{\rtf1\adeflang1025\ansi\ansicpg1252\uc1\adeff31507\deff0\stshfdbch0\stshfloch31506\stshfhich31506\stshfbi31506\deflang1033\deflangfe1033\themelang1033\themelangfe0\themelangcs0{\fonttbl{\f0\fbidi \froman\fcharset0\fprq2{\*\panose 02020603050405020304}Times New Roman;}{\f34\fbidi \froman\fcharset0\fprq2{\*\panose 02040503050406030204}Cambria Math;}
{\f37\fbidi \fswiss\fcharset0\fprq2{\*\panose 020f0502020204030204}Calibri;}{\flomajor\f31500\fbidi \froman\fcharset0\fprq2{\*\panose 02020603050405020304}Times New Roman;}
{\fdbmajor\f31501\fbidi \froman\fcharset0\fprq2{\*\panose 02020603050405020304}Times New Roman;}{\fhimajor\f31502\fbidi \froman\fcharset0\fprq2{\*\panose 02040503050406030204}Cambria;}
{\fbimajor\f31503\fbidi \froman\fcharset0\fprq2{\*\panose 02020603050405020304}Times New Roman;}{\flominor\f31504\fbidi \froman\fcharset0\fprq2{\*\panose 02020603050405020304}Times New Roman;}
{\fdbminor\f31505\fbidi \froman\fcharset0\fprq2{\*\panose 02020603050405020304}Times New Roman;}{\fhiminor\f31506\fbidi \fswiss\fcharset0\fprq2{\*\panose 020f0502020204030204}Calibri;}
{\fbiminor\f31507\fbidi \froman\fcharset0\fprq2{\*\panose 02020603050405020304}Times New Roman;}{\f39\fbidi \froman\fcharset238\fprq2 Times New Roman CE;}{\f40\fbidi \froman\fcharset204\fprq2 Times New Roman Cyr;}
{\f42\fbidi \froman\fcharset161\fprq2 Times New Roman Greek;}{\f43\fbidi \froman\fcharset162\fprq2 Times New Roman Tur;}{\f44\fbidi \froman\fcharset177\fprq2 Times New Roman (Hebrew);}{\f45\fbidi \froman\fcharset178\fprq2 Times New Roman (Arabic);}
{\f46\fbidi \froman\fcharset186\fprq2 Times New Roman Baltic;}{\f47\fbidi \froman\fcharset163\fprq2 Times New Roman (Vietnamese);}{\f379\fbidi \froman\fcharset238\fprq2 Cambria Math CE;}{\f380\fbidi \froman\fcharset204\fprq2 Cambria Math Cyr;}
{\f382\fbidi \froman\fcharset161\fprq2 Cambria Math Greek;}{\f383\fbidi \froman\fcharset162\fprq2 Cambria Math Tur;}{\f386\fbidi \froman\fcharset186\fprq2 Cambria Math Baltic;}{\f409\fbidi \fswiss\fcharset238\fprq2 Calibri CE;}
{\f410\fbidi \fswiss\fcharset204\fprq2 Calibri Cyr;}{\f412\fbidi \fswiss\fcharset161\fprq2 Calibri Greek;}{\f413\fbidi \fswiss\fcharset162\fprq2 Calibri Tur;}{\f416\fbidi \fswiss\fcharset186\fprq2 Calibri Baltic;}
{\flomajor\f31508\fbidi \froman\fcharset238\fprq2 Times New Roman CE;}{\flomajor\f31509\fbidi \froman\fcharset204\fprq2 Times New Roman Cyr;}{\flomajor\f31511\fbidi \froman\fcharset161\fprq2 Times New Roman Greek;}
{\flomajor\f31512\fbidi \froman\fcharset162\fprq2 Times New Roman Tur;}{\flomajor\f31513\fbidi \froman\fcharset177\fprq2 Times New Roman (Hebrew);}{\flomajor\f31514\fbidi \froman\fcharset178\fprq2 Times New Roman (Arabic);}
{\flomajor\f31515\fbidi \froman\fcharset186\fprq2 Times New Roman Baltic;}{\flomajor\f31516\fbidi \froman\fcharset163\fprq2 Times New Roman (Vietnamese);}{\fdbmajor\f31518\fbidi \froman\fcharset238\fprq2 Times New Roman CE;}
{\fdbmajor\f31519\fbidi \froman\fcharset204\fprq2 Times New Roman Cyr;}{\fdbmajor\f31521\fbidi \froman\fcharset161\fprq2 Times New Roman Greek;}{\fdbmajor\f31522\fbidi \froman\fcharset162\fprq2 Times New Roman Tur;}
{\fdbmajor\f31523\fbidi \froman\fcharset177\fprq2 Times New Roman (Hebrew);}{\fdbmajor\f31524\fbidi \froman\fcharset178\fprq2 Times New Roman (Arabic);}{\fdbmajor\f31525\fbidi \froman\fcharset186\fprq2 Times New Roman Baltic;}
{\fdbmajor\f31526\fbidi \froman\fcharset163\fprq2 Times New Roman (Vietnamese);}{\fhimajor\f31528\fbidi \froman\fcharset238\fprq2 Cambria CE;}{\fhimajor\f31529\fbidi \froman\fcharset204\fprq2 Cambria Cyr;}
{\fhimajor\f31531\fbidi \froman\fcharset161\fprq2 Cambria Greek;}{\fhimajor\f31532\fbidi \froman\fcharset162\fprq2 Cambria Tur;}{\fhimajor\f31535\fbidi \froman\fcharset186\fprq2 Cambria Baltic;}
{\fbimajor\f31538\fbidi \froman\fcharset238\fprq2 Times New Roman CE;}{\fbimajor\f31539\fbidi \froman\fcharset204\fprq2 Times New Roman Cyr;}{\fbimajor\f31541\fbidi \froman\fcharset161\fprq2 Times New Roman Greek;}
{\fbimajor\f31542\fbidi \froman\fcharset162\fprq2 Times New Roman Tur;}{\fbimajor\f31543\fbidi \froman\fcharset177\fprq2 Times New Roman (Hebrew);}{\fbimajor\f31544\fbidi \froman\fcharset178\fprq2 Times New Roman (Arabic);}
{\fbimajor\f31545\fbidi \froman\fcharset186\fprq2 Times New Roman Baltic;}{\fbimajor\f31546\fbidi \froman\fcharset163\fprq2 Times New Roman (Vietnamese);}{\flominor\f31548\fbidi \froman\fcharset238\fprq2 Times New Roman CE;}
{\flominor\f31549\fbidi \froman\fcharset204\fprq2 Times New Roman Cyr;}{\flominor\f31551\fbidi \froman\fcharset161\fprq2 Times New Roman Greek;}{\flominor\f31552\fbidi \froman\fcharset162\fprq2 Times New Roman Tur;}
{\flominor\f31553\fbidi \froman\fcharset177\fprq2 Times New Roman (Hebrew);}{\flominor\f31554\fbidi \froman\fcharset178\fprq2 Times New Roman (Arabic);}{\flominor\f31555\fbidi \froman\fcharset186\fprq2 Times New Roman Baltic;}
{\flominor\f31556\fbidi \froman\fcharset163\fprq2 Times New Roman (Vietnamese);}{\fdbminor\f31558\fbidi \froman\fcharset238\fprq2 Times New Roman CE;}{\fdbminor\f31559\fbidi \froman\fcharset204\fprq2 Times New Roman Cyr;}
{\fdbminor\f31561\fbidi \froman\fcharset161\fprq2 Times New Roman Greek;}{\fdbminor\f31562\fbidi \froman\fcharset162\fprq2 Times New Roman Tur;}{\fdbminor\f31563\fbidi \froman\fcharset177\fprq2 Times New Roman (Hebrew);}
{\fdbminor\f31564\fbidi \froman\fcharset178\fprq2 Times New Roman (Arabic);}{\fdbminor\f31565\fbidi \froman\fcharset186\fprq2 Times New Roman Baltic;}{\fdbminor\f31566\fbidi \froman\fcharset163\fprq2 Times New Roman (Vietnamese);}
{\fhiminor\f31568\fbidi \fswiss\fcharset238\fprq2 Calibri CE;}{\fhiminor\f31569\fbidi \fswiss\fcharset204\fprq2 Calibri Cyr;}{\fhiminor\f31571\fbidi \fswiss\fcharset161\fprq2 Calibri Greek;}{\fhiminor\f31572\fbidi \fswiss\fcharset162\fprq2 Calibri Tur;}
{\fhiminor\f31575\fbidi \fswiss\fcharset186\fprq2 Calibri Baltic;}{\fbiminor\f31578\fbidi \froman\fcharset238\fprq2 Times New Roman CE;}{\fbiminor\f31579\fbidi \froman\fcharset204\fprq2 Times New Roman Cyr;}
{\fbiminor\f31581\fbidi \froman\fcharset161\fprq2 Times New Roman Greek;}{\fbiminor\f31582\fbidi \froman\fcharset162\fprq2 Times New Roman Tur;}{\fbiminor\f31583\fbidi \froman\fcharset177\fprq2 Times New Roman (Hebrew);}
{\fbiminor\f31584\fbidi \froman\fcharset178\fprq2 Times New Roman (Arabic);}{\fbiminor\f31585\fbidi \froman\fcharset186\fprq2 Times New Roman Baltic;}{\fbiminor\f31586\fbidi \froman\fcharset163\fprq2 Times New Roman (Vietnamese);}}
{\colortbl;\red0\green0\blue0;\red0\green0\blue255;\red0\green255\blue255;\red0\green255\blue0;\red255\green0\blue255;\red255\green0\blue0;\red255\green255\blue0;\red255\green255\blue255;\red0\green0\blue128;\red0\green128\blue128;\red0\green128\blue0;
\red128\green0\blue128;\red128\green0\blue0;\red128\green128\blue0;\red128\green128\blue128;\red192\green192\blue192;\chyperlink\ctint255\cshade255\red0\green0\blue255;}{\*\defchp \f31506\fs22 }{\*\defpap \ql \li0\ri0\sa200\sl276\slmult1
\widctlpar\wrapdefault\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0 }\noqfpromote {\stylesheet{\ql \li0\ri0\sa200\sl276\slmult1\widctlpar\wrapdefault\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0 \rtlch\fcs1 \af31507\afs22\alang1025
\ltrch\fcs0 \f31506\fs22\lang1033\langfe1033\cgrid\langnp1033\langfenp1033 \snext0 \sqformat \spriority0 Normal;}{\*\cs10 \additive \ssemihidden \sunhideused \spriority1 Default Paragraph Font;}{\*
\ts11\tsrowd\trftsWidthB3\trpaddl108\trpaddr108\trpaddfl3\trpaddft3\trpaddfb3\trpaddfr3\tblind0\tblindtype3\tscellwidthfts0\tsvertalt\tsbrdrt\tsbrdrl\tsbrdrb\tsbrdrr\tsbrdrdgl\tsbrdrdgr\tsbrdrh\tsbrdrv \ql \li0\ri0\sa200\sl276\slmult1
\widctlpar\wrapdefault\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0 \rtlch\fcs1 \af31506\afs22\alang1025 \ltrch\fcs0 \f31506\fs22\lang1033\langfe1033\cgrid\langnp1033\langfenp1033 \snext11 \ssemihidden \sunhideused \sqformat Normal Table;}{\*\cs15
\additive \rtlch\fcs1 \af0 \ltrch\fcs0 \ul\cf17 \sbasedon10 \sunhideused \styrsid7933868 Hyperlink;}{\s16\ql \li720\ri0\sa200\sl276\slmult1\widctlpar\wrapdefault\aspalpha\aspnum\faauto\adjustright\rin0\lin720\itap0\contextualspace \rtlch\fcs1
\af31507\afs22\alang1025 \ltrch\fcs0 \f31506\fs22\lang1033\langfe1033\cgrid\langnp1033\langfenp1033 \sbasedon0 \snext16 \sqformat \spriority34 \styrsid9253991 List Paragraph;}}{\*\listtable{\list\listtemplateid-18061548\listhybrid{\listlevel\levelnfc0
\levelnfcn0\leveljc0\leveljcn0\levelfollow0\levelstartat1\levelspace0\levelindent0{\leveltext\leveltemplateid-1346761240\'02\'00.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \fbias0\hres0\chhres0 \fi-360\li1080\lin1080 }{\listlevel\levelnfc4
\levelnfcn4\leveljc0\leveljcn0\levelfollow0\levelstartat1\lvltentative\levelspace0\levelindent0{\leveltext\leveltemplateid67698713\'02\'01.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \hres0\chhres0 \fi-360\li1800\lin1800 }{\listlevel\levelnfc2
\levelnfcn2\leveljc2\leveljcn2\levelfollow0\levelstartat1\lvltentative\levelspace0\levelindent0{\leveltext\leveltemplateid67698715\'02\'02.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \hres0\chhres0 \fi-180\li2520\lin2520 }{\listlevel\levelnfc0
\levelnfcn0\leveljc0\leveljcn0\levelfollow0\levelstartat1\lvltentative\levelspace0\levelindent0{\leveltext\leveltemplateid67698703\'02\'03.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \hres0\chhres0 \fi-360\li3240\lin3240 }{\listlevel\levelnfc4
\levelnfcn4\leveljc0\leveljcn0\levelfollow0\levelstartat1\lvltentative\levelspace0\levelindent0{\leveltext\leveltemplateid67698713\'02\'04.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \hres0\chhres0 \fi-360\li3960\lin3960 }{\listlevel\levelnfc2
\levelnfcn2\leveljc2\leveljcn2\levelfollow0\levelstartat1\lvltentative\levelspace0\levelindent0{\leveltext\leveltemplateid67698715\'02\'05.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \hres0\chhres0 \fi-180\li4680\lin4680 }{\listlevel\levelnfc0
\levelnfcn0\leveljc0\leveljcn0\levelfollow0\levelstartat1\lvltentative\levelspace0\levelindent0{\leveltext\leveltemplateid67698703\'02\'06.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \hres0\chhres0 \fi-360\li5400\lin5400 }{\listlevel\levelnfc4
\levelnfcn4\leveljc0\leveljcn0\levelfollow0\levelstartat1\lvltentative\levelspace0\levelindent0{\leveltext\leveltemplateid67698713\'02\'07.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \hres0\chhres0 \fi-360\li6120\lin6120 }{\listlevel\levelnfc2
\levelnfcn2\leveljc2\leveljcn2\levelfollow0\levelstartat1\lvltentative\levelspace0\levelindent0{\leveltext\leveltemplateid67698715\'02\'08.;}{\levelnumbers\'01;}\rtlch\fcs1 \af0 \ltrch\fcs0 \hres0\chhres0 \fi-180\li6840\lin6840 }{\listname
;}\listid519781024}}{\*\listoverridetable{\listoverride\listid519781024\listoverridecount0\ls1}}{\*\rsidtbl \rsid210682\rsid550895\rsid1468495\rsid1646983\rsid3568720\rsid3802679\rsid4021494\rsid4990647\rsid6820385\rsid7933868\rsid8062794\rsid9072908
\rsid9253991\rsid9909908\rsid9972971\rsid10035611\rsid10359851\rsid10486683\rsid11692257\rsid13336526\rsid14225308\rsid14761308\rsid14948957\rsid15229775\rsid15297938\rsid15354785\rsid15613048}{\mmathPr\mmathFont34\mbrkBin0\mbrkBinSub0\msmallFrac0
\mdispDef1\mlMargin0\mrMargin0\mdefJc1\mwrapIndent1440\mintLim0\mnaryLim1}{\info{\author Mobley Lab}{\operator Mobley Lab}{\creatim\yr2012\mo3\dy8\hr14\min11}{\revtim\yr2012\mo3\dy8\hr14\min11}{\version2}{\edmins0}{\nofpages7}{\nofwords2604}
{\nofchars14424}{\nofcharsws16995}{\vern32773}}{\*\xmlnstbl {\xmlns1 http://schemas.microsoft.com/office/word/2003/wordml}}\paperw12240\paperh15840\margl1440\margr1440\margt1440\margb1440\gutter0\ltrsect
\widowctrl\ftnbj\aenddoc\trackmoves1\trackformatting1\donotembedsysfont1\relyonvml0\donotembedlingdata0\grfdocevents0\validatexml1\showplaceholdtext0\ignoremixedcontent0\saveinvalidxml0\showxmlerrors1\noxlattoyen
\expshrtn\noultrlspc\dntblnsbdb\nospaceforul\formshade\horzdoc\dgmargin\dghspace180\dgvspace180\dghorigin1440\dgvorigin1440\dghshow1\dgvshow1
\jexpand\viewkind1\viewscale100\pgbrdrhead\pgbrdrfoot\splytwnine\ftnlytwnine\htmautsp\nolnhtadjtbl\useltbaln\alntblind\lytcalctblwd\lyttblrtgr\lnbrkrule\nobrkwrptbl\snaptogridincell\allowfieldendsel\wrppunct
\asianbrkrule\rsidroot15297938\newtblstyruls\nogrowautofit\usenormstyforlist\noindnmbrts\felnbrelev\nocxsptable\indrlsweleven\noafcnsttbl\afelev\utinl\hwelev\spltpgpar\notcvasp\notbrkcnstfrctbl\notvatxbx\krnprsnet\cachedcolbal \nouicompat \fet0
{\*\wgrffmtfilter 2450}\nofeaturethrottle1\ilfomacatclnup0\ltrpar \sectd \ltrsect\linex0\endnhere\sectlinegrid360\sectdefaultcl\sftnbj {\*\pnseclvl1\pnucrm\pnstart1\pnindent720\pnhang {\pntxta .}}{\*\pnseclvl2\pnucltr\pnstart1\pnindent720\pnhang
{\pntxta .}}{\*\pnseclvl3\pndec\pnstart1\pnindent720\pnhang {\pntxta .}}{\*\pnseclvl4\pnlcltr\pnstart1\pnindent720\pnhang {\pntxta )}}{\*\pnseclvl5\pndec\pnstart1\pnindent720\pnhang {\pntxtb (}{\pntxta )}}{\*\pnseclvl6\pnlcltr\pnstart1\pnindent720\pnhang
{\pntxtb (}{\pntxta )}}{\*\pnseclvl7\pnlcrm\pnstart1\pnindent720\pnhang {\pntxtb (}{\pntxta )}}{\*\pnseclvl8\pnlcltr\pnstart1\pnindent720\pnhang {\pntxtb (}{\pntxta )}}{\*\pnseclvl9\pnlcrm\pnstart1\pnindent720\pnhang {\pntxtb (}{\pntxta )}}
\pard\plain \ltrpar\ql \fi720\li0\ri0\sa200\sl276\slmult1\widctlpar\wrapdefault\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0\pararsid11692257 \rtlch\fcs1 \af31507\afs22\alang1025 \ltrch\fcs0
\f31506\fs22\lang1033\langfe1033\cgrid\langnp1033\langfenp1033 {\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 TFAST ReadMe
\par
\par Overview of TFAST
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9909908
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 TFAST was originally adapted from a series of algorithms used to analyze SELEX with high-throughput sequencing data. For a review of the}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid7933868 aptamer-free}{
\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid7933868 SELEX-seq }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
protocol used, see Reiss, D.J and Mobley, HLT. "Determination of the target sequence bound by PapX, a rep
ressor of bacterial motility, in the flhd promoter using SELEX and high-throughput sequencing (DOI 10.1074/jbc.M111.290684). In order to make optimal use of TFAST, first the initial (unselected) library used for SELEX must be sequenced, as well as selecte
d
subsequent cycles. Once sequence data has been procured, they can be processed using TFAST. Alternatively, the user may process files as she or he wishes and enter completed files into the TFAST workflow, so long as files are properly formatted. Included
here are instructions for the use of TFAST and the file format used at each stage, so that the user can integrate features as they see fit.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 Dependencies: TFAST is written in Java. Java must be installed to execute the .jar files.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683
\par Terms
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 \'93}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683 P}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 robe length\'94 or \'93fragment length\'94
refer to the average size of fragment submitted for sequencing in each round of SELEX sequenced.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683 \'93Upper limit of reads\'94 refers to the number of reads aligned in the cycle of SELEX in which the greatest number of reads was aligned to the target sequence.
\par \'93N\'94 and \'93#\'94 are placeholders for integer values.
\par \'93Power\'94 refers to the area under peaks and is a surrogate for representation of a peak in the final cycle of SELEX sequenced
\par \'93Weight\'94 is an indicator of how well a given peak enriched. Weights per cycle of SELEX are determined by th
e user, and should reflect the bulk binding characteristics of the library (ie, should increase with stringency as cycles are iteratively enriched).
\par
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991
\par Quick use guide}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9909908
\par }\pard \ltrpar\ql \fi720\li0\ri0\sa200\sl276\slmult1\widctlpar\wrapdefault\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0\pararsid9253991 {\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 1.
Run fileconversion.jar on Illumina _fastq.txt formatted sequence folder
\par 2. Run folder blast.jar on the resulting /fasta directory from step \'931\'94
\par 3. Run freq counter.jar on the resulting /blast directory from step \'932\'94
\par 3. Alternatively, run sam freq counter.jar on .SAM files generated by the user using another aligner.
\par 4. Run peak finder.jar on the resulting freq_n.txt files generated in either step \'933\'94
\par 5. Run evaluation.jar on the resulting peak.txt or spoof.txt files generated in step \'934\'94
\par }\pard \ltrpar\ql \fi720\li0\ri0\sa200\sl276\slmult1\widctlpar\wrapdefault\aspalpha\aspnum\faauto\adjustright\rin0\lin0\itap0\pararsid11692257 {\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991
\par
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 Instructions for use}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15354785
\par The first step in analyzing }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid7933868 aptamer-free }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15354785 SELEX-seq}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid7933868 data is to align the reads generated by nex
t-generation sequencing (NGS) to a target sequence (eg, a chromosome). TFAST can accept alignment in the form of BLASTn output or .SAM files. BLASTn tends to generate a very complete alignment of NGS reads to a target sequence, but tends to be computation
ally heavy and may take some time. To align sequences using BLASTn follow the steps as outlined. TFAST can also accept .SAM alignment files, which can be generated very quickly using programs such as BOWTIE. To use .SAM files, enter the workflow at step
\'93alternate }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775 step }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid7933868 3 sam freq counter\'94.}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid4021494
\par
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 Step 1 }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid4021494 fileconversion}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495
\par BLASTn requires that sequences are in FASTA format, so the first program in the TFAST workflow, fileconversion}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495
, converts Illumina high-throughput sequence data (typically in a form similar to \'93s_}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683 #}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid6820385 _1_0}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683 #}{
\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 _qseq.txt\'94}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683 , ie \'93s_5_1_0}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid6820385 0}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683 01_qseq.txt\'94 or
\'93s_1_1_0120_qseq.txt\'94}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 ) into FASTA format}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 . }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775 Fileconversion currently only supports Illumina
\rquote s _qseq.txt format. Fileconversion}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775
only coverts uninterrupted reads from _qseq.txt files into FASTA format; partial, degenerate or incomplete reads will not be converted. Fileconversion}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid15229775 does not take read quality (PHRED score) into account when converting sequences.}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495
For files in fastq format, existing open-source resources exist for converting sequences to FASTA (such as the Galaxy suite of tools, }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495\charrsid1468495 http://}{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid1468495 usegalaxy.org)}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
\par To use }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 fileconversion}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 , execute the application. This will open the command }{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid9253991 window}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 and prompt the user to ent}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 er the directory that contains _}{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid15297938 qseq}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 .txt}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 files.
\par Input: Directory of }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 _}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 qseq.txt files, each line of the format: \tab
\par HWUSI-EAS1707\tab 1\tab 6\tab 1\tab 1871\tab 1088\tab 0\tab 1AAACAATTGACAATGATTATCATTTGCATTAAAAAGACTACGTAGTATTTTTATTTCATGAGGAACTATACCCGCCAGCA\tab fffaWd`ff]ffd^_SaYa^fffdfcdRccacc\\^[]`dccW^ccRb^bbccccccccfccacc_cc[WWdbb````BBB}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid9909908
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 1
\par Output: /fasta subdirectory of the original directory, with a file corresponding to each}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 _}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 qseq}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 .txt}{
\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 file}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 (naming in line with fasta_}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683\charrsid10486683 }{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid10486683 s_#_1_000#_qseq.txt}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 )}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 , with lines from the }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 _}{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid15297938 qseq}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 .txt}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 files formatted as follows (corresponding to the above input line):
\par >18711088}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9909908
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 AAACAATTGACAATGATTATCATTTGCATTAAAAAGACTACGTAGTATTTTTATTTCATGAGGAACTATACCCGCCAGCA
\par Notes: If the raw sequence was not determinable at one point (indicated by one or more '.' characters instead of A/C/G/T), the read will be discarded.
\par
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 Step 2 Folder blast}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 Requirements: }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775 Download}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 and install}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775 }{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid1468495 the appropriate version of }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775 BLASTn}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 for your operating system. BLASTn is a utility provided by the NCBI}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid15229775 at no cost}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 at}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775 (}{\field\flddirty{\*\fldinst {\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775
HYPERLINK "http://www.ncbi.nlm.nih.gov/books/NBK1762" }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1646983 {\*\datafield
00d0c9ea79f9bace118c8200aa004ba90b0200000003000000e0c9ea79f9bace118c8200aa004ba90b6c00000068007400740070003a002f002f007700770077002e006e006300620069002e006e006c006d002e006e00690068002e0067006f0076002f0062006f006f006b0073002f004e0042004b003100370036003200
0000795881f43b1d7f48af2c825dc485276300000000a5ab00000000}}}{\fldrslt {\rtlch\fcs1 \af31507 \ltrch\fcs0 \cs15\ul\cf17\insrsid15229775\charrsid3568720 http://www.ncbi.nlm.nih.gov/books/NBK1762}}}\sectd \ltrsect
\linex0\endnhere\sectlinegrid360\sectdefaultcl\sftnbj {\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 ).}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15229775
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 Folder}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 blast}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
uses FASTA formatted sequences, provid}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 ed by the user or generated by fileconve}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 r}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1468495 sion}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
in Step 1. The user will also have to provide a sequence file of the genome of the organism being investigated, in .fna format. .fna files can be found on the NCBI website (}{\field\flddirty{\*\fldinst {\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308
HYPERLINK "http://www.ncbi.nlm.nih.gov/pubmed/" }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid1646983 {\*\datafield
00d0c9ea79f9bace118c8200aa004ba90b0200000003000000e0c9ea79f9bace118c8200aa004ba90b6000000068007400740070003a002f002f007700770077002e006e006300620069002e006e006c006d002e006e00690068002e0067006f0076002f007000750062006d00650064002f000000795881f43b1d7f48af2c
825dc485276300000000a5ab00000070}}}{\fldrslt {\rtlch\fcs1 \af31507 \ltrch\fcs0 \cs15\ul\cf17\insrsid14761308\charrsid3568720 http://www.ncbi.nlm.nih.gov/pubmed/}}}\sectd \ltrsect\linex0\endnhere\sectlinegrid360\sectdefaultcl\sftnbj {\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid15297938 )}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14948957 .}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 Folder}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 blast}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
uses a shell script to run BLASTn on the FASTA formatted sequences against the appropriate}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 .fna file of interest. To use f}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 olde}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid14761308 r blast}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 , execute the application. This will open the command }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 window
}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 and prompt the user to enter the directory containing the FASTA formatted sequence files as well as the .fna genome se}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308
quence file. The result of folder blast}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 are BLAST}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 -formatted .txt}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid15297938 files}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 (naming in line with blast_fasta_}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid6820385\charrsid6820385 }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid6820385 s_#_1_000#
_qseq.txt}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 )}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 . Check the NCBI website for tips on streamlining very large BLAST sets (http://www.ncbi.nlm.nih.gov/books/NBK1762).
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9909908
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 Input: Directory of FASTA }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 formatted sequences}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 , as described above. Each
.txt file in the directory will be run with BLAST - be sure to include only FASTA sequence files.
\par \tab
\par Output: /blast subdirectory of the /fasta, with a file corresponding to each FASTA}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 _}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid6820385\charrsid6820385 }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid6820385
s_#_1_000#_qseq.txt }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 file. Output is a series of BLAST}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 files}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 corresponding
to each FASTA sequence read. Also requires a plain sequence .fna file.
\par
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 Step 3 }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 freq counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid15297938
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 Freq counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
uses results of local BLAST files to generate a position-frequency table, provided by the user or by running }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 folder blast}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid15297938 . }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 Frequency tables can be generated by the user using other utilities or program packages (see description of _freq.txt format, below). Freq counter}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 takes the aligned sequences from}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 folder blast}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid15297938 and counts the number of sequence reads that overlap at each nucleotide within the chromosome of interest. This results in a frequency table (displayed freq_#.txt), which is a tab-delimited }{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid14761308 single column }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 table}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 the length of the target sequence (sequence aligned to, ie chromosome or genome)}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid15297938 that indicates }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 frequencies at each position.}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
\par To use }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid550895 freq counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 , execute the application. This will open the command }{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid9253991 window}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 and prompt the user to enter the directory containing the files produced in the local BLAST of sequences, the genome\rquote s .fna file}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid550895 , the estimated upper boun}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 d on the number of aligned reads}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 and the cycle number.}{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid550895 Cycle number is}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 \'931\'94 for the control cycle (the unselected cycle, i.e. the starting library of sequences), \'932\'94 for the second cycle to be analyzed, etc.}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid550895 The estimated upper bound for the number of aligned reads allows freq counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid550895
to normalize the number of reads processed. This ensures that freq counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid550895
will not bias frequency files due to variation in raw number of reads between or within lanes during sequencing.}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid8062794 Blast sample counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid8062794 can estimate the number of aligned reads for BLASTn aligned files.}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10359851 To use it, execute
the program, select the directory containing the blast_ files and run. The fields will populate automatically.}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
\par
\par Input: Directory of BLAST results, as described above. Each .txt file in the directory will be included in }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid550895 the frequency table generation so}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
be sure to include only relevant BLAST results. Also requires a plain sequence .fna file.
\par
\par Output: /freq subdirectory of the /blast directory, with a freq_n.txt file which is a list of integers, with the nth integer corresponding to the frequency of the nth location in the genome.
\par
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308 Alternate step 3 sam freq counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 A user may choose to
use a different method of aligning their NGS data to a target sequence. The easiest way to incorporate alternative (non-BLASTn) alignments into the TFAST workflow is to generate .SAM files (such as by using BOWTIE). There are several good, freely availab
le NGS alignment tools. Many tools of this type require FASTQ formatted sequences (instead of Illumina\rquote
s _qseq.txt format). An easy way to convert _qseq to FASTQ is to use Bash (the command line in Cygwin and Unix-based systems, ie Linux, OSX, etc), navigate to the directory containing the _qseq.txt files and enter the command (after the $):
\par for ((x=1;x<=8;x+=1)); do cat s_"$x"_1_*_qseq.txt | awk -F '\\t' '\{gsub(/\\./,"N", $9); if ($11 > 0) printf("@%s_%04d:%s:%s:%s:%s#%s/%s\\n%s\\n+%s_%04d:%s:%s:%s:%s#%s/%s\\n%s\\n",$1,$2,$3,$4,$5,$6,$7,$8,$9,$1,$2,$3,$4,$5,$6,$7,$8,$10)\}
' > s_"$x"_sequence.fastq; done
\par Resulting files should be}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 .txt files}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 in FASTQ format.
\par Once the user has generated .SAM files using their alignment tool of choice, execute sam freq counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 . This will open the command }{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid9253991 window}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308
and prompt the user to enter the directory containing .SAM files for a particular cycle, the genome .fna file, the upper bound on number of aligned reads (usually given in aligner reports), the cycle number, the fragment length subj
ected to sequencing, and the read length (number of bases sequenced/read per fragment). Sam freq counter}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308
will then generate freq_n.txt files as described in step 3.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14761308
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 Step }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid7933868 4}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 \endash }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 peak finder}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 Peak finder}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 uses the frequency tables of the control libr
ary and the final round of SELEX (that is, the most enriched round that was sequenced). Frequen}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 cy tables can be generated using TFAST or generated by the user}{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid15297938 . Peak}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 f}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 inder}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
determines local maxima, and rejects peaks that are less than two standard}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 deviations above the mean of an n-}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 bp window}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid14225308 (set by the user)}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 around that peak position in the control library}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 . Peak finder}{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid14225308 also rejects peaks that were two standard deviations above the mean in the control library, to reduce bias from aberrant variation in
the control cycle being counted as peaks. Peak f}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 inder}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
examines the sequence within a fragment length (probe length) of each peak to determine whether or not a given peak is an aberration or represents a true maxima for that region.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 To use peak f}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 inder}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
, execute the application. This will open the command }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 window}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
and prompt the user to enter the frequency file of the most enriched SELEX cycle, the frequency file of the control library, the .fna file of the genome of interest}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 , a manually set thresho
ld for peaks in the final cycle (optional), the threshold window (we suggest a value equal to or greater than probe length)}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
and the estimated fragment length (probe length). Probe length can be determined empirically by running the library on a high-resolution gel, or when the initial library}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 is selected for SELEX analysis}{
\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 .
\par Peak}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 f}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 inder}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 produces two files \endash
Peak.txt and Spoof.txt. Peak.txt is a .txt file containing a single column of chromosomal positions corresponding to predicted peaks. The user may el
ect to use his/her own peak finding algorithms, in which case, format the output similarly to proceed to Step 5. Spoof.txt is a similarly formatted file that contains chromosomal positions generated randomly. Spoof.txt can be used as a control file to val
idate results and improve downstream data analysis w}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 hen using motif finding software and to generate background models of genome sequence behavior and nucleotide representation}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid15297938 .
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 TFAST can also find minima instead of maxima if the user desires. In most SELEX
experiments, this will result in a vast number of minima as SELEX tends to produce zero frequency between peaks. This option is useful for knockout experiments, such as transposon mutagenesis studies coupled with high-throughput sequencing. When selectin
g minima, TFAST subtracts the final cycle from the control cycle and counts regions that are two standard deviations of the control cycle (within the set window) above zero as peaks.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
\par Input: freq_n.txt (where n is the number of cycles), freq_1.txt (the control library), a plain sequence .fna file, a set threshold if necessary,}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 threshold window}{\rtlch\fcs1 \af31507 \ltrch\fcs0
\insrsid15297938 and the average probe}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 (fragment)}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 length.
\par
\par Output: /peak subdirectory, with a peak.txt file and a spoof.txt file.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9909908
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 Step }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid7933868 5}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 \endash Evaluaton}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid15297938
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 Evaluaton}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 uses peak positions determined in Step 4 or provided by t}{\rtlch\fcs1 \af31507
\ltrch\fcs0 \insrsid10035611 he user to grade peaks. Before using evaluaton}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 , place all freq_#.txt files of interest (including the control) i}{
\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 nto a single directory. To use e}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 valuator}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
, execute the application. This will open the command }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid9253991 window}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
and prompt the user to enter the directory containing all freq_#.txt files, the .fna file of the genome of interest, the peak.txt file, weights for every round, average probe length}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 (fragment length)}{
\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 and the length of sequence around each peak to be included in the output.
\par Weights for every round should be delimited with commas. Every cycle of SELEX selects for the most strongly binding species in a pool. Thus, as cycles continue, the requirements for binding increase. Therefore, we advise the use
r to use a scheme that weighs enrichment in later rounds higher than enrichment in earlier rounds. For example, for a SELEX with three rounds of enrichment (control library, enriched1, enriched2 and enriched3), one scoring schema could be \'931, 1.5, 2
\'94. \'931,1,1\'94
will result in equal weights in every round, which does not reflect the increasing stringency of competitive binding in the DNA fragment libraries. Ideally, a scoring scheme for weights between rounds will be based on the fraction of input species that
are recovered after each round in the SELEX experiment, reflecting the bulk affinity of the library for the protein of interest. These considerations are less of a concern if the user performs \'93fixed stringency SELEX\'94.
\par Once completed, }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 e}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 valuato}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611 n}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1
\af31507 \ltrch\fcs0 \insrsid15297938 will produce a tab-delimited table called \'93output.txt\'94, including data on each peak.
\par -The first (left-most) column describes the peak number, which for most users can be disregarded (useful for testing the program internally).
\par -The second column describes the location of the peak within the chromosome, based on the .fna file provided.
\par -The third through nth columns describe the frequency at that chromosomal position for each SELEX cycle amplified, where \'93n\'94 is the cycle number (1 = the control library, 2 = first enrichment entered, etc).
\par -The (n+1)th column describes the weight of a peak. Weight is determined by adding the \'93weight\'94 values when the frequency at a position increased between cycles, and by adding 0 when the frequenc
y at a position remained unchanged or declined. High weights correspond to strongly enriching sequences.
\par -The (n+2)th column describes the power of a peak. Power represents the area under a peak as compared to the total area under peaks for the final cycle
sequence. Power is another way to grade how strongly a fragment has enriched relative to every other fragment.
\par -the (n+3)th column describes an estimated binding site length. This is determined by finding the bounds under a peak that includes 99% of the p
eak area, and subtracting that distance from twice the probe length. Because probe length will vary slightly for technical reasons, it is best to use an average of several peaks to assess the theoretical binding length for a site. This can be useful for d
etermining cases of multiple adjacent binding sites as well as for discarding large repeated regions.
\par -The (n+4)th column describes The chromosomal sequence that falls under a given peak, with the amount of sequence included determined by the user. The length included should conform to the standards of a}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10486683
ny downstream analysis planned.}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611
\par Evaluation}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid13336526 .jar}{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid10035611
can also analyze the quality of minima (valleys) instead of peaks. This utility is useful for knockout experiments that incorporate NGS, but is unlikely to yield results in SELEX data.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 \tab
\par Input: A folder containing only the freq_1.txt through freq_n.txt files, with every file from 1 to n included. Also, a plain sequence .fna file, average probe length, length of flanking sequence to be printed, and a list of weights.
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15613048
\par }{\rtlch\fcs1 \af31507 \ltrch\fcs0 \insrsid15297938 Output: /output subdirectory, with a output.txt file as referenced above.
\par
\par
\par A dataset of SELEX data using high-throughput sequencing is provided in supplemental data. Feel free to make use of them as a practice set. The files are from an actual experiment that used the algorithms found in TFAST to determine and experi
mentally validate a novel, unique binding site for a transcription factor (PapX) in E. coli.
\par }{\*\themedata 504b030414000600080000002100828abc13fa0000001c020000130000005b436f6e74656e745f54797065735d2e786d6cac91cb6ac3301045f785fe83d0b6d8
72ba28a5d8cea249777d2cd20f18e4b12d6a8f843409c9df77ecb850ba082d74231062ce997b55ae8fe3a00e1893f354e9555e6885647de3a8abf4fbee29bbd7
2a3150038327acf409935ed7d757e5ee14302999a654e99e393c18936c8f23a4dc072479697d1c81e51a3b13c07e4087e6b628ee8cf5c4489cf1c4d075f92a0b
44d7a07a83c82f308ac7b0a0f0fbf90c2480980b58abc733615aa2d210c2e02cb04430076a7ee833dfb6ce62e3ed7e14693e8317d8cd0433bf5c60f53fea2fe7
065bd80facb647e9e25c7fc421fd2ddb526b2e9373fed4bb902e182e97b7b461e6bfad3f010000ffff0300504b030414000600080000002100a5d6a7e7c00000
00360100000b0000005f72656c732f2e72656c73848fcf6ac3300c87ef85bd83d17d51d2c31825762fa590432fa37d00e1287f68221bdb1bebdb4fc7060abb08
84a4eff7a93dfeae8bf9e194e720169aaa06c3e2433fcb68e1763dbf7f82c985a4a725085b787086a37bdbb55fbc50d1a33ccd311ba548b63095120f88d94fbc
52ae4264d1c910d24a45db3462247fa791715fd71f989e19e0364cd3f51652d73760ae8fa8c9ffb3c330cc9e4fc17faf2ce545046e37944c69e462a1a82fe353
bd90a865aad41ed0b5b8f9d6fd010000ffff0300504b0304140006000800000021006b799616830000008a0000001c0000007468656d652f7468656d652f7468
656d654d616e616765722e786d6c0ccc4d0ac3201040e17da17790d93763bb284562b2cbaebbf600439c1a41c7a0d29fdbd7e5e38337cedf14d59b4b0d592c9c
070d8a65cd2e88b7f07c2ca71ba8da481cc52c6ce1c715e6e97818c9b48d13df49c873517d23d59085adb5dd20d6b52bd521ef2cdd5eb9246a3d8b4757e8d3f7
29e245eb2b260a0238fd010000ffff0300504b03041400060008000000210096b5ade296060000501b0000160000007468656d652f7468656d652f7468656d65
312e786d6cec594f6fdb3614bf0fd87720746f6327761a07758ad8b19b2d4d1bc46e871e698996d850a240d2497d1bdae38001c3ba618715d86d87615b8116d8
a5fb34d93a6c1dd0afb0475292c5585e9236d88aad3e2412f9e3fbff1e1fa9abd7eec70c1d1221294fda5efd72cd4324f1794093b0eddd1ef62fad79482a9c04
98f184b4bd2991deb58df7dfbb8ad755446282607d22d771db8b944ad79796a40fc3585ee62949606ecc458c15bc8a702910f808e8c66c69b9565b5d8a314d3c
94e018c8de1a8fa94fd05093f43672e23d06af89927ac06762a049136785c10607758d9053d965021d62d6f6804fc08f86e4bef210c352c144dbab999fb7b471
7509af678b985ab0b6b4ae6f7ed9ba6c4170b06c788a705430adf71bad2b5b057d03606a1ed7ebf5babd7a41cf00b0ef83a6569632cd467faddec9699640f671
9e76b7d6ac355c7c89feca9cccad4ea7d36c65b258a206641f1b73f8b5da6a6373d9c11b90c537e7f08dce66b7bbeae00dc8e257e7f0fd2badd5868b37a088d1
e4600ead1ddaef67d40bc898b3ed4af81ac0d76a197c86826828a24bb318f3442d8ab518dfe3a20f000d6458d104a9694ac6d88728eee2782428d60cf03ac1a5
193be4cbb921cd0b495fd054b5bd0f530c1931a3f7eaf9f7af9e3f45c70f9e1d3ff8e9f8e1c3e3073f5a42ceaa6d9c84e5552fbffdeccfc71fa33f9e7ef3f2d1
17d57859c6fffac327bffcfc793510d26726ce8b2f9ffcf6ecc98baf3efdfdbb4715f04d814765f890c644a29be408edf3181433567125272371be15c308d3f2
8acd249438c19a4b05fd9e8a1cf4cd296699771c393ac4b5e01d01e5a30a787d72cf1178108989a2159c77a2d801ee72ce3a5c545a6147f32a99793849c26ae6
6252c6ed637c58c5bb8b13c7bfbd490a75330f4b47f16e441c31f7184e140e494214d273fc80900aedee52ead87597fa824b3e56e82e451d4c2b4d32a423279a
668bb6690c7e9956e90cfe766cb37b077538abd27a8b1cba48c80acc2a841f12e698f13a9e281c57911ce298950d7e03aba84ac8c154f8655c4f2af074481847
bd804859b5e696007d4b4edfc150b12addbecba6b18b148a1e54d1bc81392f23b7f84137c2715a851dd0242a633f900710a218ed715505dfe56e86e877f0034e
16bafb0e258ebb4faf06b769e888340b103d3311da9750aa9d0a1cd3e4efca31a3508f6d0c5c5c398602f8e2ebc71591f5b616e24dd893aa3261fb44f95d843b
5974bb5c04f4edafb95b7892ec1108f3f98de75dc97d5772bdff7cc95d94cf672db4b3da0a6557f70db629362d72bcb0431e53c6066acac80d699a6409fb44d0
8741bdce9c0e4971624a2378cceaba830b05366b90e0ea23aaa241845368b0eb9e2612ca8c742851ca251ceccc70256d8d87265dd96361531f186c3d9058edf2
c00eafe8e1fc5c509031bb4d680e9f39a3154de0accc56ae644441edd76156d7429d995bdd88664a9dc3ad50197c38af1a0c16d684060441db02565e85f3b966
0d0713cc48a0ed6ef7dedc2dc60b17e92219e180643ed27acffba86e9c94c78ab90980d8a9f0913ee49d62b512b79626fb06dccee2a432bbc60276b9f7dec44b
7904cfbca4f3f6443ab2a49c9c2c41476dafd55c6e7ac8c769db1bc399161ee314bc2e75cf8759081743be1236ec4f4d6693e5336fb672c5dc24a8c33585b5fb
9cc24e1d4885545b58463634cc5416022cd19cacfccb4d30eb45296023fd35a458598360f8d7a4003bbaae25e331f155d9d9a5116d3bfb9a95523e51440ca2e0
088dd844ec6370bf0e55d027a012ae264c45d02f708fa6ad6da6dce29c255df9f6cae0ec38666984b372ab5334cf640b37795cc860de4ae2816e95b21be5ceaf
8a49f90b52a51cc6ff3355f47e0237052b81f6800fd7b802239daf6d8f0b1571a8426944fdbe80c6c1d40e8816b88b8569082ab84c36ff0539d4ff6dce591a26
ade1c0a7f669880485fd484582903d284b26fa4e2156cff62e4b9265844c4495c495a9157b440e091bea1ab8aaf7760f4510eaa69a6465c0e04ec69ffb9e65d0
28d44d4e39df9c1a52ecbd3607fee9cec7263328e5d661d3d0e4f62f44acd855ed7ab33cdf7bcb8ae889599bd5c8b3029895b6825696f6af29c239b75a5bb1e6
345e6ee6c28117e73586c1a2214ae1be07e93fb0ff51e133fb65426fa843be0fb515c187064d0cc206a2fa926d3c902e907670048d931db4c1a44959d366ad93
b65abe595f70a75bf03d616c2dd959fc7d4e6317cd99cbcec9c58b34766661c7d6766ca1a9c1b327531486c6f941c638c67cd22a7f75e2a37be0e82db8df9f30
254d30c1372581a1f51c983c80e4b71ccdd28dbf000000ffff0300504b0304140006000800000021000dd1909fb60000001b010000270000007468656d652f74
68656d652f5f72656c732f7468656d654d616e616765722e786d6c2e72656c73848f4d0ac2301484f78277086f6fd3ba109126dd88d0add40384e4350d363f24
51eced0dae2c082e8761be9969bb979dc9136332de3168aa1a083ae995719ac16db8ec8e4052164e89d93b64b060828e6f37ed1567914b284d262452282e3198
720e274a939cd08a54f980ae38a38f56e422a3a641c8bbd048f7757da0f19b017cc524bd62107bd5001996509affb3fd381a89672f1f165dfe514173d9850528
a2c6cce0239baa4c04ca5bbabac4df000000ffff0300504b01022d0014000600080000002100828abc13fa0000001c0200001300000000000000000000000000
000000005b436f6e74656e745f54797065735d2e786d6c504b01022d0014000600080000002100a5d6a7e7c0000000360100000b000000000000000000000000
002b0100005f72656c732f2e72656c73504b01022d00140006000800000021006b799616830000008a0000001c00000000000000000000000000140200007468
656d652f7468656d652f7468656d654d616e616765722e786d6c504b01022d001400060008000000210096b5ade296060000501b000016000000000000000000
00000000d10200007468656d652f7468656d652f7468656d65312e786d6c504b01022d00140006000800000021000dd1909fb60000001b010000270000000000
00000000000000009b0900007468656d652f7468656d652f5f72656c732f7468656d654d616e616765722e786d6c2e72656c73504b050600000000050005005d010000960a00000000}
{\*\colorschememapping 3c3f786d6c2076657273696f6e3d22312e302220656e636f64696e673d225554462d3822207374616e64616c6f6e653d22796573223f3e0d0a3c613a636c724d
617020786d6c6e733a613d22687474703a2f2f736368656d61732e6f70656e786d6c666f726d6174732e6f72672f64726177696e676d6c2f323030362f6d6169
6e22206267313d226c743122207478313d22646b3122206267323d226c743222207478323d22646b322220616363656e74313d22616363656e74312220616363
656e74323d22616363656e74322220616363656e74333d22616363656e74332220616363656e74343d22616363656e74342220616363656e74353d22616363656e74352220616363656e74363d22616363656e74362220686c696e6b3d22686c696e6b2220666f6c486c696e6b3d22666f6c486c696e6b222f3e}
{\*\latentstyles\lsdstimax267\lsdlockeddef0\lsdsemihiddendef1\lsdunhideuseddef1\lsdqformatdef0\lsdprioritydef99{\lsdlockedexcept \lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority0 \lsdlocked0 Normal;
\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority9 \lsdlocked0 heading 1;\lsdqformat1 \lsdpriority9 \lsdlocked0 heading 2;\lsdqformat1 \lsdpriority9 \lsdlocked0 heading 3;\lsdqformat1 \lsdpriority9 \lsdlocked0 heading 4;
\lsdqformat1 \lsdpriority9 \lsdlocked0 heading 5;\lsdqformat1 \lsdpriority9 \lsdlocked0 heading 6;\lsdqformat1 \lsdpriority9 \lsdlocked0 heading 7;\lsdqformat1 \lsdpriority9 \lsdlocked0 heading 8;\lsdqformat1 \lsdpriority9 \lsdlocked0 heading 9;
\lsdpriority39 \lsdlocked0 toc 1;\lsdpriority39 \lsdlocked0 toc 2;\lsdpriority39 \lsdlocked0 toc 3;\lsdpriority39 \lsdlocked0 toc 4;\lsdpriority39 \lsdlocked0 toc 5;\lsdpriority39 \lsdlocked0 toc 6;\lsdpriority39 \lsdlocked0 toc 7;
\lsdpriority39 \lsdlocked0 toc 8;\lsdpriority39 \lsdlocked0 toc 9;\lsdqformat1 \lsdpriority35 \lsdlocked0 caption;\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority10 \lsdlocked0 Title;\lsdpriority1 \lsdlocked0 Default Paragraph Font;
\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority11 \lsdlocked0 Subtitle;\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority22 \lsdlocked0 Strong;\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority20 \lsdlocked0 Emphasis;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority59 \lsdlocked0 Table Grid;\lsdunhideused0 \lsdlocked0 Placeholder Text;\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority1 \lsdlocked0 No Spacing;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority60 \lsdlocked0 Light Shading;\lsdsemihidden0 \lsdunhideused0 \lsdpriority61 \lsdlocked0 Light List;\lsdsemihidden0 \lsdunhideused0 \lsdpriority62 \lsdlocked0 Light Grid;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority63 \lsdlocked0 Medium Shading 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority64 \lsdlocked0 Medium Shading 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority65 \lsdlocked0 Medium List 1;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority66 \lsdlocked0 Medium List 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority67 \lsdlocked0 Medium Grid 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority68 \lsdlocked0 Medium Grid 2;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority69 \lsdlocked0 Medium Grid 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority70 \lsdlocked0 Dark List;\lsdsemihidden0 \lsdunhideused0 \lsdpriority71 \lsdlocked0 Colorful Shading;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority72 \lsdlocked0 Colorful List;\lsdsemihidden0 \lsdunhideused0 \lsdpriority73 \lsdlocked0 Colorful Grid;\lsdsemihidden0 \lsdunhideused0 \lsdpriority60 \lsdlocked0 Light Shading Accent 1;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority61 \lsdlocked0 Light List Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority62 \lsdlocked0 Light Grid Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority63 \lsdlocked0 Medium Shading 1 Accent 1;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority64 \lsdlocked0 Medium Shading 2 Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority65 \lsdlocked0 Medium List 1 Accent 1;\lsdunhideused0 \lsdlocked0 Revision;
\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority34 \lsdlocked0 List Paragraph;\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority29 \lsdlocked0 Quote;\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority30 \lsdlocked0 Intense Quote;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority66 \lsdlocked0 Medium List 2 Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority67 \lsdlocked0 Medium Grid 1 Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority68 \lsdlocked0 Medium Grid 2 Accent 1;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority69 \lsdlocked0 Medium Grid 3 Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority70 \lsdlocked0 Dark List Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority71 \lsdlocked0 Colorful Shading Accent 1;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority72 \lsdlocked0 Colorful List Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority73 \lsdlocked0 Colorful Grid Accent 1;\lsdsemihidden0 \lsdunhideused0 \lsdpriority60 \lsdlocked0 Light Shading Accent 2;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority61 \lsdlocked0 Light List Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority62 \lsdlocked0 Light Grid Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority63 \lsdlocked0 Medium Shading 1 Accent 2;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority64 \lsdlocked0 Medium Shading 2 Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority65 \lsdlocked0 Medium List 1 Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority66 \lsdlocked0 Medium List 2 Accent 2;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority67 \lsdlocked0 Medium Grid 1 Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority68 \lsdlocked0 Medium Grid 2 Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority69 \lsdlocked0 Medium Grid 3 Accent 2;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority70 \lsdlocked0 Dark List Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority71 \lsdlocked0 Colorful Shading Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority72 \lsdlocked0 Colorful List Accent 2;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority73 \lsdlocked0 Colorful Grid Accent 2;\lsdsemihidden0 \lsdunhideused0 \lsdpriority60 \lsdlocked0 Light Shading Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority61 \lsdlocked0 Light List Accent 3;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority62 \lsdlocked0 Light Grid Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority63 \lsdlocked0 Medium Shading 1 Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority64 \lsdlocked0 Medium Shading 2 Accent 3;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority65 \lsdlocked0 Medium List 1 Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority66 \lsdlocked0 Medium List 2 Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority67 \lsdlocked0 Medium Grid 1 Accent 3;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority68 \lsdlocked0 Medium Grid 2 Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority69 \lsdlocked0 Medium Grid 3 Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority70 \lsdlocked0 Dark List Accent 3;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority71 \lsdlocked0 Colorful Shading Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority72 \lsdlocked0 Colorful List Accent 3;\lsdsemihidden0 \lsdunhideused0 \lsdpriority73 \lsdlocked0 Colorful Grid Accent 3;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority60 \lsdlocked0 Light Shading Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority61 \lsdlocked0 Light List Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority62 \lsdlocked0 Light Grid Accent 4;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority63 \lsdlocked0 Medium Shading 1 Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority64 \lsdlocked0 Medium Shading 2 Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority65 \lsdlocked0 Medium List 1 Accent 4;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority66 \lsdlocked0 Medium List 2 Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority67 \lsdlocked0 Medium Grid 1 Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority68 \lsdlocked0 Medium Grid 2 Accent 4;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority69 \lsdlocked0 Medium Grid 3 Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority70 \lsdlocked0 Dark List Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority71 \lsdlocked0 Colorful Shading Accent 4;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority72 \lsdlocked0 Colorful List Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority73 \lsdlocked0 Colorful Grid Accent 4;\lsdsemihidden0 \lsdunhideused0 \lsdpriority60 \lsdlocked0 Light Shading Accent 5;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority61 \lsdlocked0 Light List Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority62 \lsdlocked0 Light Grid Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority63 \lsdlocked0 Medium Shading 1 Accent 5;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority64 \lsdlocked0 Medium Shading 2 Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority65 \lsdlocked0 Medium List 1 Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority66 \lsdlocked0 Medium List 2 Accent 5;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority67 \lsdlocked0 Medium Grid 1 Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority68 \lsdlocked0 Medium Grid 2 Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority69 \lsdlocked0 Medium Grid 3 Accent 5;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority70 \lsdlocked0 Dark List Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority71 \lsdlocked0 Colorful Shading Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority72 \lsdlocked0 Colorful List Accent 5;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority73 \lsdlocked0 Colorful Grid Accent 5;\lsdsemihidden0 \lsdunhideused0 \lsdpriority60 \lsdlocked0 Light Shading Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority61 \lsdlocked0 Light List Accent 6;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority62 \lsdlocked0 Light Grid Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority63 \lsdlocked0 Medium Shading 1 Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority64 \lsdlocked0 Medium Shading 2 Accent 6;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority65 \lsdlocked0 Medium List 1 Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority66 \lsdlocked0 Medium List 2 Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority67 \lsdlocked0 Medium Grid 1 Accent 6;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority68 \lsdlocked0 Medium Grid 2 Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority69 \lsdlocked0 Medium Grid 3 Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority70 \lsdlocked0 Dark List Accent 6;
\lsdsemihidden0 \lsdunhideused0 \lsdpriority71 \lsdlocked0 Colorful Shading Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority72 \lsdlocked0 Colorful List Accent 6;\lsdsemihidden0 \lsdunhideused0 \lsdpriority73 \lsdlocked0 Colorful Grid Accent 6;
\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority19 \lsdlocked0 Subtle Emphasis;\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority21 \lsdlocked0 Intense Emphasis;
\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority31 \lsdlocked0 Subtle Reference;\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority32 \lsdlocked0 Intense Reference;
\lsdsemihidden0 \lsdunhideused0 \lsdqformat1 \lsdpriority33 \lsdlocked0 Book Title;\lsdpriority37 \lsdlocked0 Bibliography;\lsdqformat1 \lsdpriority39 \lsdlocked0 TOC Heading;}}{\*\datastore 010500000200000018000000
4d73786d6c322e534158584d4c5265616465722e352e3000000000000000000000060000
d0cf11e0a1b11ae1000000000000000000000000000000003e000300feff090006000000000000000000000001000000010000000000000000100000feffffff00000000feffffff0000000000000000ffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff
ffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff
ffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff
fffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff
Source: TFAST ReadMe RTF.rtf, updated 2012-04-08
