To Run

How to Run:

The simulator is written in Perl and should work on most Linux-based operating systems.

1) Edit the .pl file to reflect the maximum size, CNV type and number of mismatches to allow. By default, the maximum size is 25.3 Mb and microhomology allows for zero mismatches. Further details are in the header of the .pl file.

2) To run type:

perl breakpoint_microhomology_simulator.pl

This should simulate a single duplication and output something like:
chr20,30397854,46090368,GTTGCTTATAACAGAAATAACATAATACATAAAACTTGGT AGGCAGTTTAAGGATGTCACCATAAAATGGACTTTACCTT,C/C 1 microhomology with 0 mismatch(es),|1|0| CAT/CAT 3 microhomology with 0 mismatch(es)|3|0

Columns refer to the following:
Chromosome, duplication start, duplication end, final 40 bp of the duplication, first 40 bp of the duplication, microhomology description, micohomology length|number mismatches

3) Micohomology is calculated by generating substrings of 1,2,3,4 .. basepairs in length starting from the middle of each sequence and walking out one basepair at a time until the mismatch limit has been breached.