmodules/lib/perl5/** >> Bio/Factory/FTLocationFactory.**pm >> line 160, <GEN0> line 14. >> >> ------------------------------**--------------------- >> Thread 2 terminated abnormally: Can't call method "primary_tag" on an >> undefined value at >> /home12/caparmor/bioinfo/**softs/perlmodules/lib/perl5/**Bio/SeqIO/ >> genbank.pm >> <http://genbank.pm> line >> >> 687, <GEN0> line 14. >> Can't use an undefined value as an ARRAY reference at >> /mnt/data/home12/bioinfo/**softs/sources/cgp/scripts/run_** >> annotation_genbank.pl <http://run_annotation_genbank.pl> >> <http://run_annotation_**genbank.pl<http://run_annotation_genbank.pl> >> > >> >> line 43. >> Perl exited with active threads: >> 2 running and unjoined >> -1 finished and unjoined >> 0 running and detached >> ANNOTATION GENBANK END on cgtest Tue Jun 25 19:20:04 (CG-Pipeline >> v0.4.0.0) >> >> Thank you, >> Regards, >> Laure >> >> ------------------------------**------------------------------** >> ------------------ >> This SF.net email is sponsored by Windows: >> >> Build for Windows Store. >> >> http://p.sf.net/sfu/windows-**dev2dev<http://p.sf.net/sfu/windows-dev2dev> >> ______________________________**_________________ >> Cg-pipeline-users mailing list >> Cg-pipeline-users@lists.**sourceforge.net<Cg-...@li...> >> <mailto:Cg-pipeline-users@**lists.sourceforge.net<Cg-...@li...> >> > >> >> https://lists.sourceforge.net/**lists/listinfo/cg-pipeline-**users<https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users> >> >> >> >> >> -- >> Lee Katz, Ph.D. >> > -- Lee Katz, Ph.D. |
|
From: Laure Q. <Lau...@if...> - 2013-06-26 12:41:59
|
Here are the first lines of the file /mnt/data2/home1/lquintri/cgtest/annotation/aa.fasta.card_hits.sql cgtest_0001|NC_011595.7058613.p01|1.6|12.16|/home12/caparmor/bioinfo/softs/sources/cgp/data/CARD.faa|43.59|445|MacA. [M] COG0845 Membrane-fusion protein. Encoded by gene ABBFA_003018. Homology: Secretion protein HlyD (HMMPfam: PF00529, score: 9.1e-08). ARO:1000001 process or component of antibiotic biology or chemistry. ARO:3000533 macA. [Acinetobacter baumannii AB307-0294]|1|55|25.8|56.4102564102564|NC_011595.7058613.p01|NC_011595.7058613.p01 cgtest_0001|NC_010410.6003290.p01|10.0|22.97|/home12/caparmor/bioinfo/softs/sources/cgp/data/CARD.faa|20.55|483|putative Outer membrane efflux protein. Evidence 3 : Function proposed based on presence of conserved amino acid motif, structural feature or limited homology; Product type pm : putative membrane component. Encoded by gene ABAYE1172. Homology: Outer membrane efflux protein (HMMPfam: PF02321, score: 7.6e-26). ARO:1000001 process or component of antibiotic biology or chemistry. ARO:3000779 adeH. [Acinetobacter baumannii AYE]|2|49|23.5|45.2054794520548|NC_010410.6003290.p01|NC_010410.6003290.p01 cgtest_0002|AJ250203.gene.p01|0.62|25.97|/home12/caparmor/bioinfo/softs/sources/cgp/data/CARD.faa|31.34|410|tet31 protein. Encoded by gene tet31. ARO:3000476 tet31. ARO:1000001 process or component of antibiotic biology or chemistry. [Aeromonas salmonicida]|1|57|26.6|43.2835820895522|AJ250203.gene.p01|AJ250203.gene.p01 cgtest_0003|NC_005054.2598278.p01|7.6|9.73|/home12/caparmor/bioinfo/softs/sources/cgp/data/CARD.faa|61.11|384|sensor histidine kinase VanS. Homology: Signal transduction histidine kinase-related protein, C-terminal (FPrintScan: PR00344, score: 7.5e-10). similar to PIR:B41838, and PIR:B41838; identified by sequence similarity; putative. Homology: ATPase-like, ATP-binding domain (HMMPfam: PF02518, score: 5.5e-22) (Gene3D: G3DSA:3.30.565.10, score: 5.7e-28). Homology: Signal transduction histidine kinase, subgroup 1, dimerisation/phosphoacceptor domain (HMMPfam: PF00512, score: 7.7e-12). Encoded by gene vanS. ARO:1000001 process or component of antibiotic biology or chemistry. ARO:3000071 vanS. [Staphylococcus aureus]|1|48|23.1|72.2222222222222|NC_005054.2598278.p01|NC_005054.2598278.p01 cgtest_0003|NC_014475.1.orf1.gene.p01|7.9|9.73|/home12/caparmor/bioinfo/softs/sources/cgp/data/CARD.faa|61.11|364|VanS. Encoded by gene vanS. ARO:1000001 process or component of antibiotic biology or chemistry. ARO:3000071 vanS. [Enterococcus faecalis]|2|47|22.7|72.2222222222222|NC_014475.1.orf1.gene.p01|NC_014475.1.orf1.gene.p01 cgtest_0005|NC_002758.1119966.p01|0.55|11.01|/home12/caparmor/bioinfo/softs/sources/cgp/data/CARD.faa|41.03|889|DNA gyrase subunit A. Encoded by gene gyrA. Homology: DNA topoisomerase, type IIA, subunit A/ C-terminal, alpha-beta (Gene3D: G3DSA:3.90.199.10, score: 8.6e-114). Homology: DNA gyrase/topoisomerase IV, subunit A, C-terminal beta-pinwheel (HMMPfam: PF03989, score: 1.6e-11). Homology: DNA topoisomerase, type IIA, subunit A, alpha-helical (Gene3D: G3DSA:1.10.268.10, score: 2.1e-31). Homology: DNA topoisomerase, type IIA, subunit A/C-terminal (HMMPfam: PF00521, score: 2.1e-157). ARO:1000001 process or component of antibiotic biology or chemistry. ARO:3000618 fluoroquinolone resistant gyrA. [Staphylococcus aureus subsp. aureus Mu50]|5|60|27.7|51.2820512820513|NC_002758.1119966.p01|NC_002758.1119966.p01 cgtest_0005|NC_002951.3236187.p01|0.55|11.01|/home12/caparmor/bioinfo/softs/sources/cgp/data/CARD.faa|41.03|887|DNA gyrase, A subunit. Encoded by gene gyrA. Homology: DNA topoisomerase, type IIA, subunit A/ C-terminal, alpha-beta (Gene3D: G3DSA:3.90.199.10, score: 4.2e-114). Homology: DNA topoisomerase, type IIA, subunit A/C-terminal (HMMPfam: PF00521, score: 8.3e-158). Homology: DNA topoisomerase, type IIA, subunit A, alpha-helical (Gene3D: G3DSA:1.10.268.10, score: 1.5e-31). identified by similarity to SP:P20831; match to protein family HMM PF00521; match to protein family HMM PF03989; match to protein family HMM TIGR01063. Homology: DNA gyrase/topoisomerase IV, subunit A, C-terminal beta-pinwheel (HMMPfam: PF03989, score: 1.6e-11). ARO:1000001 process or component of antibiotic biology or chemistry. ARO:3000618 fluoroquinolone resistant gyrA. [Staphylococcus aureus subsp. aureus COL]|2|60|27.7|51.2820512820513|NC_002951.3236187.p01|NC_002951.3236187.p01 Le 26/06/2013 14:11, Lee Katz a écrit : > This might be a bug that I introduced if you are using the SVN version. > Could you show me the first few lines of this file? > > /mnt/data2/home1/lquintri/cgtest/annotation/aa.fasta.card_hits.sql > > > On Wed, Jun 26, 2013 at 5:09 AM, Laure QUINTRIC > <Lau...@if... <mailto:Lau...@if...>> wrote: > > Hello, > > do you plan to update cg-pipeline in order to handle interproscan5 xml > output, which is different from interproscan4 ? > > I also have the error below, do you have an idea of the problem ? > ANNOTATION GENBANK FILE CREATION START on cgtest Tue Jun 25 19:20:04 > (CG-Pipeline v0.4.0.0) > COMMAND > run_annotation_genbank.pl <http://run_annotation_genbank.pl> > --organism=cgtest > --prediction=/mnt/data2/home1/lquintri/cgtest/prediction.gb > <http://prediction.gb> > --inputdir=/mnt/data2/home1/lquintri/cgtest/annotation > --gb=/mnt/data2/home1/lquintri/cgtest/annotation.gb > <http://annotation.gb> 2>&1 |tee --append > cgtest/log/genbank.txt > run_annotation_genbank.pl <http://run_annotation_genbank.pl>: > main::main: Putting all annotations in > /mnt/data2/home1/lquintri/cgtest/annotation into memory > run_annotation_genbank.pl <http://run_annotation_genbank.pl>: > main::main: Transforming the prediction > genbank into a set of features > run_annotation_genbank.pl <http://run_annotation_genbank.pl>: > main::readSqlFile: TID3 > /mnt/data2/home1/lquintri/cgtest/annotation/aa.fasta.card_hits.sql > > --------------------- WARNING --------------------- > MSG: exception while parsing location line [1..25250] in reading > EMBL/GenBank/SwissProt, ignoring feature source > (seqid=NODE_100_length_25148_cov_343.557709): Eval-group not allowed at > runtime, use re 'eval' in regex m/(.*?)\(((?x-ism: > (?> > [^()]+ > | > \( > (??{.../ at > /home12/caparmor/bioinfo/softs/perlmodules/lib/perl5/Bio/Factory/FTLocationFactory.pm > line 160, <GEN0> line 14. > > --------------------------------------------------- > Thread 2 terminated abnormally: Can't call method "primary_tag" on an > undefined value at > /home12/caparmor/bioinfo/softs/perlmodules/lib/perl5/Bio/SeqIO/genbank.pm > <http://genbank.pm> line > 687, <GEN0> line 14. > Can't use an undefined value as an ARRAY reference at > /mnt/data/home12/bioinfo/softs/sources/cgp/scripts/run_annotation_genbank.pl > <http://run_annotation_genbank.pl> > line 43. > Perl exited with active threads: > 2 running and unjoined > -1 finished and unjoined > 0 running and detached > ANNOTATION GENBANK END on cgtest Tue Jun 25 19:20:04 (CG-Pipeline > v0.4.0.0) > > Thank you, > Regards, > Laure > > ------------------------------------------------------------------------------ > This SF.net email is sponsored by Windows: > > Build for Windows Store. > > http://p.sf.net/sfu/windows-dev2dev > _______________________________________________ > Cg-pipeline-users mailing list > Cg-...@li... > <mailto:Cg-...@li...> > https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users > > > > > -- > Lee Katz, Ph.D. |
|
From: Lee K. <ls...@gm...> - 2013-06-26 12:16:38
|
As of now, I do not have any concrete plans to handle Interpro5 yet just
because of time constraints, but I would love to. The newest SVN source
code however will let you skip interproscan with the "--skip INTERPRO"
option. I realize that everyone does not want every kind of annotation
every time, and so I introduced some controls in run_annotation: --skip,
--just, and --goto (skip and just can be invoked multiple times in a single
command).
I would love a volunteer for the new Interpro script! Volunteers: please
contact me directly. I have so many other distinct ideas for modules, but
I don't have any time. The good news is that the ideas are very modular
and so it is possible for volunteers to be semi-independent.
On Wed, Jun 26, 2013 at 8:11 AM, Lee Katz <ls...@gm...> wrote:
> This might be a bug that I introduced if you are using the SVN version.
> Could you show me the first few lines of this file?
>
> /mnt/data2/home1/lquintri/cgtest/annotation/aa.fasta.card_hits.sql
>
>
> On Wed, Jun 26, 2013 at 5:09 AM, Laure QUINTRIC <Lau...@if...
> > wrote:
>
>> Hello,
>>
>> do you plan to update cg-pipeline in order to handle interproscan5 xml
>> output, which is different from interproscan4 ?
>>
>> I also have the error below, do you have an idea of the problem ?
>> ANNOTATION GENBANK FILE CREATION START on cgtest Tue Jun 25 19:20:04
>> (CG-Pipeline v0.4.0.0)
>> COMMAND
>> run_annotation_genbank.pl --organism=cgtest
>> --prediction=/mnt/data2/home1/lquintri/cgtest/prediction.gb
>> --inputdir=/mnt/data2/home1/lquintri/cgtest/annotation
>> --gb=/mnt/data2/home1/lquintri/cgtest/annotation.gb 2>&1 |tee --append
>> cgtest/log/genbank.txt
>> run_annotation_genbank.pl: main::main: Putting all annotations in
>> /mnt/data2/home1/lquintri/cgtest/annotation into memory
>> run_annotation_genbank.pl: main::main: Transforming the prediction
>> genbank into a set of features
>> run_annotation_genbank.pl: main::readSqlFile: TID3
>> /mnt/data2/home1/lquintri/cgtest/annotation/aa.fasta.card_hits.sql
>>
>> --------------------- WARNING ---------------------
>> MSG: exception while parsing location line [1..25250] in reading
>> EMBL/GenBank/SwissProt, ignoring feature source
>> (seqid=NODE_100_length_25148_cov_343.557709): Eval-group not allowed at
>> runtime, use re 'eval' in regex m/(.*?)\(((?x-ism:
>> (?>
>> [^()]+
>> |
>> \(
>> (??{.../ at
>>
>> /home12/caparmor/bioinfo/softs/perlmodules/lib/perl5/Bio/Factory/FTLocationFactory.pm
>> line 160, <GEN0> line 14.
>>
>> ---------------------------------------------------
>> Thread 2 terminated abnormally: Can't call method "primary_tag" on an
>> undefined value at
>> /home12/caparmor/bioinfo/softs/perlmodules/lib/perl5/Bio/SeqIO/genbank.pmline
>> 687, <GEN0> line 14.
>> Can't use an undefined value as an ARRAY reference at
>> /mnt/data/home12/bioinfo/softs/sources/cgp/scripts/
>> run_annotation_genbank.pl
>> line 43.
>> Perl exited with active threads:
>> 2 running and unjoined
>> -1 finished and unjoined
>> 0 running and detached
>> ANNOTATION GENBANK END on cgtest Tue Jun 25 19:20:04 (CG-Pipeline
>> v0.4.0.0)
>>
>> Thank you,
>> Regards,
>> Laure
>>
>>
>> ------------------------------------------------------------------------------
>> This SF.net email is sponsored by Windows:
>>
>> Build for Windows Store.
>>
>> http://p.sf.net/sfu/windows-dev2dev
>> _______________________________________________
>> Cg-pipeline-users mailing list
>> Cg-...@li...
>> https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users
>>
>
>
>
> --
> Lee Katz, Ph.D.
>
--
Lee Katz, Ph.D.
|
|
From: Lee K. <ls...@gm...> - 2013-06-26 12:11:45
|
This might be a bug that I introduced if you are using the SVN version.
Could you show me the first few lines of this file?
/mnt/data2/home1/lquintri/cgtest/annotation/aa.fasta.card_hits.sql
On Wed, Jun 26, 2013 at 5:09 AM, Laure QUINTRIC
<Lau...@if...>wrote:
> Hello,
>
> do you plan to update cg-pipeline in order to handle interproscan5 xml
> output, which is different from interproscan4 ?
>
> I also have the error below, do you have an idea of the problem ?
> ANNOTATION GENBANK FILE CREATION START on cgtest Tue Jun 25 19:20:04
> (CG-Pipeline v0.4.0.0)
> COMMAND
> run_annotation_genbank.pl --organism=cgtest
> --prediction=/mnt/data2/home1/lquintri/cgtest/prediction.gb
> --inputdir=/mnt/data2/home1/lquintri/cgtest/annotation
> --gb=/mnt/data2/home1/lquintri/cgtest/annotation.gb 2>&1 |tee --append
> cgtest/log/genbank.txt
> run_annotation_genbank.pl: main::main: Putting all annotations in
> /mnt/data2/home1/lquintri/cgtest/annotation into memory
> run_annotation_genbank.pl: main::main: Transforming the prediction
> genbank into a set of features
> run_annotation_genbank.pl: main::readSqlFile: TID3
> /mnt/data2/home1/lquintri/cgtest/annotation/aa.fasta.card_hits.sql
>
> --------------------- WARNING ---------------------
> MSG: exception while parsing location line [1..25250] in reading
> EMBL/GenBank/SwissProt, ignoring feature source
> (seqid=NODE_100_length_25148_cov_343.557709): Eval-group not allowed at
> runtime, use re 'eval' in regex m/(.*?)\(((?x-ism:
> (?>
> [^()]+
> |
> \(
> (??{.../ at
>
> /home12/caparmor/bioinfo/softs/perlmodules/lib/perl5/Bio/Factory/FTLocationFactory.pm
> line 160, <GEN0> line 14.
>
> ---------------------------------------------------
> Thread 2 terminated abnormally: Can't call method "primary_tag" on an
> undefined value at
> /home12/caparmor/bioinfo/softs/perlmodules/lib/perl5/Bio/SeqIO/genbank.pmline
> 687, <GEN0> line 14.
> Can't use an undefined value as an ARRAY reference at
> /mnt/data/home12/bioinfo/softs/sources/cgp/scripts/
> run_annotation_genbank.pl
> line 43.
> Perl exited with active threads:
> 2 running and unjoined
> -1 finished and unjoined
> 0 running and detached
> ANNOTATION GENBANK END on cgtest Tue Jun 25 19:20:04 (CG-Pipeline v0.4.0.0)
>
> Thank you,
> Regards,
> Laure
>
>
> ------------------------------------------------------------------------------
> This SF.net email is sponsored by Windows:
>
> Build for Windows Store.
>
> http://p.sf.net/sfu/windows-dev2dev
> _______________________________________________
> Cg-pipeline-users mailing list
> Cg-...@li...
> https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users
>
--
Lee Katz, Ph.D.
|
|
From: Laure Q. <Lau...@if...> - 2013-06-26 09:09:33
|
Hello,
do you plan to update cg-pipeline in order to handle interproscan5 xml
output, which is different from interproscan4 ?
I also have the error below, do you have an idea of the problem ?
ANNOTATION GENBANK FILE CREATION START on cgtest Tue Jun 25 19:20:04
(CG-Pipeline v0.4.0.0)
COMMAND
run_annotation_genbank.pl --organism=cgtest
--prediction=/mnt/data2/home1/lquintri/cgtest/prediction.gb
--inputdir=/mnt/data2/home1/lquintri/cgtest/annotation
--gb=/mnt/data2/home1/lquintri/cgtest/annotation.gb 2>&1 |tee --append
cgtest/log/genbank.txt
run_annotation_genbank.pl: main::main: Putting all annotations in
/mnt/data2/home1/lquintri/cgtest/annotation into memory
run_annotation_genbank.pl: main::main: Transforming the prediction
genbank into a set of features
run_annotation_genbank.pl: main::readSqlFile: TID3
/mnt/data2/home1/lquintri/cgtest/annotation/aa.fasta.card_hits.sql
--------------------- WARNING ---------------------
MSG: exception while parsing location line [1..25250] in reading
EMBL/GenBank/SwissProt, ignoring feature source
(seqid=NODE_100_length_25148_cov_343.557709): Eval-group not allowed at
runtime, use re 'eval' in regex m/(.*?)\(((?x-ism:
(?>
[^()]+
|
\(
(??{.../ at
/home12/caparmor/bioinfo/softs/perlmodules/lib/perl5/Bio/Factory/FTLocationFactory.pm
line 160, <GEN0> line 14.
---------------------------------------------------
Thread 2 terminated abnormally: Can't call method "primary_tag" on an
undefined value at
/home12/caparmor/bioinfo/softs/perlmodules/lib/perl5/Bio/SeqIO/genbank.pm line
687, <GEN0> line 14.
Can't use an undefined value as an ARRAY reference at
/mnt/data/home12/bioinfo/softs/sources/cgp/scripts/run_annotation_genbank.pl
line 43.
Perl exited with active threads:
2 running and unjoined
-1 finished and unjoined
0 running and detached
ANNOTATION GENBANK END on cgtest Tue Jun 25 19:20:04 (CG-Pipeline v0.4.0.0)
Thank you,
Regards,
Laure
|
|
From: Laure Q. <Lau...@if...> - 2013-06-19 14:30:41
|
wow, sounds great, thank you. Laure Le 19/06/2013 16:21, Lee Katz a écrit : > Jay Humphrey actually made a script a while ago, makefna.pl > <http://makefna.pl>. It looks like it will do exactly that. I should > incorporate it so that it spits out the fasta sequence after the > prediction stage. Good suggestion! > > > On Wed, Jun 19, 2013 at 10:04 AM, Laure QUINTRIC > <Lau...@if... <mailto:Lau...@if...>> wrote: > > Hello, > > I would like to know if there is a file generated by cgpipeline > containing all predicted ORFs nucleotide sequences or if it is > easily possible to generate it ? > > Kind regards. > Laure > > > > > -- > Lee Katz, Ph.D. |
|
From: Laure Q. <Lau...@if...> - 2013-06-19 14:22:53
|
Hello, I would like to know if there is a file generated by cgpipeline containing all predicted ORFs nucleotide sequences or if it is easily possible to generate it ? Kind regards. Laure |
|
From: Lee K. <ls...@gm...> - 2013-06-19 14:21:54
|
Jay Humphrey actually made a script a while ago, makefna.pl. It looks like it will do exactly that. I should incorporate it so that it spits out the fasta sequence after the prediction stage. Good suggestion! On Wed, Jun 19, 2013 at 10:04 AM, Laure QUINTRIC <Lau...@if...>wrote: > Hello, > > I would like to know if there is a file generated by cgpipeline containing > all predicted ORFs nucleotide sequences or if it is easily possible to > generate it ? > > Kind regards. > Laure > -- Lee Katz, Ph.D. |
|
From: kokwei <kok...@gm...> - 2013-06-10 06:24:34
|
Thanks for your prompt answer. On 10/6/2013 1:00 AM, Lee Katz wrote: > Hi, unfortunately it looks like I added something into run_prediction > that isn't perl 5.8 compatible. Thank you for pointing it out. I will > put in some better error reporting for it. > > The best fix, it seems is to upgrade to something newer. I think that > perl 5.10 should be ok, but you will be safer with 5.12 or 5.14 (or > newer). > > Let me know if you have any other problems. > > On Jun 9, 2013, at 10:48, kokwei <kok...@gm... > <mailto:kok...@gm...>> wrote: > >> Hello, >> >> I was trying to run the prediction module to get the ORF predicted >> from a bacterial genome and encountered the following error: >> >> run_prediction: AKUtils::getBLASTGenePredictions: Reading blast results >> run_prediction: Thread::Queue::enqueue: Invalid value for shared >> scalar at /usr/lib/perl5/5.8.8/Thread/Queue.pm line 90, <BLSOUT> line 78. >> A thread exited while 17 threads were running at >> /usr/lib/perl5/5.8.8/Thread/Queue.pm line 90, <BLSOUT> line 78. >> >> Can anyone help me to get through this, also included the command I >> used and part of <BLSOUT> around line 78 (labelled with bold), >> >> run_pipeline predict -p project1 >> ========================================== >> # BLASTP 2.2.26+ >> # Query: >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGC >> # Database: /share/apps/cg_pipeline/data/uniprot_sprot >> # Fields: query id, subject id, % identity, alignment length, >> mismatches, gap opens, q. start, q. end, s. start, s. >> # 28 hits found >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT >> *# BLASTP 2.2.26+**(line 78)* >> # Query: >> scaffold477.size2524_816_58_-_915_858_58_816_ATGACGGCCTCCGATTGCCGCCCTCCACGAGCGCACGCGATGCCACACGACGATCCGACGA >> # Database: /share/apps/cg_pipeline/data/uniprot_sprot >> # Fields: query id, subject id, % identity, alignment length, >> mismatches, gap opens, q. start, q. end, s. start, s. >> # 4 hits found >> ================================= >> >> Thanks. >> >> >> ------------------------------------------------------------------------------ >> How ServiceNow helps IT people transform IT departments: >> 1. A cloud service to automate IT design, transition and operations >> 2. Dashboards that offer high-level views of enterprise services >> 3. A single system of record for all IT processes >> http://p.sf.net/sfu/servicenow-d2d-j >> _______________________________________________ >> Cg-pipeline-users mailing list >> Cg-...@li... >> <mailto:Cg-...@li...> >> https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users |
|
From: Lee K. <ls...@gm...> - 2013-06-09 17:00:41
|
Hi, unfortunately it looks like I added something into run_prediction that isn't perl 5.8 compatible. Thank you for pointing it out. I will put in some better error reporting for it. The best fix, it seems is to upgrade to something newer. I think that perl 5.10 should be ok, but you will be safer with 5.12 or 5.14 (or newer). Let me know if you have any other problems. On Jun 9, 2013, at 10:48, kokwei <kok...@gm...> wrote: Hello, I was trying to run the prediction module to get the ORF predicted from a bacterial genome and encountered the following error: run_prediction: AKUtils::getBLASTGenePredictions: Reading blast results run_prediction: Thread::Queue::enqueue: Invalid value for shared scalar at /usr/lib/perl5/5.8.8/Thread/Queue.pm line 90, <BLSOUT> line 78. A thread exited while 17 threads were running at /usr/lib/perl5/5.8.8/Thread/Queue.pm line 90, <BLSOUT> line 78. Can anyone help me to get through this, also included the command I used and part of <BLSOUT> around line 78 (labelled with bold), run_pipeline predict -p project1 ========================================== # BLASTP 2.2.26+ # Query: scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGC # Database: /share/apps/cg_pipeline/data/uniprot_sprot # Fields: query id, subject id, % identity, alignment length, mismatches, gap opens, q. start, q. end, s. start, s. # 28 hits found scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT *# BLASTP 2.2.26+** (line 78)* # Query: scaffold477.size2524_816_58_-_915_858_58_816_ATGACGGCCTCCGATTGCCGCCCTCCACGAGCGCACGCGATGCCACACGACGATCCGACGA # Database: /share/apps/cg_pipeline/data/uniprot_sprot # Fields: query id, subject id, % identity, alignment length, mismatches, gap opens, q. start, q. end, s. start, s. # 4 hits found ================================= Thanks. ------------------------------------------------------------------------------ How ServiceNow helps IT people transform IT departments: 1. A cloud service to automate IT design, transition and operations 2. Dashboards that offer high-level views of enterprise services 3. A single system of record for all IT processes http://p.sf.net/sfu/servicenow-d2d-j _______________________________________________ Cg-pipeline-users mailing list Cg-...@li... https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users |
|
From: kokwei <kok...@gm...> - 2013-06-09 14:48:53
|
Hello, I was trying to run the prediction module to get the ORF predicted from a bacterial genome and encountered the following error: run_prediction: AKUtils::getBLASTGenePredictions: Reading blast results run_prediction: Thread::Queue::enqueue: Invalid value for shared scalar at /usr/lib/perl5/5.8.8/Thread/Queue.pm line 90, <BLSOUT> line 78. A thread exited while 17 threads were running at /usr/lib/perl5/5.8.8/Thread/Queue.pm line 90, <BLSOUT> line 78. Can anyone help me to get through this, also included the command I used and part of <BLSOUT> around line 78 (labelled with bold), run_pipeline predict -p project1 ========================================== # BLASTP 2.2.26+ # Query: scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGC # Database: /share/apps/cg_pipeline/data/uniprot_sprot # Fields: query id, subject id, % identity, alignment length, mismatches, gap opens, q. start, q. end, s. start, s. # 28 hits found scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT scaffold477.size2524_1995_1138_-_2028_891_1138_1995_ATGCGGGGCGCGGGTTGGCGCAACCCGACCCCATGCGCTAATCTTCTCCGCTGCACATCATTT *# BLASTP 2.2.26+**(line 78)* # Query: scaffold477.size2524_816_58_-_915_858_58_816_ATGACGGCCTCCGATTGCCGCCCTCCACGAGCGCACGCGATGCCACACGACGATCCGACGA # Database: /share/apps/cg_pipeline/data/uniprot_sprot # Fields: query id, subject id, % identity, alignment length, mismatches, gap opens, q. start, q. end, s. start, s. # 4 hits found ================================= Thanks. |
|
From: kokwei <kok...@gm...> - 2013-06-09 14:22:36
|
kok...@gm... |
|
From: Lee K. <ls...@gm...> - 2012-12-20 13:48:30
|
Hi Yucai, Annotation_uniprot.db3 and annotation_uniprot_evidence.db3 are custom databases in Berkeley database format. They are created when running run_annotation_parse_uniprot_xml.pl on the two XML files from Uniprot. These XML files are downloaded during the CG-Pipeline installation. The db3 files store information about Uniprot matches that you will have after running run_annotation (and its sub module). For vfdb_blast_db and other parameters, please set them in cg_pipeline/conf/cgpipelinerc Please see cg_pipeline/doc/INSTALL for more help, or please write back to this mailing list again if it does not address what you are looking for. Good luck! --Lee On Wed, Dec 19, 2012 at 10:13 PM, 230119304 <230...@se...> wrote: > ** > Dear professor: > > When i was used the cg_pipeline, i have some problems. > i don't understand these files: > annotation_uniprot_db3 and annotation_uniprot_evidence_db3 > where and how can i get the files ? > And how to set parameters about vfdb_blast_db? > > > I am looking forward to your reply. > sincerely yours, > fanYucai > ------------------------------ > 230119304 > > > ------------------------------------------------------------------------------ > LogMeIn Rescue: Anywhere, Anytime Remote support for IT. Free Trial > Remotely access PCs and mobile devices and provide instant support > Improve your efficiency, and focus on delivering more value-add services > Discover what IT Professionals Know. Rescue delivers > http://p.sf.net/sfu/logmein_12329d2d > _______________________________________________ > Cg-pipeline-users mailing list > Cg-...@li... > https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users > > -- Lee Katz, Ph.D. |
|
From: 230119304 <230...@se...> - 2012-12-20 03:14:10
|
Dear professor: When i was used the cg_pipeline, i have some problems. i don't understand these files: annotation_uniprot_db3 and annotation_uniprot_evidence_db3 where and how can i get the files ? And how to set parameters about vfdb_blast_db? I am looking forward to your reply. sincerely yours, fanYucai 230119304 |
|
From: Lee K. <ls...@gm...> - 2012-12-13 14:48:32
|
I agree that it is weird that it is taking so long. I am querying Jay who might be able to put an older db3 and its partner BLAST database on the website. I multithreaded the script for parsing the database in source control (URL is below). I don't think that anyone outside of our team has used it yet, but it's ready for some beta testing. Give it a try. I think it requires Perl >=5.10 with multithreading. To get started, download it to your normal scripts directory and run it with -h for usage information, or just supply the xml files. run_annotation_parse_uniprot_xml.pl -h run_annotation_parse_uniprot_xml.pl uniprot_sprot.xml uniprot_trembl.xml # while in your data directory http://sourceforge.net/p/cg-pipeline/code/364/tree/cg_pipeline/branches/lkatz/scripts/run_annotation_parse_uniprot_xml.pl On Thu, Dec 13, 2012 at 2:35 AM, Laure QUINTRIC <Lau...@if...>wrote: > Hello, > Since last friday, I'm waiting for cgpipeline.db3 and > cgpipeline.evidence.db3 to be created, and today it's only : > run_annotation_parse_uniprot_xml.pl: main::main: [63%] Processed > 17132000 records... > > Is it possible to download somewhere (ftp?) your last annotation db3 > files ? As I need them for Monday... I'm not sure I will reach 100% > until then. > > Thanks a lot > Laure > > > ------------------------------------------------------------------------------ > LogMeIn Rescue: Anywhere, Anytime Remote support for IT. Free Trial > Remotely access PCs and mobile devices and provide instant support > Improve your efficiency, and focus on delivering more value-add services > Discover what IT Professionals Know. Rescue delivers > http://p.sf.net/sfu/logmein_12329d2d > _______________________________________________ > Cg-pipeline-users mailing list > Cg-...@li... > https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users > -- Lee Katz, Ph.D. |
|
From: Laure Q. <Lau...@if...> - 2012-12-13 07:35:31
|
Hello, Since last friday, I'm waiting for cgpipeline.db3 and cgpipeline.evidence.db3 to be created, and today it's only : run_annotation_parse_uniprot_xml.pl: main::main: [63%] Processed 17132000 records... Is it possible to download somewhere (ftp?) your last annotation db3 files ? As I need them for Monday... I'm not sure I will reach 100% until then. Thanks a lot Laure |
|
From: Lee K. <ls...@gm...> - 2012-12-07 14:53:37
|
Ok, good to know! And anyone looking for the same problem will be able to fix it with what you said. Thank you! Hopefully this Sourceforge upgrade that I'm about to hit OK on won't affect the mailing list though... On Fri, Dec 7, 2012 at 2:45 AM, Laure QUINTRIC <Lau...@if...>wrote: > Actually, the issue was glimmer3 and long-orfs options which were not > recognized, so I modified AKUtils.pm to change $longorfs_opts and > $glimmer_opts in order to have something like : > long-orfs $longorfs_opts -n -t 1.15 > instead of > long-orfs $longorfs_opts --no_header --cutoff 1.15. > > maybe my glimmer3 version does not allow using long options... > > Regards, > Laure > > Le 06/12/2012 17:54, Lee Katz a écrit : > >> Let's see... this is older code so I am feeling my way here. I'll give >> a few points to look into, and hopefully one will address your issue. >> >> First, the `run_pipeline predict` command will look for the file >> myproject/assembly.fasta. Does myseq.fasta match >> myproject/assembly.fasta? You could simply copy myseq.fasta to >> assembly.fasta, or another thing you could do is use `run_prediction >> myseq.fasta -o myproject/prediction.gb <http://prediction.gb>` >> >> >> Second, is glimmer installed properly on your machine? Did you install >> it using Linux repositories? >> >> Third if all else fails, could you give us the CG-Pipeline where it >> matches this error reporting line? >> Error running long-orfs with command\n long-orfs $longorfs_opts >> --no_header --cutoff 1.15 '$longorfs_infile' '$longorfs_infile.longorfs' >> 2>'$$settings{tempdir}/**glimmer3.log'\nError was $! >> >> Thanks for letting us know about the problem! Let us know if one of >> these avenues fixes the problem. >> >> >> >> >> On Thu, Dec 6, 2012 at 10:39 AM, Laure QUINTRIC >> <Lau...@if... <mailto:Laure.Quintric@**ifremer.fr<Lau...@if...>>> >> wrote: >> >> Hello, >> I'm currently trying to use the cg-pipeline, and I have some troubles >> using the prediction part to calculate long-orfs : >> >> when I run run_pipeline predict -p myproject -i myseq.fasta >> >> in the myproject/build/prediction/**glimmer3.log is written : >> >> --- >> Starting at Thu Dec 6 16:18:59 2012 >> >> long-orfs: invalid option -- '-' >> Unrecognized option -- >> USAGE: long-orfs [options] <sequence-file> <output-file> >> --- >> >> is there a way to go through this ? maybe by launching manually the >> command? >> thanks. >> >> Laure >> IFREMER - France >> >> ------------------------------**------------------------------** >> ------------------ >> LogMeIn Rescue: Anywhere, Anytime Remote support for IT. Free Trial >> Remotely access PCs and mobile devices and provide instant support >> Improve your efficiency, and focus on delivering more value-add >> services >> Discover what IT Professionals Know. Rescue delivers >> http://p.sf.net/sfu/logmein_**12329d2d<http://p.sf.net/sfu/logmein_12329d2d> >> ______________________________**_________________ >> Cg-pipeline-users mailing list >> Cg-pipeline-users@lists.**sourceforge.net<Cg-...@li...> >> <mailto:Cg-pipeline-users@**lists.sourceforge.net<Cg-...@li...> >> > >> >> https://lists.sourceforge.net/**lists/listinfo/cg-pipeline-**users<https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users> >> >> >> >> >> -- >> Lee Katz, Ph.D. >> > -- Lee Katz, Ph.D. |
|
From: Laure Q. <Lau...@if...> - 2012-12-07 07:45:38
|
Actually, the issue was glimmer3 and long-orfs options which were not recognized, so I modified AKUtils.pm to change $longorfs_opts and $glimmer_opts in order to have something like : long-orfs $longorfs_opts -n -t 1.15 instead of long-orfs $longorfs_opts --no_header --cutoff 1.15. maybe my glimmer3 version does not allow using long options... Regards, Laure Le 06/12/2012 17:54, Lee Katz a écrit : > Let's see... this is older code so I am feeling my way here. I'll give > a few points to look into, and hopefully one will address your issue. > > First, the `run_pipeline predict` command will look for the file > myproject/assembly.fasta. Does myseq.fasta match > myproject/assembly.fasta? You could simply copy myseq.fasta to > assembly.fasta, or another thing you could do is use `run_prediction > myseq.fasta -o myproject/prediction.gb <http://prediction.gb>` > > Second, is glimmer installed properly on your machine? Did you install > it using Linux repositories? > > Third if all else fails, could you give us the CG-Pipeline where it > matches this error reporting line? > Error running long-orfs with command\n long-orfs $longorfs_opts > --no_header --cutoff 1.15 '$longorfs_infile' '$longorfs_infile.longorfs' > 2>'$$settings{tempdir}/glimmer3.log'\nError was $! > > Thanks for letting us know about the problem! Let us know if one of > these avenues fixes the problem. > > > > > On Thu, Dec 6, 2012 at 10:39 AM, Laure QUINTRIC > <Lau...@if... <mailto:Lau...@if...>> wrote: > > Hello, > I'm currently trying to use the cg-pipeline, and I have some troubles > using the prediction part to calculate long-orfs : > > when I run run_pipeline predict -p myproject -i myseq.fasta > > in the myproject/build/prediction/glimmer3.log is written : > > --- > Starting at Thu Dec 6 16:18:59 2012 > > long-orfs: invalid option -- '-' > Unrecognized option -- > USAGE: long-orfs [options] <sequence-file> <output-file> > --- > > is there a way to go through this ? maybe by launching manually the > command? > thanks. > > Laure > IFREMER - France > > ------------------------------------------------------------------------------ > LogMeIn Rescue: Anywhere, Anytime Remote support for IT. Free Trial > Remotely access PCs and mobile devices and provide instant support > Improve your efficiency, and focus on delivering more value-add services > Discover what IT Professionals Know. Rescue delivers > http://p.sf.net/sfu/logmein_12329d2d > _______________________________________________ > Cg-pipeline-users mailing list > Cg-...@li... > <mailto:Cg-...@li...> > https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users > > > > > -- > Lee Katz, Ph.D. |
|
From: Lee K. <ls...@gm...> - 2012-12-06 16:54:45
|
Let's see... this is older code so I am feeling my way here. I'll give a
few points to look into, and hopefully one will address your issue.
First, the `run_pipeline predict` command will look for the file
myproject/assembly.fasta. Does myseq.fasta match myproject/assembly.fasta?
You could simply copy myseq.fasta to assembly.fasta, or another thing you
could do is use `run_prediction myseq.fasta -o myproject/prediction.gb`
Second, is glimmer installed properly on your machine? Did you install it
using Linux repositories?
Third if all else fails, could you give us the CG-Pipeline where it matches
this error reporting line?
Error running long-orfs with command\n long-orfs $longorfs_opts
--no_header --cutoff 1.15 '$longorfs_infile' '$longorfs_infile.longorfs'
2>'$$settings{tempdir}/glimmer3.log'\nError was $!
Thanks for letting us know about the problem! Let us know if one of these
avenues fixes the problem.
On Thu, Dec 6, 2012 at 10:39 AM, Laure QUINTRIC
<Lau...@if...>wrote:
> Hello,
> I'm currently trying to use the cg-pipeline, and I have some troubles
> using the prediction part to calculate long-orfs :
>
> when I run run_pipeline predict -p myproject -i myseq.fasta
>
> in the myproject/build/prediction/glimmer3.log is written :
>
> ---
> Starting at Thu Dec 6 16:18:59 2012
>
> long-orfs: invalid option -- '-'
> Unrecognized option --
> USAGE: long-orfs [options] <sequence-file> <output-file>
> ---
>
> is there a way to go through this ? maybe by launching manually the
> command?
> thanks.
>
> Laure
> IFREMER - France
>
>
> ------------------------------------------------------------------------------
> LogMeIn Rescue: Anywhere, Anytime Remote support for IT. Free Trial
> Remotely access PCs and mobile devices and provide instant support
> Improve your efficiency, and focus on delivering more value-add services
> Discover what IT Professionals Know. Rescue delivers
> http://p.sf.net/sfu/logmein_12329d2d
> _______________________________________________
> Cg-pipeline-users mailing list
> Cg-...@li...
> https://lists.sourceforge.net/lists/listinfo/cg-pipeline-users
>
--
Lee Katz, Ph.D.
|
|
From: Laure Q. <Lau...@if...> - 2012-12-06 15:39:57
|
Hello, I'm currently trying to use the cg-pipeline, and I have some troubles using the prediction part to calculate long-orfs : when I run run_pipeline predict -p myproject -i myseq.fasta in the myproject/build/prediction/glimmer3.log is written : --- Starting at Thu Dec 6 16:18:59 2012 long-orfs: invalid option -- '-' Unrecognized option -- USAGE: long-orfs [options] <sequence-file> <output-file> --- is there a way to go through this ? maybe by launching manually the command? thanks. Laure IFREMER - France |
|
From: Jay <jhu...@gm...> - 2012-01-25 17:48:51
|
This is just to remind you that you're still subscribed and the project is still alive! Best wishes -- Jay Humphrey Ensembl Genomes Web Developer EMBL-EBI Tel: +44-(0)1223-492682 Wellcome Trust Genome Campus Fax: +44-(0)1223-494468 Cambridge CB10 1SD, UK http://www.ensemblgenomes.org/ |
