Menu
▾
▴
Re: [Samtools-help] Update FW: seg fault on import
|
From: Nicole W. <NLW...@lb...> - 2009-09-29 22:19:00
|
Hi again Tom,
If you are meaning me to use the fai that is produced by running faidx
on the fasta file, then i have tried that too... and i still get a seg
fault.
> samtools faidx elegans.WS190.dna.fa
gives me:
I 15072421 3 50 51
II 15279323 15373877 50 51
III 13783681 30958792 50 51
IV 17493785 45018151 50 51
MtDNA 13794 62861819 50 51
V 20919568 62875892 50 51
X 17718854 84213855 50 51
and then the other commands:
> samtools import elegans.WS190.dna.fa.fai L1.merged.header L1.bam
> samtools sort L1.bam L1.sorted
> samtools index L1.sorted.bam
> samtools tview L1.sorted.bam elegans.WS190.dna.fa
it starts up the viewer, and the it seg faults. bt is the following:
Program received signal SIGSEGV, Segmentation fault.
0x08066924 in bam_fetch (fp=0x9d13100, idx=0x9d13200, tid=0, beg=0,
end=80,
data=0x9d13008, func=0x8049f20 <tv_fetch_func>) at bam_index.c:556
556 bam_seek(fp, off[i+1].u, SEEK_SET);
(gdb) bt
#0 0x08066924 in bam_fetch (fp=0x9d13100, idx=0x9d13200, tid=0, beg=0,
end=80, data=0x9d13008, func=0x8049f20 <tv_fetch_func>) at
bam_index.c:556
#1 0x0804a0b9 in tv_draw_aln (tv=0x9d13008, tid=0, pos=0) at
bam_tview.c:269
#2 0x0804acf5 in bam_tview_main (argc=3, argv=0xbfe12068) at
bam_tview.c:402
#3 0x080563e9 in main (argc=4, argv=Cannot access memory at address 0x4
) at bamtk.c:123
(gdb)
i didn't specify it before, but the fasta file is from wormbase:
ftp://ftp.wormbase.org/pub/wormbase/data_freezes/WS190/sequences/elegans.WS190.dna.fa.gz
(unzipped before processing)
Nicole
On Sep 29, 2009, at 2:51 PM, Tom Blackwell wrote:
>
> Is it possible that in your call to samtools import, the first
> argument is a fasta file for the worm genome, rather than a tab-
> delimited file naming the five chromosomes and giving their
> lengths ? See man samtools.
>
> - tom blackwell -
>
> On Tue, 29 Sep 2009, Nicole Washington wrote:
>
>> Hello,
>>
>> I did a little investigation... it seemed to be bugging out in some
>> get_header function. So, just in case, I added a header to my
>> L1.merged file (having a header was never a requirement before),
>> similar to this (for all chromosomes):
>>
>> @SQ SN:I AS:WormBase WS190 LN:15072421 SP:Caenorhabditis elegans
>>
>> Now, when I added the header, the import command didn't seg fault!
>> However, when I ran the tview, it did seg fault.
>>
>> samtools tview L1.bam.bai elegans.WS190.dna.fa
>>
>> when i did a backtrace in gdb, i got this:
>>
>> #0 0x08066924 in bam_fetch (fp=0x8f930f0, idx=0x8f93068, tid=0,
>> beg=0,
>> end=80, data=0x8f93008, func=0x8049f20 <tv_fetch_func>) at
>> bam_index.c:556
>> #1 0x0804a0b9 in tv_draw_aln (tv=0x8f93008, tid=0, pos=0) at
>> bam_tview.c:269
>> #2 0x0804acf5 in bam_tview_main (argc=3, argv=0xbff561b8) at
>> bam_tview.c:402
>> #3 0x080563e9 in main (argc=4, argv=Cannot access memory at
>> address 0x4
>> ) at bamtk.c:123
>>
>> help?
>>
>> nicole
>>
>>
>> Begin forwarded message:
>>
>>> From: Nicole Washington <NLW...@lb...>
>>> Date: September 29, 2009 2:18:52 PM PDT
>>> To: sam...@li...
>>> Subject: seg fault on import
>>> hi,
>>> i'm trying to perform an import with worm fasta WS190, and i get a
>>> segfault when running the import command:
>>>> samtools import elegans.WS190.dna.fa L1.merged L1.bam
>>> [sam_header_read2] 1000653 sequences loaded.
>>> Segmentation fault (core dumped)
>>> i thought maybe it was the blank lines in the fasta file, so i
>>> removed those. but that didn't fix it.
>>> i've tried this with all different versions of my sam file, and it
>>> is still not working. i include a 10-line sam file at the bottom
>>> of this email that i tried (L1.merged). i am running the latest
>>> samtools (svn revision 469).
>>> any ideas?
>>> nicole
>>> EX36I5J02G5DRG 0 V 9068340 0 27M *
>>> 0 0 GATCAAAGAATACAATCTTCATTTTAC * AS:i:27 HI:i:1
>>> EX36I5J02G5X2V 0 I 13953063 0
>>> 16M1D59M1D39M * 0 0
>>> GATCGCCCGCAGACGCCTTCGGCTTCCCATCACTCCGAGTCCGAGGTCAAGAAGACCAGCAAGAAGTAAATACTGTGCTCGTTATTGTTTCCTAATGAAATTGTTGTTAAACAT
>>> * AS:i:96 HI:i:1
>>> EX36I5J02GFGT4 0 X 60733 0 8M1D42M *
>>> 0 0 GATCTTGGAAGCTCTAAATTGTTTTTGTTGGTAATAAAAACTTGTTATAC
>>> * AS:i:35 HI:i:1
>>> EX36I5J02GFGT4 16 IV 4389136 0 42M1D8M *
>>> 0 0 GTATAACAAGTTTTTATTACCAACAAAAACAATTTAGAGCTTCCAAGATC
>>> * AS:i:35 HI:i:2
>>> EX36I5J02GNVZU 0 X 14978582 0 7M1D42M
>>> * 0 0
>>> GATCCCGTTAATACTCTGTACGCTAAAGCATAAATAAAGACGATGTGTC * AS:i:38
>>> HI:i:1
>>> EX36I5J02GQ2EN 16 V 3978812 0 1S39M1D5M
>>> * 0 0 GTGAGTTAATAAATTTCATTTCATGAATAAATATTTCGATGGATC
>>> * AS:i:37 HI:i:1
>>> EX36I5J02I9M5J 16 IV 12390268 0
>>> 40M1D59M1D12M * 0 0
>>> AACCCCAACGACTTTATGTCGGAATAACAAGAACAACAAAATTTACGAACGTGGTCTCTCCTTCTTTCCCTTGAACAGGGCGATGAGGGAGGTGTTGGCACCTTCACGATC
>>> * AS:i:93 HI:i:1
>>> EX36I5J02ILYM1 0 II 7106202 0 13M1D38M1S
>>> * 0 0
>>> GATCTTCTGTTATGTTATTGTTCGCAGTTGTAATAAACAGTTGTGACTTTGT * AS:i:44
>>> HI:i:1
>>
>
|