What is SSDJ?

liangc_mu

SSDJ (Secondary Structure Dataset in JSON) is a new data file format that has been defined for exchanging RNA secondary structure dataset information. It is an easy-to-read, easy-to-use and light-weighted data format that not only stores base-pairing information for RNA secondary structure as in DBN, CT and BPSEQ formats but also contains graphic drawing information like 2-dimensional coordinates and color setting for each base. Clearly, SSDJ will facilitate data exchange and communication and enhance data retrieval efficiency.

Primarily, this file format consists of 5 parts:

1) sequence: The sequence of base in the secondary structure graph.
2) dot_bracket: The dot bracket notation of the secondary structure graph.
3) coordinate: The position/coordinate of every base in the secondary structure graph.
• Each base is positioned at the coordinate point x,y. One space is treated as the default separator between coordinates. When taking personal using habits into account, the semicolons could also be accepted as separator.
4) color(Not required): The color of each base in the secondary structure graph.
• A group of valid 6 digit hex number (from 000000 to FFFFFF) is taken to define the color of one base. To identify each group, a space or a semicolon works as the hex number separator. When the color is not specified, a different default color will be used to filled in the bases in RNASViewer.
5) pairings: The indexes of the base pairs.
• The index of each base starts at 1 and increases by 1. A group of indexes n,m means that the base n paired with the base m. One space or one semicolon works as separator to identify each group.

Example:

{sequence:"CACCUAAAUGGGCGAUAGCAAUGCAUUGGAAUCGUAAUUGGCUACGCUGCAGUUUGGUAAUU",dot_bracket:".(((....((((((.((((..(((.........)))....)))))))).))....)))....",coordinate:"605,61 584,82 554,82 524,82 539,56 524,30 494,30 479,56 494,82 464,82 434,82 404,82 374,82 344,82 329,56 314,82 284,82 254,82 224,82 224,52 194,52 194,82 164,82 134,82 118,57 90,44 61,49 38,68 30,97 38,126 61,145 90,150 118,137 134,112 164,112 194,112 179,138 194,164 224,164 239,138 224,112 254,112 284,112 314,112 344,112 374,112 404,112 434,112 449,138 464,112 494,112 479,138 494,164 524,164 539,138 524,112 554,112 584,112 605,133 635,133 656,112 656,82",color:"#28FF28 #FF0000 #28FF28 #28FF28 #FFFF00 #FF0000 #FF0000 #FF0000 #FFFF00 #00FFFF #00FFFF #00FFFF #28FF28 #00FFFF #FF0000 #FFFF00 #FF0000 #00FFFF #28FF28 #FF0000 #FF0000 #FFFF00 #00FFFF #28FF28 #FF0000 #FFFF00 #FFFF00 #00FFFF #00FFFF #FF0000 #FF0000 #FFFF00 #28FF28 #00FFFF #FFFF00 #FF0000 #FF0000 #FFFF00 #FFFF00 #00FFFF #00FFFF #28FF28 #FFFF00 #FF0000 #28FF28 #00FFFF #28FF28 #FFFF00 #00FFFF #28FF28 #FF0000 #00FFFF #FFFF00 #FFFF00 #FFFF00 #00FFFF #00FFFF #FFFF00 #FF0000 #FF0000 #FFFF00 #FFFF00",pairings:"24,34 23,35 22,36 19,41 18,42 17,43 16,44 14,45 13,46 12,47 11,48 10,50 9,51 4,56 3,57 2,58"}


Related

Wiki: Home