#238 bowtie 0.12.7 colorspace unmapped but mapped

[Anonymous]

Hi Ben,

We have used bowtie 0.12.7 64-bit to map SOLiD reads to both mRNA and genome sequence. We saw some interesting cases in which the reads mapped to genome location of the mRNAs (when mapped to genome index) but not mapped to the mRNA index.
Could you give us a potential explanation for why this could happen? Could it be due to the colorspace conversion?

We really appreciate your help. If you need any file to demonstrate it, we are happy to send them to you.

Best,

Hoa

The University of Pennsylvania
Laboratory of Junhyong Kim
kim.bio.upenn.edu

#####

Here are two examples we picked out:

test_bowtie.csfasta:
>1279_48_327_F3
T30202210310311223303333213232132131
>1279_109_287_F3
T21011322013012332221022113232132131

test_bowtie.qual:
>1279_48_327_F3
33 33 30 31 32 31 31 31 33 27 22 25 27 23 27 32 26 30 22 25 18 5 31 18 4 8 6 31 23 10 19 15 17 14 22
>1279_109_287_F3
30 29 33 30 25 21 31 33 33 31 12 26 32 29 5 5 25 31 31 23 4 31 29 16 17 9 26 24 21 26 6 30 24 15 25

the bowtie commands we used:

test_bowtie_genome.sam:@PG ID:Bowtie VN:0.12.7 CL:"bowtie -t -f -C -v 2 --trim3 12 -a -m 1 --best --sam -p 4 -Q test_bowtie.qual /home/hoagiang/bin/bowtie/0.12.7/indexes/S288C_cs/S288C_cs test_bowtie.csfasta test_bowtie_genome.sam --un test_bowtie_genome_unmapped"

test_bowtie_refseq.sam:@PG ID:Bowtie VN:0.12.7 CL:"bowtie -t -f -C -v 2 --trim3 12 -a -m 1 --best --sam -p 4 -Q test_bowtie.qual /home/hoagiang/bin/bowtie/0.12.7/indexes/S288C_SGD_R64_transcriptome_cs/S288C_mRNA_cs test_bowtie.csfasta test_bowtie_refseq.sam --un test_bowtie_refseq_unmapped"

The results we got from mapping to the genome:
test_bowtie_genome.sam:1279_48_327_F3 0 chrXI 163830 255 21M * 0 AGGAGTTACCGTGAGCGGCGA `^``__a]RPUSS\[YUPL.; XA:i:1 MD:Z:21 NM:i:0 CM:i:1
test_bowtie_genome.sam:1279_109_287_F3 16 chrXII 283214 255 21M * 0 CTTGAGAATCAACAAGATGTT ]D<W_Y5!C^[/4acaUOX`_ XA:i:2 MD:Z:21 NM:i:0 CM:i:2

whereas the mRNAs are:
>YKL152C GPM1 SGDID:S000001635, Chr XI from 164385-163642, Genome Release 64-1-1, reverse complement, Verified ORF, "Tetrameric phosphoglycerate mutase, mediates the conversion of 3-phosphoglycerate to 2-phosphoglycerate during glycolysis and the reverse reaction during gluconeogenesis"
>YLR075W RPL10 SGDID:S000004065, Chr XII from 282927-283592, Genome Release 64-1-1, Verified ORF, "Protein component of the large (60S) ribosomal subunit, responsible for joining the 40S and 60S subunits; regulates translation initiation; has similarity to rat L10 ribosomal protein and to members of the QM gene family"

The two indexes are built from the SGD website: R64-1-1 version of the S288C genome and orf_genomic.fasta