#1 sequence export

open
nobody
5
2004-04-30
2004-04-30
Anonymous
No

Following features would be very helpful:

1) Extraction of tagged sequences (e.g. manually tagged
regions)

Extraction of DNA sequences:
contig tag region sequence (5'-3')
1 oligo 120..143 AGTCTTTCTAGCTAGCTTGGTGT

Extraction of protein sequences:
obtained from selected/all templates and/or contigs
according to a feature list or tags (e.g. exons)

2) Export of full annotated consensus sequences,
including all information of read tags and consensus tags
in EMBL format

Holger Wedler
holger.wedler@freenet.de

Discussion

  • James Bonfield
    James Bonfield
    2004-05-10

    Logged In: YES
    user_id=154581

    Tag export and protein export ideas sound good. I'll add it
    to my list.

    Export of EMBL feature tables is also something I've had
    planned for ages, but it's not trivial. The key problem here
    is that Gap4's tags are for a single range (start..end)
    whereas EMBL features consist of multiple ranges linked
    together via join() functions. There's a horrid hack to link
    these together for CDS (etc) when reading EMBL tags, but any
    editing of the resulting tags can cause complete mayhem.
    Something to work on for sure!

     
  • Logged In: NO

    Hi,

    In addition to the possibilities described above, it would be
    very useful to extract consensus sequences of selected or all
    templates from multiple alignments without need of
    disassembly into new contigs.

    Regards,
    Holger
    holger.wedler@freenet.de