[Staden-package] Problems with "add_tags" (pregap scripting)
Brought to you by:
awhitwham,
jkbonfield
From: <Sq...@we...> - 2006-12-01 08:29:06
|
Hello, I'm doing a little pregap scripting trying to write primer information dir= ectly on the consensus sequenz of my gap4 database. In a first step I'm collecting the primer data by using "find=5Fprimers". Th= is returns a list of primers and also seems to set tags on the correspondi= ng reads. Now I'm walking through the list of primers, determine reading <-> contig = pairs and create a new list entry with primer data. Finally I want to add the content of the list of the gap4 database by usin= g the "add=5Ftags" function. Here a short section of code showing only the relevant part (without "find= =5Fprimers"): set primer=5Flist {} foreach primer $primers { # get reading=5Fname of the current primer # MSC-08=5FG08 MSC-08=5FG08=5FT3 test=5Fproject.47 CGTCTGCTGTCAGATAAAGTC 764 + set reading=5Fname [lindex $primer 1] # get number of the leftmost reading of the config on which $reading=5Fname = resides set leftmost=5Freading=5Fnum [db=5Finfo chain=5Fleft $io $reading=5Fname] # walk throug all contigs, $contig contains name of the contig foreach contig $contig=5Flist { # get number of leftmost reading from $contig set tmp [db=5Finfo chain=5Fleft $io $contig] # check if both numbers are equal, it true the primer resides on this cont= ig if {$leftmost=5Freading=5Fnum =3D=3D $tmp} then { # add primer data to tag list set start=5Fpos [lindex $primer 4] set tmp=5Fpos [string length [lindex $primer 3]] set end=5Fpos [expr {$start=5Fpos +$tmp=5Fpos}] set direction [lindex $primer 5] set comment [lindex $primer 3] lappend primer=5Flist "-$tmp PRIM $direction $start=5Fpos..$end=5Fpos $comment" break } } } add=5Ftags -io $io -tags $primer=5Flist Executing this script ends with something like this: Level 2: gatc=5Fprimer::run {/home/sk/workspace/faaf/documents/users/stefan/= faaf/test=5Fproject/MSC2-A19Y-B21=5FT3- 1.exp /home/sk/workspace/faaf/documents/users/stefan/faaf/test=5Fproject/MSC= 2-A2Y-G13=5FT7-2.exp /home/sk/workspa ce/faaf/documents/users/stefan/faaf/test=5Fproject/MSC2-A3Y-B20=5FT3-1.exp /ho= me/sk/workspace/faaf/documents/user s/stefan/faaf/test=5Fproject/MSC2-A14Y-I18=5FT3-1.exp /home/sk/workspace/faaf/= documents/users/stefan/faaf/test=5Fpr oject/MSC2-A8Y-H04=5FT3-2.exp /home/sk/workspace/faaf/documents/users/stefan= /faaf/test=5Fproject/MSC2-B2D-A12=5FT7. exp /home/sk/workspace/faaf/documents/users/stefan/faaf/test=5Fproject/MSC2-= A20Y-H18=5FT3-1.exp .... This seems to be a dump of the files, coming into my script. Also the program terminates unexpected: Thu 23 Nov 10:51:48 2006 [5031@pc48] ...opened Thu 23 Nov 10:52:00 2006 [5031@pc48] Program terminated unexpectedly with = signal 2. By commenting the "add=5Ftags" function out the script runs to the end. Would it be possible to recive a hint or is there a fault I'm not able to = see=3F Thank you for your efforts. With kind regards, Stefan Kesberg =5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F=5F= Erweitern Sie FreeMail zu einem noch leistungsst=E4rkeren E-Mail-Postfach! =09 Mehr Infos unter http://freemail.web.de/home/landingpad/=3Fmc=3D021131 |