Re: [Samtools-help] problem with ValidateSam. issue from Samtool or Picards ?

[Alec W. <al...@br...>]

Hi Tiphaine,

I'm afraid I don't have any idea why this might be happening.  The message about mate negative strand flag not matching reality should appear in both invocations of ValidateSamFile.  I don't know the content of your reference, so I don't know if the message about the NM value is correct or not.  The only thing I can imagine is that you are not validating the files you think you are.  I'm sorry I can't be of more help.

-Alec

On Feb 28, 2013, at 4:44 AM, Tiphaine Martin wrote:

> Hi,
> 
> This is my command line : 
> java -Xmx3584m -jar $PICARD_HOME/ValidateSamFile.jar REFERENCE_SEQUENCE=$REFGENOME INPUT=4397_6.sorted.bam OUTPUT=4397_6.sorted.valid.txt
> 
> java -Xmx3584m -jar $PICARD_HOME/ValidateSamFile.jar REFERENCE_SEQUENCE=$REFGENOME INPUT=4397_6.bam OUTPUT=4397_6.valid.txt
> 
> the sequence of the reference genome is the same in the step BWA. Samtools seems not to change the reads.
> 
> I know that ValidateSamFrile stops printing errors after the first 100 errors. But I have only 1 error and 7 warnings from bam before samtools and I think more 100 error/warnings messages after samtools.
> 
> 
> Tiphaine
> From: Alec Wysoker [al...@br...]
> Sent: 27 February 2013 17:23
> To: Tiphaine Martin
> Cc: sam...@li...
> Subject: Re: [Samtools-help] problem with ValidateSam. issue from Samtool or Picards ?
> 
> Hi Tiphaine,
> 
> It's always helpful to send along the entire command lines you used.
> 
> For the reads that produced additional errors, can you pull the reads out of the files before and after samtools sort, and send them along?  I would be surprised if samtools sort is changing the reads themselves.
> 
> Note also the by default ValidateSamFile stops printing errors after the first 100 errors.  If you don't override this option, then you will see different errors before the cutoff is reached.
> 
> -Alec
> 
> 
> On Feb 27, 2013, at 10:07 AM, Tiphaine Martin wrote:
> 
>> Hi,
>> 
>> I don't understand the error from ValidateSamFile (picard/1.80) when I gave the reference genome.
>> 
>> the data are mapping with BWA and after that, the data are sorted by samtools (samtools/0.1.18)
>> 
>> Before that the data are sorted by samtools, I have only these error messages.
>> ERROR: Read groups is empty
>> WARNING: Read name IL30_4397:6:1:1146:19924, A record is missing a read group
>> WARNING: Read name IL30_4397:6:1:1146:19924, A record is missing a read group
>> WARNING: Read name IL30_4397:6:1:1153:18458, A record is missing a read group
>> WARNING: Read name IL30_4397:6:1:1153:18458, A record is missing a read group
>> WARNING: Read name IL30_4397:6:1:1168:14196, A record is missing a read group
>> WARNING: Read name IL30_4397:6:1:1168:14196, A record is missing a read group
>> WARNING: Read name IL30_4397:6:1:1223:7932, A record is missing a read group
>> 
>> But after sorting, I have more error messages.ERROR: Read groups is empty
>> WARNING: Read name IL30_4397:6:48:13092:15987, A record is missing a read group
>> ERROR: Record 1, Read name IL30_4397:6:48:13092:15987, NM tag (nucleotide differences) in file [4] does not match reality [9]
>> ERROR: Record 1, Read name IL30_4397:6:48:13092:15987, Mate negative strand flag does not match read negative strand flag of mate
>> WARNING: Read name IL30_4397:6:48:13092:15987, A record is missing a read group
>> WARNING: Read name IL30_4397:6:24:8653:9499, A record is missing a read group
>> ERROR: Record 3, Read name IL30_4397:6:24:8653:9499, NM tag (nucleotide differences) in file [3] does not match reality [8]
>> .......
>> 
>> 
>> my reads are  :
>> IL30_4397:6:48:13092:15987    89    1    9994    37    7M2I45M    =    9994    0    CTTCCGATCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA    D<ADD??ACBB<BBFDD<GGGED<DGDBE:FGFCF=FGGDG=GIIFFAIIIHIG    XT:A:U    NM:i:4    XN:i:7    SM:i:37    AM:i:0    X0:i:1    X1:i:0    XM:i:2    XO:i:1    XG:i:2    MD:Z:0T0G50
>> IL30_4397:6:48:13092:15987    181    1    9994    0    *    =    9994    0    CTTCCGATCTTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTT    DC@BD@:BACBA@CACFBAFDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
>> 
>> Can you help me to understand that? does the issue come from Samtools or Picards
>> 
>> 
>> Tiphaine
>> ------------------------------------------------------------------------------
>> Everyone hates slow websites. So do we.
>> Make your web apps faster with AppDynamics
>> Download AppDynamics Lite for free today:
>> http://p.sf.net/sfu/appdyn_d2d_feb_______________________________________________
>> Samtools-help mailing list
>> Sam...@li...
>> https://lists.sourceforge.net/lists/listinfo/samtools-help
> 
> <4397_6_extract.sorted.txt><4397_6_extract.txt>