for the latest version bowtie2-2.0.5/bowtie2 the following error message appears for each read. This wasn't happening in earlier bowtie2 versions for the our same datasets and comands used:
bowtie2 -f -p 2 -k 1 --very-sensitive --un-conc unaligned_reads/101_files -x genome_file -1 bowtie_out/101.pair1 -2 bowtie_out/101.pair2 -U bowtie_out/101.singletons -S bowtie_out/101.sam
Argument ">@NINA_0030:7:1:19416:1020#0/1%0AGGTGGCTTTGGTTGTATGGGTAG..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 13.
Argument ">@NINA_0030:7:1:19416:1020#0/2%0AATTACTCTTATCTTTTTCTTTTT..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 15.
Argument ">@NINA_0030:7:1:6896:1022#0/1%0ATATAGAGTTTAGTAGGCGTATAAA..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 17.
Argument ">@NINA_0030:7:1:6896:1022#0/2%0ACTATAGAGTTTAATAGTTCGCTTA..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 19.
Argument ">@NINA_0030:7:1:12832:1025#0/2%0ACAGTTTCCCACAATCGTCTCATT..." isn't numeric in bitwise and (&) at /usr/local/bioinfosoft/bowtie2-2.0.5/bowtie2 line 413, <BT> line 21.
This error is happening when the fasta header has a @ after the > such as:
>@NINA_0030:8:1:3487:1035#0/1
AACGTTTAGCCGCTATAAATTAATTATCCCTATAGTAACTTTTTAGTACT
The error does not happen anymore. However, the '@' sign cannot be part of the output since this will be against the SAM output format specifications.
Val
Argument ">TamiR8001%0ATCCCACAATATAAGACGTTTT%0" isn't numeric in bitwise and (&) at /data1/masw/bowtie2-2.3.1-legacy/bowtie2 line 551, <BT> line 4.
Argument ">TamiR8001%0ATCCCACAATATAAGACGTTTT%0" isn't numeric in bitwise and (&) at /data1/masw/bowtie2-2.3.1-legacy/bowtie2 line 551, <BT> line 6.
Argument ">TamiR8001%0ATCCCACAATATAAGACGTTTT%0" isn't numeric in bitwise and (&) at /data1/masw/bowtie2-2.3.1-legacy/bowtie2 line 551, <BT> line 8.