amos-help — For general AMOS questions and help.

[AMOS-help] install error

[Rádai Z. <zoz...@gm...>]

Dear AMOS Development,

I'd like to ask some help in relation to errors encountered during the
installation of AMOS 3.1.0.

After I run: "./configure --prefix=/usr/local/AMOS PYTHON=/usr/bin/python3
--with-Qt-dir=/usr/share/qt4"

there are no missing nodes or warnings. However, when I run "make", I get
the errors below

make[2]: *** [Makefile:918: genome-complexity-fast.o] Error 1
make[2]: Leaving directory '/home/zozoo/Science/Software/AMOS/src/Align'
make[1]: *** [Makefile:325: install-recursive] Error 1
make[1]: Leaving directory '/home/zozoo/Science/Software/AMOS/src'
make: *** [Makefile:306: install-recursive] Error 1

I tried adding ' CXXFLAGS="$CXXFLAGS -Wno-narrowing" ' to the configure but
it doesn't change the results from "make".

I couldn't resolve it unfortunately, and did not find any solutions for it
on existing mailing lists / descriptions. Could you please help me in how
to resolve this issue?

Thank you in advance,
With kind regards,
Zoltan

[AMOS-help] minimus2 produces empty .ovl file

[Copetti D. <dar...@us...>]

Hello,

I have sets of (2-7) overlapping contigs that I want to merge, in a separate minimus2 job for each set of contigs with overlaps.
After preparing the .afg file I run
minimus2 ctg_4075-ctg_8153 -D REFCOUNT=1 -D OVERLAP=5000 (also with overlap down to 1000)
And I get the following:
$ ls -lrth
total 9.0M
-rwx------ 1 copettid mpb 326K May 25 15:49 ctg_4075-ctg_8153.fa
-rwx------ 1 copettid mpb 653K May 25 15:50 ctg_4075-ctg_8153.afg
-rwx------ 1 copettid mpb 248K May 25 16:46 ctg_4075-ctg_8153.ref.seq
-rwx------ 1 copettid mpb  78K May 25 16:46 ctg_4075-ctg_8153.qry.seq
-rwx------ 1 copettid mpb 1.3K May 25 16:46 ctg_4075-ctg_8153.delta
-rwx------ 1 copettid mpb   86 May 25 16:46 ctg_4075-ctg_8153.coords
-rwx------ 1 copettid mpb    0 May 25 16:46 ctg_4075-ctg_8153.ovl
-rwx------ 1 copettid mpb    0 May 25 16:46 ctg_4075-ctg_8153.contig
-rwx------ 1 copettid mpb    0 May 25 16:46 ctg_4075-ctg_8153.fasta
-rwx------ 1 copettid mpb   32 May 25 16:46 ctg_4075-ctg_8153.singletons
drwx------ 2 copettid mpb    0 May 25 16:46 ctg_4075-ctg_8153.bnk
-rwx------ 1 copettid mpb 326K May 25 16:46 ctg_4075-ctg_8153.singletons.seq
-rwx------ 1 copettid mpb  14K May 25 16:46 ctg_4075-ctg_8153.runAmos.log
With the overlap (17 kb, almost 97% identity) is not used to merge the conitgs.

Looking at the log file I see that the issue is at step 22 and if I run it manually I get one line:
$ /home/copettid/miniconda3/envs/amos_env/bin/nucmer2ovl -ignore 20 -tab ctg_4075-ctg_8153.coords | /home/copettid/miniconda3/envs/amos_env/bin/sort2
1       2       N       -60722  -232258 17611   97.44
While instead the .ovl file is empty.

What is the reason for this? Too few contigs? Not the right parameters? Does the Maximum consensus error matter in my case, with overlaps between max 2 sequences?
Thanks,

Dario


Molecular Plant Breeding
Institute of Agricultural Sciences
ETH Zurich - LFW A53<http://www.mapsearch.ethz.ch/map/mapSearchPre.do?gebaeudeMap=LFW&lang=en>
Universitaetstrasse 2<https://maps.google.com/?q=Universitaetstrasse+2&entry=gmail&source=g>
8092 Zurich, Switzerland
www.mpb.ethz.ch<http://www.mpb.ethz.ch/>

[AMOS-help] (no subject)

[Сергей П. <poe...@li...>]

Dear, AMOS team

git clone https://git.code.sf.net/p/amos/code amos-code
I can not download the development version 


Regular version.
I have next problem at make command

Makefile:329: recipe for target 'FileSystem.o' failed
make[3]: *** [FileSystem.o] Error 1
make[3]: Leaving directory '/home/sergey/amos-2.0.8/src/Foundation'
Makefile:290: recipe for target 'all-recursive' failed
make[2]: *** [all-recursive] Error 1
make[2]: Leaving directory '/home/sergey/amos-2.0.8/src'
Makefile:269: recipe for target 'all-recursive' failed
make[1]: *** [all-recursive] Error 1
make[1]: Leaving directory '/home/sergey/amos-2.0.8'
Makefile:207: recipe for target 'all' failed
make: *** [all] Error 2

Limnological Institute Siberian Branch of the Russian Academy of Sciences,  Laboratory of Aquatic Microbiology
http://www.lin.irk.ru/en/  
https://www.researchgate.net/profile/Sergey_Potapov4  
mailto: poe...@li...


Best regards, Sergey Potapov.

[AMOS-help] error message from amos running

[Xin G. <ga...@um...>]

Dear Amos support team:


I tried to use minimus2 (from amos) to merge two versions of genome
assembles. Here are my commands:


/projects/mikem/applications/centos7/amos/bin/toAmos -s
pilon.plus.spades.short.

assembly.fasta -o pilon.plus.spades.short.assembly.afg

/projects01/arifakhanlabs/Xin/script/minimus2 pilon.plus.spades.short.assembly
-

D REFCOUNT=4577


However, I got the following error messages:


====



spades-output-sp9-slot24-version12-removePB]$ tail -30
pilon.plus.spades.short.assembly.runAmos.log

!!! 2018-08-01 23:35:00  Doing step 13

!!! 2018-08-01 23:35:00  Running:
/projects/mikem/applications/centos7/amos/bin//dumpreads
pilon.plus.spades.short.assembly.bnk -m 4577 > pilon.plus.spades.short.
assembly.qry.seq

Objects seen: 613867

Objects written: 609290

!!! 2018-08-01 23:35:33  Done! Elapsed time:0d 0h 0m 33s


!!! 2018-08-01 23:35:33  Doing step 20:  Getting overlaps

!!! 2018-08-01 23:35:33  Running: nucmer -maxmatch -c 40
pilon.plus.spades.short.assembly.ref.seq
pilon.plus.spades.short.assembly.qry.seq
-p pilon.plus.spades.short.assembly

1: PREPARING DATA

2,3: RUNNING mummer AND CREATING CLUSTERS

# reading input file "pilon.plus.spades.short.assembly.ntref" of length
452524346

# construct suffix tree for sequence of length 452524346

# (maximum reference length is 536870908)

# (maximum query length is 4294967295)

# process 4525243 characters per dot

#................................................................................ERROR:
mummer and/or mgaps returned non-zero

!!! 2018-08-01 23:38:40  Command: nucmer -maxmatch -c 40
pilon.plus.spades.short.assembly.ref.seq
pilon.plus.spades.short.assembly.qry.seq
-p pilon.plus.spades.short.assembly exited with status: 1

!!! END - Elapsed time: 0d 0h 4m 36s
===

Could you please help me to figure out what I should change?

Thanks.

Kind regards,

Xin


-- 
Xin Gao, Ph.D
Assistance Clinical Professor
Joint Institute for Food Safety & Applied Nutrition (JIFSAN) - FDA's Center
of Excellence
University of Maryland
College Park, MD 20742

[AMOS-help] amos 3.1.0 installation errors

[Shmuel P. <shm...@we...>]

Hello,

 I am trying to install amos-3.1.0 on an OS X 10.9.5 (13F1911) system. I issued the ./configure command with no error messages.
The make command failed, apparently due to errors in genome-complexity-fast.cc<http://genome-complexity-fast.cc>.

the g++ version is  % g++ -v
Configured with: --prefix=/Library/Developer/CommandLineTools/usr --with-gxx-include-dir=/usr/include/c++/4.2.1
Apple LLVM version 6.0 (clang-600.0.57) (based on LLVM 3.5svn)
Target: x86_64-apple-darwin13.4.0
Thread model: posix


Below are the make stout and stder outputs.

Please let me know any more information is needed and how can I install the amos package.

thanks, Shmuel


/Library/Developer/CommandLineTools/usr/bin/make  all-recursive
Making all in src
Making all in GNU
/Library/Developer/CommandLineTools/usr/bin/make  all-am
make[4]: Nothing to be done for `all-am'.
Making all in AMOS
make[3]: Nothing to be done for `all'.
Making all in Common
make[3]: Nothing to be done for `all'.
Making all in Foundation
make[3]: Nothing to be done for `all'.
Making all in Graph
make[3]: Nothing to be done for `all'.
Making all in Slice
make[3]: Nothing to be done for `all'.
Making all in CelMsg
make[3]: Nothing to be done for `all'.
Making all in Message
make[3]: Nothing to be done for `all'.
Making all in Bank
make[3]: Nothing to be done for `all'.
Making all in Align
g++ -DHAVE_CONFIG_H -I. -I../..  -I../../src/CelMsg -I../../src/Slice -I../../src/Common -I../../src/AMOS -I../../src/GNU -I../../src/Foundation   -g -O2 -MT genome-complexity-fast.o -MD -MP -MF .deps/genome-complexity-fast.Tpo -c -o genome-complexity-fast.o genome-complexity-fast.cc<http://genome-complexity-fast.cc>


In file included from genome-complexity-fast.cc<http://genome-complexity-fast.cc>:1:
In file included from ../../src/AMOS/foundation_AMOS.hh:13:
In file included from ../../src/AMOS/utility_AMOS.hh:48:
/Library/Developer/CommandLineTools/usr/bin/../include/c++/v1/ext/hash_map:212:5: warning: Use of the header <ext/hash_map> is deprecated. Migrate to <unordered_map> [-W#warnings]
#   warning Use of the header <ext/hash_map> is deprecated.  Migrate to <unordered_map>
    ^
In file included from genome-complexity-fast.cc<http://genome-complexity-fast.cc>:1:
In file included from ../../src/AMOS/foundation_AMOS.hh:17:
In file included from ../../src/AMOS/databanks_AMOS.hh:14:
../../src/AMOS/BankStream_AMOS.hh:286:13: warning: comparison of unsigned expression < 0 is always false [-Wtautological-compare]
    if (bid < 0 || bid > last_bid_m [version_m] )
        ~~~ ^ ~
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:21:54: error: reference to 'hash' is ambiguous
typedef HASHMAP::hash_multimap<Mer_t, MerVertex_t *, hash<unsigned long> > MerTable_t;
                                                     ^
/Library/Developer/CommandLineTools/usr/bin/../include/c++/v1/memory:3062:29: note: candidate found by name lookup is 'std::__1::hash'
template <class _Tp> struct hash;
                            ^
/Library/Developer/CommandLineTools/usr/bin/../include/c++/v1/ext/__hash:22:54: note: candidate found by name lookup is '__gnu_cxx::hash'
template <typename _Tp> struct _LIBCPP_TYPE_VIS_ONLY hash : public std::hash<_Tp>
                                                     ^
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:21:68: error: expected '(' for function-style cast or type construction
typedef HASHMAP::hash_multimap<Mer_t, MerVertex_t *, hash<unsigned long> > MerTable_t;
                                                          ~~~~~~~~ ^
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:21:74: error: expected unqualified-id
typedef HASHMAP::hash_multimap<Mer_t, MerVertex_t *, hash<unsigned long> > MerTable_t;
                                                                         ^
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:570:3: error: unknown type name 'MerTable_t'
  MerTable_t mers_m;
  ^
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:592:5: error: use of undeclared identifier 'MerTable_t'
    MerTable_t::iterator m = mers_m.find(mer);
    ^
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:592:17: error: use of class template 'iterator' requires template arguments
    MerTable_t::iterator m = mers_m.find(mer);
                ^
/Library/Developer/CommandLineTools/usr/bin/../include/c++/v1/iterator:432:30: note: template is declared here
struct _LIBCPP_TYPE_VIS_ONLY iterator
                             ^
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:771:10: error: use of undeclared identifier 'MerTable_t'
    for (MerTable_t::iterator mi = mers_m.begin();
         ^
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:771:22: error: use of class template 'iterator' requires template arguments
    for (MerTable_t::iterator mi = mers_m.begin();
                     ^
/Library/Developer/CommandLineTools/usr/bin/../include/c++/v1/iterator:432:30: note: template is declared here
struct _LIBCPP_TYPE_VIS_ONLY iterator
                             ^
genome-complexity-fast.cc<http://genome-complexity-fast.cc>:1058:1: warning: expression result unused [-Wunused-value]
"\n";
^~~~
3 warnings and 8 errors generated.
make[3]: *** [genome-complexity-fast.o] Error 1
make[2]: *** [all-recursive] Error 1
make[1]: *** [all-recursive] Error 1
make: *** [all] Error 2

[AMOS-help] AMOS compiling Issue with GCC version 7.3.1

[Will M. <wma...@jh...>]

Hi AMOS team,

I was trying to compile AMOS (3.1.0) but was getting compiler errors. I am
using arch linux (kernel verision: 4.14.33-1-lts).

GCC version: 7.3.1

Error message:
utility_AMOS.cc: At global scope:
utility_AMOS.cc:35:3: error: narrowing conversion of ‘128’ from ‘int’ to
‘char’ inside { } [-Wnarrowing]
   };

Note that even if I do:
./configure CXXFLAGS="-g -O2 -Wno-narrowing"

It still chokes with the following error message:
genome-complexity-fast.cc:21:74: error: template argument 3 is invalid
 ef HASHMAP::hash_multimap<Mer_t, MerVertex_t *, hash<unsigned long> >
MerTable_t;

I gave up after this.

To me, it seems like new versions of GCC are unable to compile the code. I
am trying to compile an old version of GCC to solve this. I will let you
know how it goes.

Update: I was successfully able to build using gcc version 4.3 available on
the AUR: https://aur.archlinux.org/packages/gcc43/.

Note that it is a little painful to build this as there are bunch of (old)
dependencies but these should also be available on the AUR.

Thanks,

-Will Matern

Joel Bader Lab
Petros Karakousis Lab
Johns Hopkins School of Medicine

[AMOS-help] src/Bambus/Bundler/Utilities_Bundler.hh:16:26: fatal error: Contig_AMOS.hh: No such file or directory

[Martin M. <mmo...@fo...>]

Hi,
  I tried to compile current git HEAD with gcc-5.4.0 but it fails to find some header file. The problem is indeed it lacks include path to the directory src/AMOS/

x86_64-pc-linux-gnu-g++ -DHAVE_CONFIG_H -I. -I/scratch/var/tmp/portage/sci-biology/amos-9999/work/amos-9999/src/Bambus/Bundler -I../../..  -I/usr/include -DAMOS_HAVE_BOOST -I../../../src/GNU -I../../../src/AMOS   -O2 -pipe -march=sandybridge -mtune=native -ftree-vectorize -c -o libBundler_a-Utilities_Bundler.o `test -f 'Utilities_Bundler.cc' || echo '/scratch/var/tmp/portage/sci-biology/amos-9999/work/amos-9999/src/Bambus/Bundler/'`Utilities_Bundler.cc
In file included from /scratch/var/tmp/portage/sci-biology/amos-9999/work/amos-9999/src/Bambus/Bundler/Utilities_Bundler.cc:4:0:
/scratch/var/tmp/portage/sci-biology/amos-9999/work/amos-9999/src/Bambus/Bundler/Utilities_Bundler.hh:16:26: fatal error: Contig_AMOS.hh: No such file or directory
compilation terminated.
make[4]: *** [Makefile:672: libBundler_a-Utilities_Bundler.o] Error 1
make[4]: Leaving directory '/scratch/var/tmp/portage/sci-biology/amos-9999/work/amos-9999_build/src/Bambus/Bundler'
make[3]: *** [Makefile:367: all-recursive] Error 1

  The attached patch fixes the problem.
Martin

[AMOS-help] Requesting help with a direct hierarchical CFA model

[Ryan V. P. <rva...@sl...>]

Hello,

I recently purchased the AMOS add-on to SPSS and I have an
underidentification problem with one of my models. This is a direct
hierarchical CFA. When I attempt to run it, I receive the following
message:
*The model is probably unidentified. In order to achieve identifiability,
it will probably be necessary to impose 2 additional constraints.*

The model is not underidentified in terms of knowns and unknowns (df =
+25). I've read a bit about empirical underidentification and I'm wondering
if that may be the problem but I haven't found specifics on how to deal
with this in AMOS. Any help with this problem is greatly appreciated.

All the best,
-Ryan

-- 
This electronic mail and any attached documents are intended solely for the
named addressee(s) and contain confidential information. If you are not an
addressee, or responsible for delivering this email to an addressee, you
have received this email in error and are notified that reading, copying,
or disclosing this email is prohibited. If you received this email in
error, immediately reply to the sender and delete the message completely
from your computer system.

[AMOS-help] Ns in minimus results

[Amit I. <in...@gm...>]

I ran the Minimus software on a set of contigs I got from my denovo
assembly. I fed these into Minimus to see if I could get a unitig. It
worked very well but a small portion of the resulting unitig has 'N's in
some locations.

Does this mean that it was difficult to make a consensus base call?

Thank you for your help. The documentation is very good.

Amit

[AMOS-help] My question (ablout imputation in Amos)

[yang xu <ste...@ho...>]

Dear friends,
 I need your help.
 I know how to use the "imputation", a function in Amos, to calculate the missing data.
But I also want to know how the Amos' "imputation" work. Could you introduce me the principles of  the "imputation" (such as "regression method")? Or tell me where I can find those contents ?

Thanks a lot !!!!

Re: [AMOS-help] Installation Problems

[Martin M. <mmo...@fo...>]

C Jenkins wrote:
> I am not convinced that this is not an issue with my compiler.
>
> But I'm trying to install AMOS onto my MacBook Pro.
>
> I unpacked the downloaded file, cd'd to the folder, and the ./configure seemed to go fine.
>
> I then typed make and get this:
>
> ContigEdge_AMOS.cc:85:1: error: unrecognizable insn:
>
>   }
>
>   ^
>
> (call_insn/j 3 2 4 (call (mem/u/c:DI (const:DI (unspec:DI [
>
>                          (symbol_ref/i:DI ("_ZNK4AMOS12ContigEdge_t8getNCodeEv") [flags 0x1] <function_decl 0x103086e58 getNCode>)
>
>                      ] UNSPEC_GOTPCREL)) [0  S8 A8])
>
>          (const_int 0 [0])) ContigEdge_AMOS.hh:115 -1
>
>       (nil)
>
>      (nil))
>
> ContigEdge_AMOS.cc:85:1: internal compiler error: in insn_min_length, at config/i386/i386.md:1894 <http://i386.md:1894/>
>
>
> ContigEdge_AMOS.cc:85:1: internal compiler error: Abort trap: 6
>
> g++: internal compiler error: Abort trap: 6 (program cc1plus)
>
> make[3]: *** [libAMOS_a-ContigEdge_AMOS.o] Abort trap: 6
>
> make[2]: *** [all-recursive] Error 1
>
> make[1]: *** [all-recursive] Error 1
>
> make: *** [all] Error 2
>
>
> ANY IDEAS? I'm at a loss and have spent far to many hours trying to figure this out.

Hi,

   the above states clearly it is indeed a compiler error, you need to report the problem to gcc folks (see bug reporting guidelines before that). And be sure to test with latest gcc version before you report a bug.
Good luck,
Martin

[AMOS-help] Installation Problems

[C J. <cej...@gm...>]

I am not convinced that this is not an issue with my compiler.

But I'm trying to install AMOS onto my MacBook Pro.

I unpacked the downloaded file, cd'd to the folder, and the ./configure
seemed to go fine.

I then typed make and get this:

ContigEdge_AMOS.cc:85:1: error: unrecognizable insn:

 }

 ^

(call_insn/j 3 2 4 (call (mem/u/c:DI (const:DI (unspec:DI [

                        (symbol_ref/i:DI
("_ZNK4AMOS12ContigEdge_t8getNCodeEv") [flags 0x1] <function_decl
0x103086e58 getNCode>)

                    ] UNSPEC_GOTPCREL)) [0  S8 A8])

        (const_int 0 [0])) ContigEdge_AMOS.hh:115 -1

     (nil)

    (nil))

ContigEdge_AMOS.cc:85:1: internal compiler error: in insn_min_length, at
config/i386/i386.md:1894


ContigEdge_AMOS.cc:85:1: internal compiler error: Abort trap: 6

g++: internal compiler error: Abort trap: 6 (program cc1plus)

make[3]: *** [libAMOS_a-ContigEdge_AMOS.o] Abort trap: 6

make[2]: *** [all-recursive] Error 1

make[1]: *** [all-recursive] Error 1

make: *** [all] Error 2


ANY IDEAS? I'm at a loss and have spent far to many hours trying to figure
this out.

Thanks!

-- 
CJenkins, MS
PhD Candidate
Washington State University/University of Idaho

[AMOS-help] Confidence intervals in Amos Bayesian analysis

[Paul J. <Pau...@vu...>]

Hello everyone:

Can anyone tell me how to generate confidence intervals in Bayesian output? I am using Amos 22.0.0 (2013). I have ticked 'estimate means and intercepts' on the first page of Analysis Properties, 'standardized estimates' and 'indirect, direct & total effects' on the Output page. I have also ticked 'perform bootstrap', 'bias-corrected confidence intervals', and 'Monte Carlo' on the Bootstrap page as well. On the main page of the Bayesian analysis I get all of the other useful output information after the analysis converges, but no CIs. Then I tick 'View', and then 'Additional estimands'. I am able to expand the middle pane on the left to find standardized and total estimates. But no confidence intervals.


I have seen a lecture in Powerpoint slides on the net that showed 95%CI (www.structuralequations.com/.../MCMC_estimation_March30_2009.pps), but nothing I do in Amos is able to bring these up. Were these only available on earlier versions of Amos, and they have been phased out? That doesn't seem likely. Help!

Paul

[AMOS-help] Fwd: AMOS 3.1.0 Compiled on Mac 10.11

[Monther A. <m.h...@gm...>]

Hello AMOS team,

I have recently managed to compile AMOS on MAC 10.11. I had to slightly
change the use of the hash in some source files by adding HASHMAP::. It
took some time. I thought it would be useful to send you the updated
package so that you can make it available through your website and save
others some time.

Cheers,
Monther


Dr Monther Alhamdoosh, PhD
Research Scientist - Bioinformatics

Re: [AMOS-help] AMOS - hybrid assembly with minimus2

[Marcin J. <jak...@un...>]

Dear AMOS team,

I've been using your tool to construct a hybrid assembly for my species of
interest. With minimu2, I constructed
a hybrid assembly between NGS-based assembly and WGS-based assembly. The
general performance is very
satisfying, but there is one problem that you might be able to help me
being solved. In case two contigs from two
different sources are found to overlap, they are merged, and in the
overlapping part, a consensus sequence is
being reported. However, in some cases one of the contigs has e.g. a G
nucleotide in a given position, while the
other contig has C. In this case minimu2 reports this nucleotide as "n". Is
there any way to force minimus to handle
such cases to report nucleotide from one selected assembly or e.g. to
extract information from log files onto which
input contigs were merged to construct a given hybrid contig?

Sincerely,

Marcin Jakalski, M.Sc.
Institute of Bioinformatics
University of Muenster, Germany

Re: [AMOS-help] Problems running minimus2

[Afif E. <ael...@sd...>]

Hello,
[see inline]

On 05/15/2015 10:03 AM, Afif Elghraoui wrote:
>>
>> 2015-05-15 1:46 GMT+02:00 Afif Elghraoui <ael...@sd...
>> <mailto:ael...@sd...>>:
>>
>>     Hello,
>>     I have assembled a bacterial genome into one contig and I am trying
>>     to circularize it using minimus2 as described at
>>
>> <https://github.com/PacificBiosciences/Bioinformatics-Training/wiki/Circularizing-and-trimming>.
>>
>>     The directions there say to introduce a break somewhere in contig
>>     and then run minimus to circularize it. With the resulting two-entry
>>     fasta file, I run the following:
>>
>>
>>     $ toAmos -s chromosome.fasta -o circularized.afg
>>     Max ID: 9
>>     $ minimus2 circularized
>>     The log file is: circularized.runAmos.log
>>     Doing step 10:  Building AMOS bank & Dumping reads
>>     Doing step 11
>>     Doing step 12
>>     Doing step 13
>>     Doing step 20:  Getting overlaps
>>     Doing step 21
>>     Doing step 22
>>     Doing step 23:  Converting overlaps
>>     Doing step 24:  Loading overlaps to the bank
>>     Doing step 25
>>     Doing step 30:  Running contigger
>>     Doing step 31
>>     Doing step 32
>>     Doing step 40:  Running consensus
>>     Doing step 41
>>     Command:
>>     /share/apps/pacbio/smrtanalysis/current/analysis/bin/make-consensus
>>     -B -e 0.06 -b circularized.bnk -w 15  exited with status: 1
>>
>>
>>     The error I'm getting is at the make-consensus step:
>>     "Could not open bank file, circularized.bnk/LAY.ifo, No such file or
>>     directory". I'm attaching the run log. My problem looks similar to
>>     another one in the mailing list archive
>>     <http://sourceforge.net/p/amos/mailman/message/585583/>, but I did
>>     not find any resolution there.
>>
>>
>>     I'm using the version of Amos distributed with PacBio's SMRTAnalysis
>>     v2.3.0
>>
>>     $ toAmos --version
>>     toAmos $Revision: 1.44 $
>>
>>     I'd really appreciate any help. I tried installing and using the
>>     current revision of Amos from git, but it had other
>>     'not-implemented' types of errors.
>>


Just to update the list, this problem turned out to be biological. There 
was some shuffling of the insertion sequences that was affecting the 
self-similarity. After fixing this, minimus2 ran properly. However, I am 
still not sure why minimus2 would not blunt-end circularize when I 
specified the minimum overlap to be zero.

Afif

-- 
Afif Elghraoui
Laboratory for Pathogenesis of Clinical Drug Resistance and Persistence
San Diego State University
Alvarado Medical Center
6367 Alvarado Court, Suite 206
San Diego, CA 92120
p. 858-222-0454
http://tuberculosis.sdsu.edu

Re: [AMOS-help] Problems running minimus2

[Afif E. <ael...@sd...>]

Thanks for your reply. I just tried this, but it still didn't work.

I don't think it's a problem with parameters because I had tried setting 
OVERLAP to zero and MINID also to zero as a debugging measure to see if 
it would just join the ends together. Doing that still did not help...


Thanks and regards
Afif

On 05/15/2015 12:52 AM, Mohamed Kassam wrote:
> Hi,
> please try to change the parameter of conserr to 0.05 and try again
>
> Mohamed
>
> 2015-05-15 1:46 GMT+02:00 Afif Elghraoui <ael...@sd...
> <mailto:ael...@sd...>>:
>
>     Hello,
>     I have assembled a bacterial genome into one contig and I am trying
>     to circularize it using minimus2 as described at
>     <https://github.com/PacificBiosciences/Bioinformatics-Training/wiki/Circularizing-and-trimming>.
>     The directions there say to introduce a break somewhere in contig
>     and then run minimus to circularize it. With the resulting two-entry
>     fasta file, I run the following:
>
>
>     $ toAmos -s chromosome.fasta -o circularized.afg
>     Max ID: 9
>     $ minimus2 circularized
>     The log file is: circularized.runAmos.log
>     Doing step 10:  Building AMOS bank & Dumping reads
>     Doing step 11
>     Doing step 12
>     Doing step 13
>     Doing step 20:  Getting overlaps
>     Doing step 21
>     Doing step 22
>     Doing step 23:  Converting overlaps
>     Doing step 24:  Loading overlaps to the bank
>     Doing step 25
>     Doing step 30:  Running contigger
>     Doing step 31
>     Doing step 32
>     Doing step 40:  Running consensus
>     Doing step 41
>     Command:
>     /share/apps/pacbio/smrtanalysis/current/analysis/bin/make-consensus
>     -B -e 0.06 -b circularized.bnk -w 15  exited with status: 1
>
>
>     The error I'm getting is at the make-consensus step:
>     "Could not open bank file, circularized.bnk/LAY.ifo, No such file or
>     directory". I'm attaching the run log. My problem looks similar to
>     another one in the mailing list archive
>     <http://sourceforge.net/p/amos/mailman/message/585583/>, but I did
>     not find any resolution there.
>
>
>     I'm using the version of Amos distributed with PacBio's SMRTAnalysis
>     v2.3.0
>
>     $ toAmos --version
>     toAmos $Revision: 1.44 $
>
>     I'd really appreciate any help. I tried installing and using the
>     current revision of Amos from git, but it had other
>     'not-implemented' types of errors.
>
>
>     Many thanks and regards,
>     Afif
>
>     ------------------------------------------------------------------------------
>     One dashboard for servers and applications across Physical-Virtual-Cloud
>     Widest out-of-the-box monitoring support with 50+ applications
>     Performance metrics, stats and reports that give you Actionable Insights
>     Deep dive visibility with transaction tracing using APM Insight.
>     http://ad.doubleclick.net/ddm/clk/290420510;117567292;y
>     _______________________________________________
>     AMOS-help mailing list
>     AMO...@li... <mailto:AMO...@li...>
>     https://lists.sourceforge.net/lists/listinfo/amos-help
>
>

-- 
Afif Elghraoui
Laboratory Manager
Laboratory for Pathogenesis of Clinical Drug Resistance and Persistence
6367 Alvarado Ct., Ste 206, Room 2
San Diego, CA 92120
p. 619-594-1710

[AMOS-help] Problems running minimus2

[Afif E. <ael...@sd...>]

Hello,
I have assembled a bacterial genome into one contig and I am trying to 
circularize it using minimus2 as described at 
<https://github.com/PacificBiosciences/Bioinformatics-Training/wiki/Circularizing-and-trimming>. 
The directions there say to introduce a break somewhere in contig and 
then run minimus to circularize it. With the resulting two-entry fasta 
file, I run the following:


$ toAmos -s chromosome.fasta -o circularized.afg
Max ID: 9
$ minimus2 circularized
The log file is: circularized.runAmos.log
Doing step 10:  Building AMOS bank & Dumping reads
Doing step 11
Doing step 12
Doing step 13
Doing step 20:  Getting overlaps
Doing step 21
Doing step 22
Doing step 23:  Converting overlaps
Doing step 24:  Loading overlaps to the bank
Doing step 25
Doing step 30:  Running contigger
Doing step 31
Doing step 32
Doing step 40:  Running consensus
Doing step 41
Command: 
/share/apps/pacbio/smrtanalysis/current/analysis/bin/make-consensus -B 
-e 0.06 -b circularized.bnk -w 15  exited with status: 1


The error I'm getting is at the make-consensus step:
"Could not open bank file, circularized.bnk/LAY.ifo, No such file or 
directory". I'm attaching the run log. My problem looks similar to 
another one in the mailing list archive
<http://sourceforge.net/p/amos/mailman/message/585583/>, but I did not 
find any resolution there.


I'm using the version of Amos distributed with PacBio's SMRTAnalysis v2.3.0

$ toAmos --version
toAmos $Revision: 1.44 $

I'd really appreciate any help. I tried installing and using the current 
revision of Amos from git, but it had other 'not-implemented' types of 
errors.


Many thanks and regards,
Afif

[AMOS-help] Troubles to install Amos

[Clement D. <cle...@vi...>]

Hello everybody,
I'm a bioinformatician trying to use Amos, and I fail at the "make" step.

I first ran configure and make with default values and I got this output ;

make[3]: entrant dans le répertoire «
/usr/local/bin/amos-3.1.0/src/Converters »
g++  -g -O2   -o toAmos_new toAmos_new-toAmos_new.o
../../src/Common/libCommon.a ../../src/AMOS/libAMOS.a
../../src/Foundation/libAMOSFoundation.a -lexpat -lz -lc -lm
/usr/bin/ld: cannot find -lexpat
collect2: ld a retourné 1 code d'état d'exécution
make[3]: *** [toAmos_new] Erreur 1

So I used the 2 following commands (I'm on RHEL 6)
yum install expat21-devel.x86_64

 yum install expat.x86_64 (that's was actually already installed before)

Then :

# locate expat
/lib64/libexpat.so.1
/lib64/libexpat.so.1.5.2
ln -s /lib64/libexpat.so.1* /usr/local/lib64/ and ln -s
/lib64/libexpat.so.1* /usr/local/lib/


But I still have the same error when doing configure and make.

Can someone help me please ?

Thanks,


-- 


*Clément DELESTRE**ViroScan3d*
8, Avenue Rockefeller
3ème Étage, Aile B
69373 LYON cedex 08
+33(0) 478-772-889
ViroScan3D - SAS au capital de 20 000 euros - SIRET 752 876 995 RCS
Bourg-en-Bresse - Siège social: 11 allée des acacias, 01 600 TREVOUX

[AMOS-help] Circularizing and trimming with toAmos and minimus2

[Mohamed K. <k.m...@gm...>]

Dear all,

I am trying to follow the Circularizing and trimming  discribed here
https://github.com/PacificBiosciences/Bioinformatics-Training/wiki/Circularizing-and-trimming
 for pacbio assembly.

I have tried many times but I could not get the result circularized.fasta
 from the overlaping step and joining step from minimus2.


I tried a test.fasta by putting a brek in the middle after making a reverse
of my contig:

>contig
ACGTCTACTACTACGTAGCTACTACTGTGAATCTAGGACTACTAGCTAGCTATCGTACTATCGATCTCTACTGCG
>break
GCGTCATCTCTAGCTATCATGCTATCGATCGATCATCAGGATCTAAGTGTCATCATCGATGCATCATCATCTGCA

amos-3.1.0/bin/toAmos -s rev.fasta -o circularized.afg

amos-3.1.0/bin/minimus2 circularized

I get all these files

circularized.bnk     circularized.fasta          circularized.qry.seq
 circularized.singletons.seq     circularized.contig
 circularizedls.runAmos.log  circularized.ref.seq
BioPerl-1.6.1     circularized.coords  circularized.ovl
 circularized.runAmos.log
circularized.afg  circularized.delta   circularized.OVL
 circularized.singletons


When  i am checking the circularized.fasta,it is empty and I do not have
any error in my log ,  all the contigs are here circularized.singletons.seq

cat  circularized.singletons.seq

>contig
ACGTCTACTACTACGTAGCTACTACTGTGAATCTAGGACTACTAGCTAGCTATCGTACTATCGATCTCTA
CTGCG
>break
GCGTCATCTCTAGCTATCATGCTATCGATCGATCATCAGGATCTAAGTGTCATCATCGATGCATCATCAT
CTGCA



cat circularized.runAmos.log


!!! 2015-03-17 17:56:38  Started by ro...@lo... on Tue Mar
17 17:56:38 2015

!!! 2015-03-17 17:56:38  Doing step 10:  Building AMOS bank & Dumping reads
!!! 2015-03-17 17:56:38  Running: rm -fr circularized.bnk
!!! 2015-03-17 17:56:38  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38  Doing step 11
!!! 2015-03-17 17:56:38  Running: /root/amos-3.1.0/bin/bank-transact -c -z
-b circularized.bnk -m circularized.afg
START DATE: Tue Mar 17 17:56:38 2015
Bank is: circularized.bnk
    0%                                            100%
AFG ..................................................
Messages read: 6
Objects added: 6
Objects deleted: 0
Objects replaced: 0
END DATE:   Tue Mar 17 17:56:38 2015
!!! 2015-03-17 17:56:38  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38  Doing step 12
!!! 2015-03-17 17:56:38  Running: /root/amos-3.1.0/bin/dumpreads
circularized.bnk -M 0 > circularized.ref.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:38  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38  Doing step 13
!!! 2015-03-17 17:56:38  Running: /root/amos-3.1.0/bin/dumpreads
circularized.bnk -m 0 > circularized.qry.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:38  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:38  Doing step 20:  Getting overlaps
!!! 2015-03-17 17:56:38  Running: /root/MUMmer3.23/nucmer -maxmatch -c 40
circularized.ref.seq circularized.qry.seq -p circularized
1: PREPARING DATA
2,3: RUNNING mummer AND CREATING CLUSTERS
# reading input file "circularized.ntref" of length 152
# construct suffix tree for sequence of length 152
# (maximum reference length is 536870908)
# (maximum query length is 4294967295)
# CONSTRUCTIONTIME /root/MUMmer3.23/mummer circularized.ntref 0.00
# reading input file "/root/circularized.qry.seq" of length 151
# matching query-file "/root/circularized.qry.seq"
# against subject-file "circularized.ntref"
# COMPLETETIME /root/MUMmer3.23/mummer circularized.ntref 0.00
# SPACE /root/MUMmer3.23/mummer circularized.ntref 0.00
4: FINISHING DATA
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 1s

!!! 2015-03-17 17:56:39  Doing step 21
!!! 2015-03-17 17:56:39  Running: /root/MUMmer3.23/show-coords -H -c -l -o
-r -I 94 circularized.delta | /root/amos-3.1.0/bin/nucmerAnnotate | egrep
'BEGIN|END|CONTAIN|IDENTITY' > circularized.coords
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 22
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/nucmer2ovl -ignore
20 -tab circularized.coords | /root/amos-3.1.0/bin/sort2 > circularized.ovl
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 23:  Converting overlaps
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/ovl2OVL
circularized.ovl  > circularized.OVL
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 24:  Loading overlaps to the bank
!!! 2015-03-17 17:56:39  Running: rm -f circularized.bnk/OVL.*
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 25
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/bank-transact -z -b
circularized.bnk -m circularized.OVL
START DATE: Tue Mar 17 17:56:39 2015
Bank is: circularized.bnk
    0%                                            100%
AFG
Messages read: 0
Objects added: 0
Objects deleted: 0
Objects replaced: 0
END DATE:   Tue Mar 17 17:56:39 2015
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 30:  Running contigger
!!! 2015-03-17 17:56:39  Running: rm -f circularized.bnk/LAY.*
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 31
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/tigger -b
circularized.bnk
 Pulling reads from bank circularized.bnk
Pulled 2 reads from bank
 AMOS Overlap Bank circularized.bnk does not exist
 total contained reads hidden 0
 number of contigs 2
 total contained reads unhidden 0
 Writing layouts to bank circularized.bnk
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 40:  Running consensus
!!! 2015-03-17 17:56:39  Running: rm -f circularized.bnk/CTG.*
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 41
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/make-consensus -B -e
0.06 -b circularized.bnk -w 15
Starting on Tue Mar 17 17:56:39 2015

Read bank is circularized.bnk
Alignment error rate is 0.06
Minimum overlap bases is 5
Output will be written to the bank
Input is being read from the bank
Processed 0 layouts
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 50:  Outputting contigs
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/bank2contig
circularized.bnk > circularized.contig
Processing circularized.bnk at Tue Mar 17 17:56:39 2015
End: Tue Mar 17 17:56:39 2015
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 60:  Converting to FastA file
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/bank2fasta -b
circularized.bnk > circularized.fasta
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 70:  Getting singletons
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/listReadPlacedStatus
-S -E circularized.bnk > circularized.singletons
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! 2015-03-17 17:56:39  Doing step 71
!!! 2015-03-17 17:56:39  Running: /root/amos-3.1.0/bin/dumpreads -e -E
circularized.singletons circularized.bnk > circularized.singletons.seq
Objects seen: 2
Objects written: 2
!!! 2015-03-17 17:56:39  Done! Elapsed time:0d 0h 0m 0s

!!! END - Elapsed time: 0d 0h 0m 1s


Any idea,

thanks in advance

Re: [AMOS-help] AMOS compilation hard-code paths + ignore DELTAFILTER and SHOWCOORDS

[Martin M. <mmo...@fo...>]

Hi Joel,
  thanks for sharing this information. While I am not an AMOS developer let me mention
these two patches Gentoo Linux uses and which might be of interest to you:
  http://sources.gentoo.org/cgi-bin/viewvc.cgi/gentoo-x86/sci-biology/amos/files/

Regards,
Martin

Joel Fillon, Mr wrote:
> Hi AMOS developers,
> 
> I don't know if AMOS is still maintained but I'm trying to compile it (version 3.1.0) and I have 2 problems:
> 
> 1. AMOS hard-codes dependency paths for Perl, Python, MUMmer, UCSC tools.
> Since we use modules with possibly different dependencies versions,
> it would be nice to compile it with simple command names and let the user add the commands in the $PATH as he wants.
> 
> 2. As a workaround, I compile it as:
> 
>   ./configure \
>     PERL=`which perl` \
>     PYTHON=`which python` \
>     NUCMER=`which nucmer` \
>     DELTAFILTER=`which delta-filter` \
>     SHOWCOORDS=`which show-coords` \
>     BLAT=`which blat` \
>     --prefix=$INSTALL_DIR/$SOFTWARE_DIR \
>     --with-qmake-qt4=/usr/lib64/qt4/bin/qmake
>   make
>   make install
> 
> but DELTAFILTER and SHOWCOORDS seem to be ignored since they create a default invalid path.
> 
> Afterwards, I set the proper paths with:
> 
>   perl -pi -e s,"DELTAFILTER\s+=.*,DELTAFILTER=`which delta-filter`,g" bin/minimus2
>   perl -pi -e s,"SHOWCOORDS\s+=.*,SHOWCOORDS=`which show-coords`,g" bin/minimus2
> 
> Any ideas?
> 
> Thanks for your help,
> Joël

[AMOS-help] AMOS compilation hard-code paths + ignore DELTAFILTER and SHOWCOORDS

[Joel F. M. <joe...@mc...>]

Hi AMOS developers,

I don't know if AMOS is still maintained but I'm trying to compile it (version 3.1.0) and I have 2 problems:

1. AMOS hard-codes dependency paths for Perl, Python, MUMmer, UCSC tools.
Since we use modules with possibly different dependencies versions,
it would be nice to compile it with simple command names and let the user add the commands in the $PATH as he wants.

2. As a workaround, I compile it as:

  ./configure \
    PERL=`which perl` \
    PYTHON=`which python` \
    NUCMER=`which nucmer` \
    DELTAFILTER=`which delta-filter` \
    SHOWCOORDS=`which show-coords` \
    BLAT=`which blat` \
    --prefix=$INSTALL_DIR/$SOFTWARE_DIR \
    --with-qmake-qt4=/usr/lib64/qt4/bin/qmake
  make
  make install

but DELTAFILTER and SHOWCOORDS seem to be ignored since they create a default invalid path.

Afterwards, I set the proper paths with:

  perl -pi -e s,"DELTAFILTER\s+=.*,DELTAFILTER=`which delta-filter`,g" bin/minimus2
  perl -pi -e s,"SHOWCOORDS\s+=.*,SHOWCOORDS=`which show-coords`,g" bin/minimus2

Any ideas?

Thanks for your help,
Joël

[AMOS-help] Minimus2 Runtime Exceeds Two Week Cluster Limit

[Joshua B. <bur...@gm...>]

I'm attempting to run minimus2 on a ~300Mbase assembly and have not seen it finish within the two week limit of the cluster I'm using.

Where should I start to debug this issue? Is this common?

Thanks,

Joshua Burkhart

[AMOS-help] Minimus run time

[Manjari D. <man...@gm...>]

Hi,

I am trying to get an assembly from celera scaffold and Soapdenovo
scaffolds and it is running from past 3 days. How much more time will it
take to complete the assembly


Thanks and regards

Manjari

[AMOS-help] amoscmp: error message

[Biddle, A. S <asb...@il...>]

Hello AMOS help,

I am trying to use AMOScmp-shortReads to map Illumina reads from a bacterial genome to a reference genome.

When I run AMOS, the program exits in step 50 (Running consensus) with this:

Expelled reads listed in file S_bovis_AMOS.exclude.seqs
Read bank is S_bovis_AMOS.bnk
Alignment error rate is 0.06
Minimum overlap bases is 5
Output will be written to the bank
Input is being read from the bank
ERROR:  Impossible  offset = 402  i = 4  in  Estimate_Offset_With_Expels
in file  align.cc  at line  1919  errno = 0

I see two other posts in the AMOS-help page with similar questions, but do not see answers to either of them.

Thank you in advance for your help on this!

Amy Biddle