Re: [Samtools-help] Sam format to fastq

[Klaudia W. <kw...@sa...>]

Hi Alec,

I tried to change it, but I still get the same error message:  Illegal  
mate state
Could you please let me know which combinations are considered legal  
mate combinations in Picard?

Many thanks,
Klaudia

On 25 Feb 2010, at 01:28, Alec Wysoker wrote:

> Hi Klaudia,
>
> Although the SAM spec does allow the info about which end is which  
> to be omitted, we (Picard development team) feel that this is bad  
> practice and we don't want to encourage it.  Can you write a perl or  
> python script to arbitrarily assign ends to be first or second of  
> pair?
>
> -Alec
>
> Klaudia Walter wrote:
>> Hi all,
>>
>> I found the following flags paired up 17 with 33 and 19 with 35,  
>> which do not contain the information whether they are the first or  
>> the second mate, if I understand that correctly.
>>
>> 1st Example:
>>
>> SRR003669.14280418    17    1    1024770    78    51M    =     
>> 1025080    259     
>> TTTGGTCTGTTGTTCTAAGAATCGGAGAGAGAGAGGTTAAAATCTCCGACT    :; 
>> 7::;9<98=:=0:=@A>=>26:9B=A<B?A5B:<?;A???:=994;6:C     
>> RG:Z:SRR003669    MF:i:4    Aq:i:53    NM:i:3    UQ:i:72    H0:i: 
>> 1    H1:i:0
>>
>> SRR003669.14280418    33    1    1025080    53    51M    =     
>> 1024770    -259     
>> TGGTCTATTGTTCTAAGAATCGGAGAGAGAGAGGTTAAAATCTCCAACTAT    C99==@=?? 
>> 8>@;A;?=9@><6=1=9>;=<<8>=9@40A9A8>@6:>9?48    RG:Z:SRR003669     
>> MF:i:4    Aq:i:53    NM:i:1    UQ:i:29    H0:i:0    H1:i:1
>>
>>
>> 2nd Example:
>>
>> SRR003667.10102516    35    1    1102933    99    51M    =     
>> 1103095    213     
>> GTCAGTACTTTAGAGGATCCCCTTCCCCAGCAGGAATCCTGGGTGCTGAGG    3';-; 
>> +<35,;==;./<@8/;542864:901>*/5736))4*-)).*-/2)    RG:Z:SRR003667     
>> MF:i:18    Aq:i:57    NM:i:0    UQ:i:0    H0:i:1    H1:i:0
>>
>> SRR003667.10102516    19    1    1103095    99    51M    =     
>> 1102933    -213     
>> GGGGAGGGGTCTCAGGGCTCCTGACTTCTTCCATTCTTGCCCAGCCCACCC     
>> 40*595,+4><;<>69,?96=@0;<@=<><;<A>:><><<;>A;::<;96@     
>> RG:Z:SRR003667    MF:i:18    Aq:i:57    NM:i:0    UQ:i:0    H0:i: 
>> 1    H1:i:0
>>
>> I am not sure in which circumstances these flags are set. As a  
>> solution for the SamToFastq tool, could not the mate with the  
>> smaller chromosomal position be allocated as the first mate and the  
>> other one as the second mate?
>>
>> Thanks,
>> Klaudia
>>
>>
>> On 23 Feb 2010, at 09:57, John Marshall wrote:
>>
>>> On 22 Feb 2010, at 22:56, Alec Wysoker wrote:
>>>> It looks like there is something strange with your input SAM  
>>>> file.  It
>>>> appears that it does actually contain paired reads, but there are  
>>>> two
>>>> reads with the same name that are either both marked as being the  
>>>> first
>>>> of the pair or both marked as being the second of the pair.
>>>
>>> I wonder whether Klaudia's input file contains non-primary  
>>> alignments.  I guess tools like SamToFastq need to allow for reads  
>>> appearing in more than one SAM alignment record -- hopefully this  
>>> could be as simple as ignoring non-primary records, though the  
>>> hint about split hits in the flag field description suggests that  
>>> might not be quite good enough.
>>>
>>>   John
>>



-- 
 The Wellcome Trust Sanger Institute is operated by Genome Research 
 Limited, a charity registered in England with number 1021457 and a 
 company registered in England with number 2742969, whose registered 
 office is 215 Euston Road, London, NW1 2BE.