opaltoolkit-users — Users mailing-list for Opal Toolkit

[Opaltoolkit-users] Vina 1.1.2 Services Changes and Errors

[Sarkis D. <dal...@gm...>]

Greetings,

I've noticed that http://nbcr-222.ucsd.edu/opal2/services/vina_1.1.2 has
been changed recently. Previously, this started Vina directly. Now, it's
using a wrapper script to make vina.sub
<http://nbcr-222.ucsd.edu/opal-jobs/appvina_1.1.21516472296916943585912/vina.sub>
and it requires adding --receptor as an argument. I'm getting the following
error when submitting jobs to this modified version of Vina 1.1.2 Services:

Unable to initialize environment because of error: cannot register
event client. Only 99 event clients are allowed in the system
Exiting.

http://nbcr-222.ucsd.edu/opal-jobs/appvina_1.1.21516472296916943585912/stderr.txt

Is it possible to change Vina 1.1.2 Services back to the way it was before?
If not,  how can one fix this error?

Thanks,
Sarkis

-- 
http://google.com/+SarkisDallakian

Re: [Opaltoolkit-users] Cannot run date test service with Opal 2.5 (Error during database update: could not insert)

[Luca C. <luc...@gm...>]

Hey,
You should try to look into the catalina.log file for more clues into why
it is throwing that error.


Luca


On Jun 14, 2017 2:56 PM, "Alex Reynolds" <ale...@gm...> wrote:

> Hello,
>
> My larger goal is to install MEME web services. However, I am having great
> difficulty getting Opal 2.5 working with the test services contained within
> Opal itself, which is also causing downstream problems with MEME.
>
> I'm hoping anyone might see this and would be able to help out.
>
> My host is a Centos 7 box.
>
> I am running JDK 1.8.0_131-b12:
>
> $ java -version
> openjdk version "1.8.0_131"
> OpenJDK Runtime Environment (build 1.8.0_131-b12)
> OpenJDK 64-Bit Server VM (build 25.131-b12, mixed mode)
>
> I have a Tomcat 7.0.69 installation running. This otherwise appears to
> work properly. I can start, stop and restart this service and view it in a
> web browser.
>
> I downloaded and compiled Opal 2.5 from here:
>
> https://sourceforge.net/projects/opaltoolkit/files/
>
> Specifically, opal-ws-2.5.tar.gz.
>
> I went through installation instructions here:
>
> http://rocce-vm0.ucsd.edu/data/docs/opal/docs/2.X/clientsetup.html#AEN305
>
> I copied the date_config.xml file from $OPAL_HOME/configs/date_config.xml
> to $CATALINA_HOME/deploy/date.xml
>
> Per documentation, I tried to run the date service to test that the Opal
> setup is working correctly. This is where things fail.
>
> This are the commands I used:
>
> $ source etc/classpath.sh
> ...
> $ java edu.sdsc.nbcr.opal.GenericServiceClient -l
> http://myhost:8080/opal2/services/date -r launchJob -a \""-v1d -v3m -v0y
> -v-1d -u"\"
>
> I get the following error from running this command:
>
> Reading command line arguments
> Service URL: http://myhost:8080/opal2/services/date
> Invoking operation: launchJob
>
> Command line arguments: -v1d -v3m -v0y -v-1d -u
> Making non-blocking invocation on Opal service -
> Exception in thread "main" AxisFault
>  faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.
> generalException
>  faultSubcode:
>  faultString:
>  faultActor:
>  faultNode:
>  faultDetail:
>         {http://nbcr.sdsc.edu/opal/types}opalFaultOutput:<message>Error
> during database update: could not insert: [edu.sdsc.nbcr.opal.state.
> JobInfo]</message>
>         {http://xml.apache.org/axis/}exceptionName:edu.sdsc.nbcr.
> opal.FaultType
>         {http://xml.apache.org/axis/}hostname:tools0.altiusinstitute.org
>
>
>         at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native
> Method)
>         at sun.reflect.NativeConstructorAccessorImpl.newInstance(
> NativeConstructorAccessorImpl.java:62)
>         at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(
> DelegatingConstructorAccessorImpl.java:45)
>         at java.lang.reflect.Constructor.newInstance(Constructor.java:423)
>         at java.lang.Class.newInstance(Class.java:442)
>         at org.apache.axis.encoding.ser.BeanDeserializer.<init>(
> BeanDeserializer.java:104)
>         at org.apache.axis.encoding.ser.BeanDeserializer.<init>(
> BeanDeserializer.java:90)
>         at edu.sdsc.nbcr.opal.FaultType.getDeserializer(FaultType.
> java:114)
>         at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
>         at sun.reflect.NativeMethodAccessorImpl.invoke(
> NativeMethodAccessorImpl.java:62)
>         at sun.reflect.DelegatingMethodAccessorImpl.invoke(
> DelegatingMethodAccessorImpl.java:43)
>         at java.lang.reflect.Method.invoke(Method.java:498)
>         at org.apache.axis.encoding.ser.BaseDeserializerFactory.
> getSpecialized(BaseDeserializerFactory.java:154)
>         at org.apache.axis.encoding.ser.BaseDeserializerFactory.
> getDeserializerAs(BaseDeserializerFactory.java:84)
>         at org.apache.axis.encoding.DeserializationContext.
> getDeserializer(DeserializationContext.java:464)
>         at org.apache.axis.encoding.DeserializationContext.
> getDeserializerForType(DeserializationContext.java:547)
>         at org.apache.axis.message.SOAPFaultDetailsBuilder.onStartChild(
> SOAPFaultDetailsBuilder.java:157)
>         at org.apache.axis.encoding.DeserializationContext.startElement(
> DeserializationContext.java:1035)
>         at org.apache.xerces.parsers.AbstractSAXParser.startElement(Unknown
> Source)
>         at org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanStartElement(Unknown
> Source)
>         at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl
> $FragmentContentDispatcher.dispatch(Unknown Source)
>         at org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown
> Source)
>         at org.apache.xerces.parsers.XML11Configuration.parse(Unknown
> Source)
>         at org.apache.xerces.parsers.XML11Configuration.parse(Unknown
> Source)
>         at org.apache.xerces.parsers.XMLParser.parse(Unknown Source)
>         at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown
> Source)
>         at javax.xml.parsers.SAXParser.parse(SAXParser.java:392)
>         at org.apache.axis.encoding.DeserializationContext.parse(
> DeserializationContext.java:227)
>         at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:696)
>         at org.apache.axis.Message.getSOAPEnvelope(Message.java:424)
>         at org.apache.axis.handlers.soap.MustUnderstandChecker.invoke(
> MustUnderstandChecker.java:62)
>         at org.apache.axis.client.AxisClient.invoke(AxisClient.java:206)
>         at org.apache.axis.client.Call.invokeEngine(Call.java:2765)
>         at org.apache.axis.client.Call.invoke(Call.java:2748)
>         at org.apache.axis.client.Call.invoke(Call.java:2424)
>         at org.apache.axis.client.Call.invoke(Call.java:2347)
>         at org.apache.axis.client.Call.invoke(Call.java:1804)
>         at edu.sdsc.nbcr.opal.AppServicePortTypeSoapBindingStub.launchJob(
> AppServicePortTypeSoapBindingStub.java:624)
>         at edu.sdsc.nbcr.opal.GenericServiceClient.main(
> GenericServiceClient.java:359)
>
> I double-checked the permissions on the database folder here:
>
> $ ls -al $CATALINA_HOME/webapps/opal2/WEB-INF/data
>
> All "opaldb*" files are owned by the "tomcat" user and are read-write-able
> by this and all users.
>
> Is there a way to fix this?
>
> Thanks in advance for any guidance!
>
> Regards,
> Alex
>
> ------------------------------------------------------------
> ------------------
> Check out the vibrant tech community on one of the world's most
> engaging tech sites, Slashdot.org! http://sdm.link/slashdot
> _______________________________________________
> Opaltoolkit-users mailing list
> Opa...@li...
> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users
>
>

[Opaltoolkit-users] Cannot run date test service with Opal 2.5 (Error during database update: could not insert)

[Alex R. <ale...@gm...>]

Hello,

My larger goal is to install MEME web services. However, I am having great
difficulty getting Opal 2.5 working with the test services contained within
Opal itself, which is also causing downstream problems with MEME.

I'm hoping anyone might see this and would be able to help out.

My host is a Centos 7 box.

I am running JDK 1.8.0_131-b12:

$ java -version
openjdk version "1.8.0_131"
OpenJDK Runtime Environment (build 1.8.0_131-b12)
OpenJDK 64-Bit Server VM (build 25.131-b12, mixed mode)

I have a Tomcat 7.0.69 installation running. This otherwise appears to work
properly. I can start, stop and restart this service and view it in a web
browser.

I downloaded and compiled Opal 2.5 from here:

https://sourceforge.net/projects/opaltoolkit/files/

Specifically, opal-ws-2.5.tar.gz.

I went through installation instructions here:

http://rocce-vm0.ucsd.edu/data/docs/opal/docs/2.X/clientsetup.html#AEN305

I copied the date_config.xml file from $OPAL_HOME/configs/date_config.xml
to $CATALINA_HOME/deploy/date.xml

Per documentation, I tried to run the date service to test that the Opal
setup is working correctly. This is where things fail.

This are the commands I used:

$ source etc/classpath.sh
...
$ java edu.sdsc.nbcr.opal.GenericServiceClient -l
http://myhost:8080/opal2/services/date -r launchJob -a \""-v1d -v3m -v0y
-v-1d -u"\"

I get the following error from running this command:

Reading command line arguments
Service URL: http://myhost:8080/opal2/services/date
Invoking operation: launchJob

Command line arguments: -v1d -v3m -v0y -v-1d -u
Making non-blocking invocation on Opal service -
Exception in thread "main" AxisFault
 faultCode: {
http://schemas.xmlsoap.org/soap/envelope/}Server.generalException
 faultSubcode:
 faultString:
 faultActor:
 faultNode:
 faultDetail:
        {http://nbcr.sdsc.edu/opal/types}opalFaultOutput:<message>Error
during database update: could not insert:
[edu.sdsc.nbcr.opal.state.JobInfo]</message>
        {
http://xml.apache.org/axis/}exceptionName:edu.sdsc.nbcr.opal.FaultType
        {http://xml.apache.org/axis/}hostname:tools0.altiusinstitute.org


        at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native
Method)
        at
sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:62)
        at
sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:45)
        at java.lang.reflect.Constructor.newInstance(Constructor.java:423)
        at java.lang.Class.newInstance(Class.java:442)
        at
org.apache.axis.encoding.ser.BeanDeserializer.<init>(BeanDeserializer.java:104)
        at
org.apache.axis.encoding.ser.BeanDeserializer.<init>(BeanDeserializer.java:90)
        at edu.sdsc.nbcr.opal.FaultType.getDeserializer(FaultType.java:114)
        at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method)
        at
sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:62)
        at
sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43)
        at java.lang.reflect.Method.invoke(Method.java:498)
        at
org.apache.axis.encoding.ser.BaseDeserializerFactory.getSpecialized(BaseDeserializerFactory.java:154)
        at
org.apache.axis.encoding.ser.BaseDeserializerFactory.getDeserializerAs(BaseDeserializerFactory.java:84)
        at
org.apache.axis.encoding.DeserializationContext.getDeserializer(DeserializationContext.java:464)
        at
org.apache.axis.encoding.DeserializationContext.getDeserializerForType(DeserializationContext.java:547)
        at
org.apache.axis.message.SOAPFaultDetailsBuilder.onStartChild(SOAPFaultDetailsBuilder.java:157)
        at
org.apache.axis.encoding.DeserializationContext.startElement(DeserializationContext.java:1035)
        at org.apache.xerces.parsers.AbstractSAXParser.startElement(Unknown
Source)
        at
org.apache.xerces.impl.XMLNSDocumentScannerImpl.scanStartElement(Unknown
Source)
        at
org.apache.xerces.impl.XMLDocumentFragmentScannerImpl$FragmentContentDispatcher.dispatch(Unknown
Source)
        at
org.apache.xerces.impl.XMLDocumentFragmentScannerImpl.scanDocument(Unknown
Source)
        at org.apache.xerces.parsers.XML11Configuration.parse(Unknown
Source)
        at org.apache.xerces.parsers.XML11Configuration.parse(Unknown
Source)
        at org.apache.xerces.parsers.XMLParser.parse(Unknown Source)
        at org.apache.xerces.parsers.AbstractSAXParser.parse(Unknown Source)
        at javax.xml.parsers.SAXParser.parse(SAXParser.java:392)
        at
org.apache.axis.encoding.DeserializationContext.parse(DeserializationContext.java:227)
        at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:696)
        at org.apache.axis.Message.getSOAPEnvelope(Message.java:424)
        at
org.apache.axis.handlers.soap.MustUnderstandChecker.invoke(MustUnderstandChecker.java:62)
        at org.apache.axis.client.AxisClient.invoke(AxisClient.java:206)
        at org.apache.axis.client.Call.invokeEngine(Call.java:2765)
        at org.apache.axis.client.Call.invoke(Call.java:2748)
        at org.apache.axis.client.Call.invoke(Call.java:2424)
        at org.apache.axis.client.Call.invoke(Call.java:2347)
        at org.apache.axis.client.Call.invoke(Call.java:1804)
        at
edu.sdsc.nbcr.opal.AppServicePortTypeSoapBindingStub.launchJob(AppServicePortTypeSoapBindingStub.java:624)
        at
edu.sdsc.nbcr.opal.GenericServiceClient.main(GenericServiceClient.java:359)

I double-checked the permissions on the database folder here:

$ ls -al $CATALINA_HOME/webapps/opal2/WEB-INF/data

All "opaldb*" files are owned by the "tomcat" user and are read-write-able
by this and all users.

Is there a way to fix this?

Thanks in advance for any guidance!

Regards,
Alex

[Opaltoolkit-users] Babel Shell Script Input - NBCR Opal WSDL

[Derek L. <der...@si...>]

Thank you Nadya – your explanation was perfectly clear. OpenBabel WSDL services are now working for me without any errors.

OpenBabel.sh shell requires the addition of positional arguments for parsing the argument string.

OpenBabel argument:
-ipdb APE1inhibitor.pdb –opdbqt APE1out.pdbqt

OpenBabel.sh shell argument with positional arguments:
-iformat -ipdb -ifile APE1inhibitor.pdb -oformat -opdbqt -ofile APE1out.pdbqt

[Opaltoolkit-users] Invalid Argument Error: OpenBabel WSDL URL

[Derek L. <der...@si...>]

Dear Opaltoolkit-users,

I am unable to complete an OpenBabel process using the WSDL URL on the NBCR Opal2 Dashboard, and I would be very grateful of any assistance.

I can complete other Opal functions like PDB2PQR and Vina from the GenericServiceClient.py on the NBCR Opal Server. Additionally, the OpenBabel service works perfectly when using the ‘Submission Form’ on the Opal Dashboard.

In using the GenericServiceClient.py, the OpenBabel service fails with the error: ‘Invalid -ipdb argument in -ipdb sample.pdb -opdbqt sample.pdqt’.

Service URL:  http://nbcr-222.ucsd.edu/opal2/services/openbabel_2.3.1
Input argument: -ipdb sample.pdb -opdbqt sample.pdbqt

Stderr: …nothing written to this file
Stdout: Invalid -ipdb argument in -ipdb sample.pdb -opdbqt sample.pdqt
The input file is loading correctly on the server.

[Opaltoolkit-users] What should be in the SOAP body?

[Sam H. <sh...@nc...>]

Hi again! So now I'm working on writing a SOAP request in Java for my example service. I've managed to get a response from the Opal 
server, but it complains about what I put in the SOAP body. Since I'm simply posting a file attachment, I'm not sure what to put in 
the SOAP body to make it happy. I just threw meme:meme in there for testing. Thanks for any help! Here's the request and response:

Request SOAP Message:

------=_Part_0_491044090.1472583742543
Content-Type: text/xml; charset=utf-8

<SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:meme="http://localhost:8080/opal2/services/meme">
<SOAP-ENV:Header/>
<SOAP-ENV:Body><meme:meme/></SOAP-ENV:Body>
</SOAP-ENV:Envelope>
------=_Part_0_491044090.1472583742543
Content-Type: application/fasta

 >intergenic_region_chraradu.Chr07_13534592..13535058
aaggagtaaatattcgcccgcgaaatctttgtttttttatttcgaaattgagccaatcca
ataccaccagaaataaataaaataaggatttgttagaatcttatgctctaatagaacaac
attatctagttatatatttaactatatatagggggggcaaattttctaataaatgtctag
ttctatataaaaatcaaaacaagatatactaatttccaattgatcaatcaatcctatgaa
atattaaaataaaaaaacctcgtgattcaattattcattaaacatatgtatatacggtat
atttttttattggtattggttaaatccatttttgtaattgttttattcgcgaggagccgt
atgaggtgaaaatctcatgtacggttctggaatagcgatgggatttctaaacaaccatca
actataaccccaaaagaaccagattccgtaagcaacatagaggaaga
 >intergenic_region_chraradu.Chr06_70048212..70048485
agagtttttcttctattaccattaaaatacaatagatgaatagtcattcgaagaaaaatc
attaaacataaatatagaatattcaaaatattctatcacatttttttactaatatatata
aatccaatcactaggattggtaactagtaataagttaataaggagcgagtatcctatttt
ttattcattgagatctgttgactttgtataccatttcactgtaaatataggattttatcc
tatagattcattgtggtcttgaaatttgagaaaa
------=_Part_0_491044090.1472583742543--

Response SOAP Message:

<?xml version="1.0" encoding="UTF-8"?>
<soapenv:Envelope xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" 
xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<soapenv:Body>
<soapenv:Fault>
<faultcode xmlns:ns1="http://xml.apache.org/axis/">ns1:Client</faultcode>
<faultstring>No such operation 'meme'</faultstring>
<detail><ns2:hostname xmlns:ns2="http://xml.apache.org/axis/">morangie</ns2:hostname></detail>
</soapenv:Fault>
</soapenv:Body>
</soapenv:Envelope>

Re: [Opaltoolkit-users] How to use the simple form to pass an uploaded file to the app?

[Sam H. <sh...@nc...>]

Thanks, Conrad, that was it! For the record, here's a functional simple form file-upload deploy XML, since I had trouble finding any 
examples in the docs:

<appConfig xmlns="http://nbcr.sdsc.edu/opal/types"
            xmlns:xsd="http://www.w3.org/2001/XMLSchema">
   <metadata appName="meme">
     <usage><![CDATA[meme fasta-file]]></usage>
     <types>
         <untaggedParams>
             <param>
                 <id>fasta-file</id>
                 <paramType>FILE</paramType>
                 <ioType>INPUT</ioType>
                 <required>true</required>
                 <textDesc><![CDATA[Input FASTA file.]]></textDesc>
             </param>
         </untaggedParams>
     </types>
   </metadata>
   <binaryLocation>/home/shokin/meme/bin/meme</binaryLocation>
   <defaultArgs></defaultArgs>
   <jobManagerFQCN>edu.sdsc.nbcr.opal.manager.ForkJobManager</jobManagerFQCN>
   <parallel>false</parallel>
</appConfig>

On 08/29/2016 07:36 PM, Conrad Huang wrote:
> I think you need to wrap your "untaggedParams" inside a "types" tag. Here's a sample config file that works for me:
>
>> <appConfig xmlns="http://nbcr.sdsc.edu/opal/types"
>>            xmlns:xsd="http://www.w3.org/2001/XMLSchema">
>>   <metadata appName="CCD">
>>     <usage><![CDATA[ccd_cat returns the wwPDB Chemical Component Dictionary for
>> the requested residue type]]></usage>
>>     <types>
>>         <untaggedParams>
>>             <param>
>>                 <id>residue</id>
>>                 <paramType>STRING</paramType>
>>                 <ioType>INPUT</ioType>
>>                 <textDesc>The name of the residue of interest</textDesc>
>>             </param>
>>         </untaggedParams>
>>     </types>
>>   </metadata>
>>   <binaryLocation>/usr/local/opal-local/bin/ccd_cat.py</binaryLocation>
>>   <defaultArgs></defaultArgs>
>>   <parallel>false</parallel>
>> </appConfig>
>
> Good luck.
>
> Conrad
>
> On 8/29/2016 5:18 PM, Sam Hokin wrote:
>> Hiya, Opal users. I've just installed Opal, it's running fine, but I'm mystified as to how I can get my uploaded file placed on the
>> command line of my command-line app using the stock webapp simple form. I see that the file is called inputFile[0] on the form, but
>> I've tried everything I can think of, and my app always errors as if it has no input.
>>
>> Here's my deploy XML. I've tried with and without the untaggedParams block.
>>
>> <appConfig xmlns="http://nbcr.sdsc.edu/opal/types"
>>             xmlns:xsd="http://www.w3.org/2001/XMLSchema">
>>    <metadata appName="meme">
>>      <usage><![CDATA[meme fasta-file]]></usage>
>>
>>          <untaggedParams>
>>              <param>
>>                  <id>inputFile[0]</id>
>>                  <paramType>FILE</paramType>
>>                  <ioType>INPUT</ioType>
>>                  <required>true</required>
>>                  <textDesc><![CDATA[Input FASTA file.]]></textDesc>
>>              </param>
>>          </untaggedParams>
>>
>>    </metadata>
>>    <binaryLocation>/home/shokin/meme/bin/meme</binaryLocation>
>>    <defaultArgs></defaultArgs>
>>    <jobManagerFQCN>edu.sdsc.nbcr.opal.manager.ForkJobManager</jobManagerFQCN>
>>    <parallel>false</parallel>
>> </appConfig>
>>
>> The file is successfully uploaded to webapps/ROOT/appmeme#/
>>
>> stdout.txt is always empty; stderr.txt has the help output from meme when you run it without any parameters.
>>
>> Thanks for the help! I'm planning to use Opal to wrap meme so I can access it via Java calls from my InterMine instances.
>>
>> ------------------------------------------------------------------------------
>> _______________________________________________
>> Opaltoolkit-users mailing list
>> Opa...@li...
>> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users
>>

[Opaltoolkit-users] How to use the simple form to pass an uploaded file to the app?

[Sam H. <sh...@nc...>]

Hiya, Opal users. I've just installed Opal, it's running fine, but I'm mystified as to how I can get my uploaded file placed on the 
command line of my command-line app using the stock webapp simple form. I see that the file is called inputFile[0] on the form, but 
I've tried everything I can think of, and my app always errors as if it has no input.

Here's my deploy XML. I've tried with and without the untaggedParams block.

<appConfig xmlns="http://nbcr.sdsc.edu/opal/types"
            xmlns:xsd="http://www.w3.org/2001/XMLSchema">
   <metadata appName="meme">
     <usage><![CDATA[meme fasta-file]]></usage>

         <untaggedParams>
             <param>
                 <id>inputFile[0]</id>
                 <paramType>FILE</paramType>
                 <ioType>INPUT</ioType>
                 <required>true</required>
                 <textDesc><![CDATA[Input FASTA file.]]></textDesc>
             </param>
         </untaggedParams>

   </metadata>
   <binaryLocation>/home/shokin/meme/bin/meme</binaryLocation>
   <defaultArgs></defaultArgs>
   <jobManagerFQCN>edu.sdsc.nbcr.opal.manager.ForkJobManager</jobManagerFQCN>
   <parallel>false</parallel>
</appConfig>

The file is successfully uploaded to webapps/ROOT/appmeme#/

stdout.txt is always empty; stderr.txt has the help output from meme when you run it without any parameters.

Thanks for the help! I'm planning to use Opal to wrap meme so I can access it via Java calls from my InterMine instances.

[Opaltoolkit-users] Job restart option for SGE?

[Charles G. <ce...@uw...>]

Hi,

Opal seems to submit jobs to SGE without setting the restart flag. We’re running Opal with SGE in the Amazon EC2 cloud, and if Opal could send jobs to SGE with the restart flag set we could take advantage of spot pricing. The problem with using spot pricing is that you can loose nodes without notice if you get outbid. Currently if the SGE cluster looses a node being used to run an Opal job, Opal simply reports an invalid job state, and the jobs is forgotten If Opal set the restart flag, SGE would automatically restart the job on another node.

I’m guessing that this would just be a mater of passing ‘-r’ to the JobTempate.setArgs() function.

Is this on anybody’s plate, or should I try creating a patch for Opal 2.5 on my own?

Thanks!

Charles

Re: [Opaltoolkit-users] DRMAA failure on SGE (Starcluster)

[Charles G. <ce...@uw...>]

Hi Luca, Hi Nadya,


> On Jan 23, 2015, at 12:15 PM, Luca Clementi <luc...@gm...> wrote:
> 
> On Fri, Jan 23, 2015 at 9:18 AM, nadya williams <na...@sd...> wrote:
>> HI Charles,
>> 
>> can you submit and execute jobs successfully outside of opal using age submission?
>> If not, first need to make sure that your age configuration is correct.
>> 
>> If yes, check  how is the opal-jobs/ created.
>> This directory needs to be NFS-mounted on all the nodes from the fronted (or opal server)
>> node of the cluster. For example,
>>        /opt/tomcat/webapps/opal-jobs -> /share/opal/opal-jobs
>> And /share/opal/opal-jobs is NFS mounted.
>> 
>> Check your in opal.properties:
>>        tomcat.url  - FQDN of your  cluster fronted
>>        drmaa.queue - set to your default SGE queue
>>        drmaa.pe - set to parallel environment of your SGe configuration
>> 
>> Are you running on ec2?
>> The starcluster is not the same “cluster" as we have in rocks. It is a group of VMs,
>> and in rocks we have a computing cluster. I don’t know how the SGE configuration and
>> inter-node communication is handled.
>> My guess would be if the SGE is working from the command line and SGE obs are running
>> correctly, then the opal configuration should just follow your SGE specifics and the above 4  variables
>> should take care of it.
> 
> Hey Charles,
> you might want to take a look in the SGE message log. I don't know
> where starcluster places it though.

Thanks for your input. I was able to submit jobs to the cluster on the command line, but was never able to get DRMAA to work.

I turned on Condor on the cluster and switched the Opal job manager setting to Condor, and that seems to be working.

Charles

Re: [Opaltoolkit-users] DRMAA failure on SGE (Starcluster)

[Luca C. <luc...@gm...>]

On Fri, Jan 23, 2015 at 9:18 AM, nadya williams <na...@sd...> wrote:
> HI Charles,
>
> can you submit and execute jobs successfully outside of opal using age submission?
> If not, first need to make sure that your age configuration is correct.
>
> If yes, check  how is the opal-jobs/ created.
> This directory needs to be NFS-mounted on all the nodes from the fronted (or opal server)
> node of the cluster. For example,
>         /opt/tomcat/webapps/opal-jobs -> /share/opal/opal-jobs
> And /share/opal/opal-jobs is NFS mounted.
>
> Check your in opal.properties:
>         tomcat.url  - FQDN of your  cluster fronted
>         drmaa.queue - set to your default SGE queue
>         drmaa.pe - set to parallel environment of your SGe configuration
>
> Are you running on ec2?
> The starcluster is not the same “cluster" as we have in rocks. It is a group of VMs,
> and in rocks we have a computing cluster. I don’t know how the SGE configuration and
> inter-node communication is handled.
> My guess would be if the SGE is working from the command line and SGE obs are running
> correctly, then the opal configuration should just follow your SGE specifics and the above 4  variables
> should take care of it.

Hey Charles,
you might want to take a look in the SGE message log. I don't know
where starcluster places it though.

On Rocks it is in:
/opt/gridengine/default/spool/qmaster/messages


Sincerely,
Luca


>> On Jan 23, 2015, at 1:36 AM, Charles Grant <ce...@uw...> wrote:
>>
>> Hi,
>>
>> I'm trying to configure Opal to use the DRMAA job manager on an SGE cluster (2011.11) configured using Starcluster.
>>
>> We're running Tomcat 7.0.57. Our application uses the Opal Java API. I can submit jobs to the cluster using the command line, and my Opal installation works fine if I have
>>
>> opal.jobmanager=edu.sdsc.nbcr.opal.manager.ForkJobManager
>>
>> But if I use
>>
>> opal.jobmanager=edu.sdsc.nbcr.opal.manager.DRMAAJobManager
>>
>> The submission to Opal fails with the trace included below. It seems to saying that the SOAP used to describe the job is malformed, but I'm not sure why it would work with one job manager but not another.
>>
>> Jan 23, 2015 9:01:59 AM org.apache.catalina.core.StandardWrapperValve invoke
>> SEVERE: Servlet.service() for servlet [SubmitMemeJob] in context with path [] threw exception
>> AxisFault
>> faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException
>> faultSubcode:
>> faultString: java.lang.reflect.InvocationTargetException
>> faultActor:
>> faultNode:
>> faultDetail:
>>        {http://xml.apache.org/axis/}hostname:master
>>
>> java.lang.reflect.InvocationTargetException
>>        at org.apache.axis.message.SOAPFaultBuilder.createFault(SOAPFaultBuilder.java:221)
>>        at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:128)
>>        at org.apache.axis.encoding.DeserializationContext.endElement(DeserializationContext.java:1087)
>>        at com.sun.org.apache.xerces.internal.parsers.AbstractSAXParser.endElement(AbstractSAXParser.java:609)
>>        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanEndElement(XMLDocumentFragmentScannerImpl.java:1781)
>>        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl$FragmentContentDriver.next(XMLDocumentFragmentScannerImpl.java:2957)
>>        at com.sun.org.apache.xerces.internal.impl.XMLDocumentScannerImpl.next(XMLDocumentScannerImpl.java:606)
>>        at com.sun.org.apache.xerces.internal.impl.XMLNSDocumentScannerImpl.next(XMLNSDocumentScannerImpl.java:117)
>>        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanDocument(XMLDocumentFragmentScannerImpl.java:510)
>>        at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:848)
>>        at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:777)
>>        at com.sun.org.apache.xerces.internal.parsers.XMLParser.parse(XMLParser.java:141)
>>        at com.sun.org.apache.xerces.internal.parsers.AbstractSAXParser.parse(AbstractSAXParser.java:1213)
>>        at com.sun.org.apache.xerces.internal.jaxp.SAXParserImpl$JAXPSAXParser.parse(SAXParserImpl.java:649)
>>        at com.sun.org.apache.xerces.internal.jaxp.SAXParserImpl.parse(SAXParserImpl.java:333)
>>        at org.apache.axis.encoding.DeserializationContext.parse(DeserializationContext.java:227)
>>        at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:696)
>>        at org.apache.axis.Message.getSOAPEnvelope(Message.java:424)
>>        at org.apache.axis.handlers.soap.MustUnderstandChecker.invoke(MustUnderstandChecker.java:62)
>>        at org.apache.axis.client.AxisClient.invoke(AxisClient.java:206)
>>        at org.apache.axis.client.Call.invokeEngine(Call.java:2765)
>>        at org.apache.axis.client.Call.invoke(Call.java:2748)
>>        at org.apache.axis.client.Call.invoke(Call.java:2424)
>>        at org.apache.axis.client.Call.invoke(Call.java:2347)
>>        at org.apache.axis.client.Call.invoke(Call.java:1804)
>>        at edu.sdsc.nbcr.opal.AppServicePortTypeSoapBindingStub.launchJob(AppServicePortTypeSoapBindingStub.java:624)
>>        at au.edu.uq.imb.memesuite.servlet.SubmitJob.submitOpalJob(SubmitJob.java:655)
>>        at au.edu.uq.imb.memesuite.servlet.SubmitJob.doPost(SubmitJob.java:699)
>>        at javax.servlet.http.HttpServlet.service(HttpServlet.java:646)
>>        at javax.servlet.http.HttpServlet.service(HttpServlet.java:727)
>>        at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:303)
>>        at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:208)
>>        at org.apache.tomcat.websocket.server.WsFilter.doFilter(WsFilter.java:52)
>>        at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:241)
>>        at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:208)
>>        at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:220)
>>        at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:122)
>>        at org.apache.catalina.authenticator.AuthenticatorBase.invoke(AuthenticatorBase.java:503)
>>        at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:170)
>>        at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:103)
>>        at org.apache.catalina.valves.AccessLogValve.invoke(AccessLogValve.java:950)
>>        at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:116)
>>        at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:421)
>>        at org.apache.coyote.http11.AbstractHttp11Processor.process(AbstractHttp11Processor.java:1070)
>>        at org.apache.coyote.AbstractProtocol$AbstractConnectionHandler.process(AbstractProtocol.java:611)
>>        at org.apache.tomcat.util.net.JIoEndpoint$SocketProcessor.run(JIoEndpoint.java:316)
>>        at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
>>        at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
>>        at org.apache.tomcat.util.threads.TaskThread$WrappingRunnable.run(TaskThread.java:61)
>>        at java.lang.Thread.run(Thread.java:744)
>>
>>
>>
>>
>> ------------------------------------------------------------------------------
>> New Year. New Location. New Benefits. New Data Center in Ashburn, VA.
>> GigeNET is offering a free month of service with a new server in Ashburn.
>> Choose from 2 high performing configs, both with 100TB of bandwidth.
>> Higher redundancy.Lower latency.Increased capacity.Completely compliant.
>> http://p.sf.net/sfu/gigenet
>> _______________________________________________
>> Opaltoolkit-users mailing list
>> Opa...@li...
>> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users
>
> Nadya Williams                 University of California, San Diego
> na...@sd...             9500 Gilman Dr. MC 0444
> +1 858 534 1820 (ofc)      La Jolla, CA 92093-0444
> +1 858 822 1619 (fax)      USA
>
>
>
>
> ------------------------------------------------------------------------------
> New Year. New Location. New Benefits. New Data Center in Ashburn, VA.
> GigeNET is offering a free month of service with a new server in Ashburn.
> Choose from 2 high performing configs, both with 100TB of bandwidth.
> Higher redundancy.Lower latency.Increased capacity.Completely compliant.
> http://p.sf.net/sfu/gigenet
> _______________________________________________
> Opaltoolkit-users mailing list
> Opa...@li...
> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users

Re: [Opaltoolkit-users] DRMAA failure on SGE (Starcluster)

[nadya w. <na...@sd...>]

HI Charles,

can you submit and execute jobs successfully outside of opal using age submission?
If not, first need to make sure that your age configuration is correct. 

If yes, check  how is the opal-jobs/ created.
This directory needs to be NFS-mounted on all the nodes from the fronted (or opal server)
node of the cluster. For example, 
	/opt/tomcat/webapps/opal-jobs -> /share/opal/opal-jobs
And /share/opal/opal-jobs is NFS mounted.

Check your in opal.properties:
	tomcat.url  - FQDN of your  cluster fronted
	drmaa.queue - set to your default SGE queue
	drmaa.pe - set to parallel environment of your SGe configuration

Are you running on ec2? 
The starcluster is not the same “cluster" as we have in rocks. It is a group of VMs,
and in rocks we have a computing cluster. I don’t know how the SGE configuration and
inter-node communication is handled. 
My guess would be if the SGE is working from the command line and SGE obs are running
correctly, then the opal configuration should just follow your SGE specifics and the above 4  variables
should take care of it. 

Nadya



> On Jan 23, 2015, at 1:36 AM, Charles Grant <ce...@uw...> wrote:
> 
> Hi,
> 
> I'm trying to configure Opal to use the DRMAA job manager on an SGE cluster (2011.11) configured using Starcluster.
> 
> We're running Tomcat 7.0.57. Our application uses the Opal Java API. I can submit jobs to the cluster using the command line, and my Opal installation works fine if I have
> 
> opal.jobmanager=edu.sdsc.nbcr.opal.manager.ForkJobManager 
> 
> But if I use 
> 
> opal.jobmanager=edu.sdsc.nbcr.opal.manager.DRMAAJobManager
> 
> The submission to Opal fails with the trace included below. It seems to saying that the SOAP used to describe the job is malformed, but I'm not sure why it would work with one job manager but not another.
> 
> Jan 23, 2015 9:01:59 AM org.apache.catalina.core.StandardWrapperValve invoke
> SEVERE: Servlet.service() for servlet [SubmitMemeJob] in context with path [] threw exception
> AxisFault
> faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException
> faultSubcode:
> faultString: java.lang.reflect.InvocationTargetException
> faultActor:
> faultNode:
> faultDetail:
>        {http://xml.apache.org/axis/}hostname:master
> 
> java.lang.reflect.InvocationTargetException
>        at org.apache.axis.message.SOAPFaultBuilder.createFault(SOAPFaultBuilder.java:221)
>        at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:128)
>        at org.apache.axis.encoding.DeserializationContext.endElement(DeserializationContext.java:1087)
>        at com.sun.org.apache.xerces.internal.parsers.AbstractSAXParser.endElement(AbstractSAXParser.java:609)
>        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanEndElement(XMLDocumentFragmentScannerImpl.java:1781)
>        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl$FragmentContentDriver.next(XMLDocumentFragmentScannerImpl.java:2957)
>        at com.sun.org.apache.xerces.internal.impl.XMLDocumentScannerImpl.next(XMLDocumentScannerImpl.java:606)
>        at com.sun.org.apache.xerces.internal.impl.XMLNSDocumentScannerImpl.next(XMLNSDocumentScannerImpl.java:117)
>        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanDocument(XMLDocumentFragmentScannerImpl.java:510)
>        at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:848)
>        at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:777)
>        at com.sun.org.apache.xerces.internal.parsers.XMLParser.parse(XMLParser.java:141)
>        at com.sun.org.apache.xerces.internal.parsers.AbstractSAXParser.parse(AbstractSAXParser.java:1213)
>        at com.sun.org.apache.xerces.internal.jaxp.SAXParserImpl$JAXPSAXParser.parse(SAXParserImpl.java:649)
>        at com.sun.org.apache.xerces.internal.jaxp.SAXParserImpl.parse(SAXParserImpl.java:333)
>        at org.apache.axis.encoding.DeserializationContext.parse(DeserializationContext.java:227)
>        at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:696)
>        at org.apache.axis.Message.getSOAPEnvelope(Message.java:424)
>        at org.apache.axis.handlers.soap.MustUnderstandChecker.invoke(MustUnderstandChecker.java:62)
>        at org.apache.axis.client.AxisClient.invoke(AxisClient.java:206)
>        at org.apache.axis.client.Call.invokeEngine(Call.java:2765)
>        at org.apache.axis.client.Call.invoke(Call.java:2748)
>        at org.apache.axis.client.Call.invoke(Call.java:2424)
>        at org.apache.axis.client.Call.invoke(Call.java:2347)
>        at org.apache.axis.client.Call.invoke(Call.java:1804)
>        at edu.sdsc.nbcr.opal.AppServicePortTypeSoapBindingStub.launchJob(AppServicePortTypeSoapBindingStub.java:624)
>        at au.edu.uq.imb.memesuite.servlet.SubmitJob.submitOpalJob(SubmitJob.java:655)
>        at au.edu.uq.imb.memesuite.servlet.SubmitJob.doPost(SubmitJob.java:699)
>        at javax.servlet.http.HttpServlet.service(HttpServlet.java:646)
>        at javax.servlet.http.HttpServlet.service(HttpServlet.java:727)
>        at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:303)
>        at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:208)
>        at org.apache.tomcat.websocket.server.WsFilter.doFilter(WsFilter.java:52)
>        at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:241)
>        at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:208)
>        at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:220)
>        at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:122)
>        at org.apache.catalina.authenticator.AuthenticatorBase.invoke(AuthenticatorBase.java:503)
>        at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:170)
>        at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:103)
>        at org.apache.catalina.valves.AccessLogValve.invoke(AccessLogValve.java:950)
>        at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:116)
>        at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:421)
>        at org.apache.coyote.http11.AbstractHttp11Processor.process(AbstractHttp11Processor.java:1070)
>        at org.apache.coyote.AbstractProtocol$AbstractConnectionHandler.process(AbstractProtocol.java:611)
>        at org.apache.tomcat.util.net.JIoEndpoint$SocketProcessor.run(JIoEndpoint.java:316)
>        at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
>        at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
>        at org.apache.tomcat.util.threads.TaskThread$WrappingRunnable.run(TaskThread.java:61)
>        at java.lang.Thread.run(Thread.java:744)
> 
> 
> 
> 
> ------------------------------------------------------------------------------
> New Year. New Location. New Benefits. New Data Center in Ashburn, VA.
> GigeNET is offering a free month of service with a new server in Ashburn.
> Choose from 2 high performing configs, both with 100TB of bandwidth.
> Higher redundancy.Lower latency.Increased capacity.Completely compliant.
> http://p.sf.net/sfu/gigenet
> _______________________________________________
> Opaltoolkit-users mailing list
> Opa...@li...
> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users

Nadya Williams                 University of California, San Diego
na...@sd...             9500 Gilman Dr. MC 0444
+1 858 534 1820 (ofc)      La Jolla, CA 92093-0444
+1 858 822 1619 (fax)      USA

[Opaltoolkit-users] DRMAA failure on SGE (Starcluster)

[Charles G. <ce...@uw...>]

Hi,

I'm trying to configure Opal to use the DRMAA job manager on an SGE cluster (2011.11) configured using Starcluster.

We're running Tomcat 7.0.57. Our application uses the Opal Java API. I can submit jobs to the cluster using the command line, and my Opal installation works fine if I have

opal.jobmanager=edu.sdsc.nbcr.opal.manager.ForkJobManager 

But if I use 

opal.jobmanager=edu.sdsc.nbcr.opal.manager.DRMAAJobManager

The submission to Opal fails with the trace included below. It seems to saying that the SOAP used to describe the job is malformed, but I'm not sure why it would work with one job manager but not another.

Jan 23, 2015 9:01:59 AM org.apache.catalina.core.StandardWrapperValve invoke
SEVERE: Servlet.service() for servlet [SubmitMemeJob] in context with path [] threw exception
AxisFault
 faultCode: {http://schemas.xmlsoap.org/soap/envelope/}Server.userException
 faultSubcode:
 faultString: java.lang.reflect.InvocationTargetException
 faultActor:
 faultNode:
 faultDetail:
        {http://xml.apache.org/axis/}hostname:master

java.lang.reflect.InvocationTargetException
        at org.apache.axis.message.SOAPFaultBuilder.createFault(SOAPFaultBuilder.java:221)
        at org.apache.axis.message.SOAPFaultBuilder.endElement(SOAPFaultBuilder.java:128)
        at org.apache.axis.encoding.DeserializationContext.endElement(DeserializationContext.java:1087)
        at com.sun.org.apache.xerces.internal.parsers.AbstractSAXParser.endElement(AbstractSAXParser.java:609)
        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanEndElement(XMLDocumentFragmentScannerImpl.java:1781)
        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl$FragmentContentDriver.next(XMLDocumentFragmentScannerImpl.java:2957)
        at com.sun.org.apache.xerces.internal.impl.XMLDocumentScannerImpl.next(XMLDocumentScannerImpl.java:606)
        at com.sun.org.apache.xerces.internal.impl.XMLNSDocumentScannerImpl.next(XMLNSDocumentScannerImpl.java:117)
        at com.sun.org.apache.xerces.internal.impl.XMLDocumentFragmentScannerImpl.scanDocument(XMLDocumentFragmentScannerImpl.java:510)
        at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:848)
        at com.sun.org.apache.xerces.internal.parsers.XML11Configuration.parse(XML11Configuration.java:777)
        at com.sun.org.apache.xerces.internal.parsers.XMLParser.parse(XMLParser.java:141)
        at com.sun.org.apache.xerces.internal.parsers.AbstractSAXParser.parse(AbstractSAXParser.java:1213)
        at com.sun.org.apache.xerces.internal.jaxp.SAXParserImpl$JAXPSAXParser.parse(SAXParserImpl.java:649)
        at com.sun.org.apache.xerces.internal.jaxp.SAXParserImpl.parse(SAXParserImpl.java:333)
        at org.apache.axis.encoding.DeserializationContext.parse(DeserializationContext.java:227)
        at org.apache.axis.SOAPPart.getAsSOAPEnvelope(SOAPPart.java:696)
        at org.apache.axis.Message.getSOAPEnvelope(Message.java:424)
        at org.apache.axis.handlers.soap.MustUnderstandChecker.invoke(MustUnderstandChecker.java:62)
        at org.apache.axis.client.AxisClient.invoke(AxisClient.java:206)
        at org.apache.axis.client.Call.invokeEngine(Call.java:2765)
        at org.apache.axis.client.Call.invoke(Call.java:2748)
        at org.apache.axis.client.Call.invoke(Call.java:2424)
        at org.apache.axis.client.Call.invoke(Call.java:2347)
        at org.apache.axis.client.Call.invoke(Call.java:1804)
        at edu.sdsc.nbcr.opal.AppServicePortTypeSoapBindingStub.launchJob(AppServicePortTypeSoapBindingStub.java:624)
        at au.edu.uq.imb.memesuite.servlet.SubmitJob.submitOpalJob(SubmitJob.java:655)
        at au.edu.uq.imb.memesuite.servlet.SubmitJob.doPost(SubmitJob.java:699)
        at javax.servlet.http.HttpServlet.service(HttpServlet.java:646)
        at javax.servlet.http.HttpServlet.service(HttpServlet.java:727)
        at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:303)
        at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:208)
        at org.apache.tomcat.websocket.server.WsFilter.doFilter(WsFilter.java:52)
        at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:241)
        at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:208)
        at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:220)
        at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:122)
        at org.apache.catalina.authenticator.AuthenticatorBase.invoke(AuthenticatorBase.java:503)
        at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:170)
        at org.apache.catalina.valves.ErrorReportValve.invoke(ErrorReportValve.java:103)
        at org.apache.catalina.valves.AccessLogValve.invoke(AccessLogValve.java:950)
        at org.apache.catalina.core.StandardEngineValve.invoke(StandardEngineValve.java:116)
        at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:421)
        at org.apache.coyote.http11.AbstractHttp11Processor.process(AbstractHttp11Processor.java:1070)
        at org.apache.coyote.AbstractProtocol$AbstractConnectionHandler.process(AbstractProtocol.java:611)
        at org.apache.tomcat.util.net.JIoEndpoint$SocketProcessor.run(JIoEndpoint.java:316)
        at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
        at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
        at org.apache.tomcat.util.threads.TaskThread$WrappingRunnable.run(TaskThread.java:61)
        at java.lang.Thread.run(Thread.java:744)


                                                                                                                                                                                                                        

Re: [Opaltoolkit-users] Troubles setting up the opal server (services run, but can't get the results)

[Luca C. <luc...@gm...>]

On Thu, Apr 17, 2014 at 11:16 AM, Jacob Durrant <jac...@gm...> wrote:
> I'm interested in developing some opal services and so am trying to set up a
> "toy" opal server on my local computer. I'm having trouble accessing and
> downloading the results. Here are the steps I've followed (probably more
> detail than you need!):
>
> 1) Downloaded tomcat 8.0.5, got it working.
>
> 2) Downloaded opal 2.5.
>
> 3) Edited $OPAL_HOME/etc/opal.properties. Uncommented the
> "working.dir=opal-jobs" line, otherwise left the file the same.
>
> 4) Made no changes to $OPAL_HOME/etc/opal.xml
>
> 5) Ran the following commands:
>
> cp $OPAL_HOME/etc/opal.xml $CATALINA_HOME/conf/Catalina/localhost/
> cd $CATALINA_HOME/webapps
> mkdir /scratch/opal-jobs
> ln -s /scratch/opal-jobs opal-jobs
>
> 6) Edited $OPAL_HOME/build.properties. Changed line: catalina.home =
> /scratch/Programs/apache-tomcat-8.0.5
>

We don't support tomcat 8
:-(

I have never tested it. Maybe it will work...
I did test both tomcat 6 and tomcat 7 series.

See the prerequisite:
http://nbcr.ucsd.edu/data/docs/opal/docs/2.X/serverprerequisites.html


> 7) From the opal-ws-2.5 directory, ran: ant install (BUILD SUCCESSFUL)
>
> 8) Added this line to my .bashrc: export
> JAVA_OPTS="-Djava.awt.headless=true"
>
> 9) Started tomcat and visited localhost:8080/opal2/happyaxis.jsp:
>
> =====================
>
> Needed Components
>
> Found SAAJ API ( javax.xml.soap.SOAPMessage ) at an unknown location
>
> Found JAX-RPC API ( javax.xml.rpc.Service ) at
> /scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/jaxrpc.jar
>
> Found Apache-Axis ( org.apache.axis.transport.http.AxisServlet ) at
> /scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/axis.jar
>
> Found Jakarta-Commons Discovery ( org.apache.commons.discovery.Resource ) at
> /scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/commons-discovery-0.2.jar
>
> Found Jakarta-Commons Logging ( org.apache.commons.logging.Log ) at
> /scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/commons-logging-1.0.4.jar
>
> Found Log4j ( org.apache.log4j.Layout ) at
> /scratch/Programs/apache-tomcat-8.0.5/lib/log4j-1.2.15.jar
>
> Found IBM's WSDL4Java ( com.ibm.wsdl.factory.WSDLFactoryImpl ) at
> /scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/wsdl4j-1.5.1.jar
>
> Found JAXP implementation ( javax.xml.parsers.SAXParserFactory ) at an
> unknown location
>
> Found Activation API ( javax.activation.DataHandler ) at an unknown location
>
> =====================
>
> 10) Copied the following toy opal XML file I made to $CATALINA_HOME/deploy:
>
> <appConfig xmlns="http://nbcr.sdsc.edu/opal/types"
>            xmlns:xsd="http://www.w3.org/2001/XMLSchema">
>   <metadata appName="parrot">
>     <usage>Here's some usage</usage>
>     <info>Some info, dude.</info>
>     <types>
>       <untaggedParams>
>         <param>
>           <id>text</id>
>           <paramType>STRING</paramType>
>           <ioType>INPUT</ioType>
>           <textDesc>Here's what will be parroted.</textDesc>
>         </param>
>       </untaggedParams>
>     </types>
>   </metadata>
>   <binaryLocation>/bin/echo</binaryLocation>
>   <defaultArgs></defaultArgs>
>   <jobManagerFQCN>edu.sdsc.nbcr.opal.manager.ForkJobManager</jobManagerFQCN>
>   <parallel>false</parallel>
> </appConfig>
>
> 11) The new service didn't appear at
> http://10.0.0.9:8080/opal2/dashboard?command=serviceList. I noticed that
> tomcat kept creating a directory at $CATALINA_HOME/deploy/deploy/. I moved
> my xml file there, and it did show up in the opal dashboard.

That's awkward.....
That should be the value you have in your
$OAPL_HOME/etc/opal.properties at the property called
opal.deploy.path.

I would recommend to put there an absolute path if you can.

PS: if you change that file remeber to re-run the "ant install".

> 12) To test the new opal app, I filled out the web form at
> http://localhost:8080/opal2/CreateSubmissionForm.do?serviceURL=http://localhost:8080/opal2/services%2Ftestit
>
> 13) Got an execution complete message and clicked on the URL:
> http://localhost:8080/opal-jobs/apptestit1397756530532282548322
>
> 14) Clicking there gives the following error message:
>
> =====================
>
> HTTP Status 404 - /opal-jobs/apptestit1397756530532282548322/
>
> type Status report
>
> message /opal-jobs/apptestit1397756530532282548322/
>
> description The requested resource is not available.
>
> Apache Tomcat/8.0.5
>
> =====================
>
> 15) Investigated further, discover that my job was correcty saved to
> $CATALINA_HOME/webapps/opal-jobs/apptestit1397756530532282548322
>
> 16) Discovered that the address
> http://localhost:8080/opal-jobs/apptestit1397756762073676906347/stdout.txt
> does in fact contain my output.
>
> 17) To see if this is just a web-interface problem, tried to access the opal
> service programatically using your python client. It didn't download the
> requested files. The url provided gave the same error when visited:
> http://localhost:8080/opal-jobs/apptestit1397757356922-550301932/. But
> http://localhost:8080/opal-jobs/apptestit1397757356922-550301932/stdout.txt
> did contain the results submitted programatically. Note that I do not have
> this problem when I submit opal jobs programatically to services deployed at
> nbcr-222.ucsd.edu.
>
> So the problem seems to be with access, not with actually launching the job.
> Can you tell me how best to fix this so I can begin developing and testing
> my own Opal services locally?

Sorry my bad.
:-(

You have to turn on the directory listing.

Check out in the documentation the bullet number 7:
http://nbcr.ucsd.edu/data/docs/opal/docs/2.X/serverinstall.html

It says "If you are using Tomcat 5.5.X" which is not true.
You have to turn it on with tomcat 6 and tomcat 7 as well, I will fix it.
Thanks for reporting it.

Let me know if you have any other problem,
Luca

[Opaltoolkit-users] Troubles setting up the opal server (services run, but can't get the results)

[Jacob D. <jac...@gm...>]

I'm interested in developing some opal services and so am trying to set up
a "toy" opal server on my local computer. I'm having trouble accessing and
downloading the results. Here are the steps I've followed (probably more
detail than you need!):

1) Downloaded tomcat 8.0.5, got it working.

2) Downloaded opal 2.5.

3) Edited $OPAL_HOME/etc/opal.properties. Uncommented the
"working.dir=opal-jobs" line, otherwise left the file the same.

4) Made no changes to $OPAL_HOME/etc/opal.xml

5) Ran the following commands:

cp $OPAL_HOME/etc/opal.xml $CATALINA_HOME/conf/Catalina/localhost/
cd $CATALINA_HOME/webapps
mkdir /scratch/opal-jobs
ln -s /scratch/opal-jobs opal-jobs

6) Edited $OPAL_HOME/build.properties. Changed line: catalina.home =
/scratch/Programs/apache-tomcat-8.0.5

7) From the opal-ws-2.5 directory, ran: ant install (BUILD SUCCESSFUL)

8) Added this line to my .bashrc: export
JAVA_OPTS="-Djava.awt.headless=true"

9) Started tomcat and visited localhost:8080/opal2/happyaxis.jsp:

=====================

Needed Components

Found SAAJ API ( javax.xml.soap.SOAPMessage ) at an unknown location

Found JAX-RPC API ( javax.xml.rpc.Service ) at
/scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/jaxrpc.jar

Found Apache-Axis ( org.apache.axis.transport.http.AxisServlet ) at
/scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/axis.jar

Found Jakarta-Commons Discovery ( org.apache.commons.discovery.Resource )
at
/scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/commons-discovery-0.2.jar

Found Jakarta-Commons Logging ( org.apache.commons.logging.Log ) at
/scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/commons-logging-1.0.4.jar

Found Log4j ( org.apache.log4j.Layout ) at
/scratch/Programs/apache-tomcat-8.0.5/lib/log4j-1.2.15.jar

Found IBM's WSDL4Java ( com.ibm.wsdl.factory.WSDLFactoryImpl ) at
/scratch/Programs/apache-tomcat-8.0.5/webapps/opal2/WEB-INF/lib/wsdl4j-1.5.1.jar

Found JAXP implementation ( javax.xml.parsers.SAXParserFactory ) at an
unknown location

Found Activation API ( javax.activation.DataHandler ) at an unknown location

=====================

10) Copied the following toy opal XML file I made to $CATALINA_HOME/deploy:

<appConfig xmlns="http://nbcr.sdsc.edu/opal/types"
           xmlns:xsd="http://www.w3.org/2001/XMLSchema">
  <metadata appName="parrot">
    <usage>Here's some usage</usage>
    <info>Some info, dude.</info>
    <types>
      <untaggedParams>
        <param>
          <id>text</id>
          <paramType>STRING</paramType>
          <ioType>INPUT</ioType>
          <textDesc>Here's what will be parroted.</textDesc>
        </param>
      </untaggedParams>
    </types>
  </metadata>
  <binaryLocation>/bin/echo</binaryLocation>
  <defaultArgs></defaultArgs>

<jobManagerFQCN>edu.sdsc.nbcr.opal.manager.ForkJobManager</jobManagerFQCN>
  <parallel>false</parallel>
</appConfig>

11) The new service didn't appear at
http://10.0.0.9:8080/opal2/dashboard?command=serviceList. I noticed that
tomcat kept creating a directory at $CATALINA_HOME/deploy/deploy/. I moved
my xml file there, and it did show up in the opal dashboard.

12) To test the new opal app, I filled out the web form at
http://localhost:8080/opal2/CreateSubmissionForm.do?serviceURL=http://localhost:8080/opal2/services%2Ftestit

13) Got an execution complete message and clicked on the URL:
http://localhost:8080/opal-jobs/apptestit1397756530532282548322

14) Clicking there gives the following error message:

=====================

HTTP Status 404 - /opal-jobs/apptestit1397756530532282548322/

type Status report

message /opal-jobs/apptestit1397756530532282548322/

description The requested resource is not available.

Apache Tomcat/8.0.5

=====================

15) Investigated further, discover that my job was correcty saved to
$CATALINA_HOME/webapps/opal-jobs/apptestit1397756530532282548322

16) Discovered that the address
http://localhost:8080/opal-jobs/apptestit1397756762073676906347/stdout.txtdoes
in fact contain my output.

17) To see if this is just a web-interface problem, tried to access the
opal service programatically using your python client. It didn't download
the requested files. The url provided gave the same error when visited:
http://localhost:8080/opal-jobs/apptestit1397757356922-550301932/. But
http://localhost:8080/opal-jobs/apptestit1397757356922-550301932/stdout.txtdid
contain the results submitted programatically. Note that I do not have
this problem when I submit opal jobs programatically to services deployed
at nbcr-222.ucsd.edu.

So the problem seems to be with access, not with actually launching the
job. Can you tell me how best to fix this so I can begin developing and
testing my own Opal services locally?

Thanks for your help.

[Opaltoolkit-users] Opal 2.5 release

[Luca C. <luc...@gm...>]

We are pleased to announce the release of version 2.5 of the Opal Toolkit.

New features in the 2.5 release of Opal include:

- New service deployment model based on dropping appConfig files in
  opal.deploy.path (no more ant command to deploy services)
- Support for tomcat 7.X, and tomcat 6.X
- Cleaner logging with few messages to the default level
- Improved Usage Statistics page layout
- Improvements to Condor job manager
- Extra config parameters for PBS job manager
- Removed support for globus GRAM
- Several fixes to the userdocs

Opal 2.5 can be downloaded from here:
https://sourceforge.net/projects/opaltoolkit/files/

A special thanks to the UCSF Chimera group (Conrad Huang) for beta
testing the new release.

Sincerely,
Opal Team

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Conrad H. <co...@cg...>]

On 1/16/2014 12:39 PM, Luca Clementi wrote:
> On Thu, Jan 16, 2014 at 9:23 AM, Conrad Huang <co...@cg...> wrote:
>> On 1/15/2014 6:14 PM, Luca Clementi wrote:
>
> [...]
>
>>>
>>> I just push a minor fix for this specific problem. If you pull and
>>> re-install it should get fixed.
>>> I don't really like this solution since it uses an hard coded URL
>>> ("http://localhost:8080/opal2/services") but for the moment it should
>>> be ok, since that URL is also used in other opal components (at least
>>> they will all break consistently if you shut down port 8080 :-) ).
>>>
>>> Are you trying to run multiple tomcats?
>>> I fear it might not work (we never tested that configuration).
>>> Consider that the deployment "configuration" of AXIS is saved in
>>> webapps/opal2/WEB-INF/server-config.wsdd I don't know how that file
>>> can be push to the other instances of tomcat.
>>>
>>>
>>> Luca
>>
>>
>> It got farther, but ran into a similar problem (catalina.out is attached).
>> It started deploying the services, but ran into the same permission problem
>> of "Rejected remote access from host /169.230.27.26" for each service that
>> it tried to deploy.
>>
>
> That's why I didn't like my previous fix. :-(
>
> With a little more time, I crafted a patch which should fix both
> problems and has a much nicer approach.
>
>> We're not trying to run multiple tomcat instances (yet).  We just want to
>> have an Apache instance as the main interface for webservices.rbvi.ucsf.edu
>> because we expect to run other CGI-type services as well and want to use the
>> same umbrella host name.
>>
>
> OK that must work.
>
> Thanks again for you very helpful testing.
>
> Luca
>

Yes!  It's working!

Thank you so much for not only getting it to work, but so very quickly.

Conrad

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Luca C. <luc...@gm...>]

On Thu, Jan 16, 2014 at 9:23 AM, Conrad Huang <co...@cg...> wrote:
> On 1/15/2014 6:14 PM, Luca Clementi wrote:

[...]

>>
>> I just push a minor fix for this specific problem. If you pull and
>> re-install it should get fixed.
>> I don't really like this solution since it uses an hard coded URL
>> ("http://localhost:8080/opal2/services") but for the moment it should
>> be ok, since that URL is also used in other opal components (at least
>> they will all break consistently if you shut down port 8080 :-) ).
>>
>> Are you trying to run multiple tomcats?
>> I fear it might not work (we never tested that configuration).
>> Consider that the deployment "configuration" of AXIS is saved in
>> webapps/opal2/WEB-INF/server-config.wsdd I don't know how that file
>> can be push to the other instances of tomcat.
>>
>>
>> Luca
>
>
> It got farther, but ran into a similar problem (catalina.out is attached).
> It started deploying the services, but ran into the same permission problem
> of "Rejected remote access from host /169.230.27.26" for each service that
> it tried to deploy.
>

That's why I didn't like my previous fix. :-(

With a little more time, I crafted a patch which should fix both
problems and has a much nicer approach.

> We're not trying to run multiple tomcat instances (yet).  We just want to
> have an Apache instance as the main interface for webservices.rbvi.ucsf.edu
> because we expect to run other CGI-type services as well and want to use the
> same umbrella host name.
>

OK that must work.

Thanks again for you very helpful testing.

Luca

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Conrad H. <co...@cg...>]

On 1/15/2014 6:14 PM, Luca Clementi wrote:
> On Wed, Jan 15, 2014 at 3:01 PM, Conrad Huang <co...@cg...> wrote:
>> Opal is now working fine for me with tomcat6 when I run it on a single host.
>> My next step is to turn it into a cluster service (Redhat Enterprise Linux 6
>> clustering).  Using the exact same Opal configuration except changing:
>>      tomcat.url=http://crick.cgl.ucsf.edu:8080
>> to
>>      tomcat.url=http://webservices.rbvi.ucsf.edu
>> in etc/opal.properties, I get the error message in the attached catalina.out
>> file.
>>
>> It appears to be a permissions problem, and I have a guess at what it might
>> be.  webservices.rbvi.ucsf.edu:80 is actually an Apache instance configured
>> to forward requests to opal2/* to tomcat.  I'm guessing that somehow the
>> opal/tomcat instance can tell whether the deployment request came from
>> itself.  In the crick:8080 case, it did, and everything worked; in the
>> webservices:80 case, it did not, and resulted in the rejection.  What I do
>> not know is where this permission check occurs (in tomcat or opal).  A
>> couple hours of research suggested that I need to have a
>>      <Valve className="org.apache.catalina.valves.RemoteAddrValve" ...
>> statement somewhere, but I really do not know tomcat or opal well enough to
>> figure it out.
>>
>
> I just push a minor fix for this specific problem. If you pull and
> re-install it should get fixed.
> I don't really like this solution since it uses an hard coded URL
> ("http://localhost:8080/opal2/services") but for the moment it should
> be ok, since that URL is also used in other opal components (at least
> they will all break consistently if you shut down port 8080 :-) ).
>
> Are you trying to run multiple tomcats?
> I fear it might not work (we never tested that configuration).
> Consider that the deployment "configuration" of AXIS is saved in
> webapps/opal2/WEB-INF/server-config.wsdd I don't know how that file
> can be push to the other instances of tomcat.
>
>
> Luca

It got farther, but ran into a similar problem (catalina.out is 
attached).  It started deploying the services, but ran into the same 
permission problem of "Rejected remote access from host /169.230.27.26" 
for each service that it tried to deploy.

We're not trying to run multiple tomcat instances (yet).  We just want 
to have an Apache instance as the main interface for 
webservices.rbvi.ucsf.edu because we expect to run other CGI-type 
services as well and want to use the same umbrella host name.

Conrad

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Luca C. <luc...@gm...>]

On Wed, Jan 15, 2014 at 3:01 PM, Conrad Huang <co...@cg...> wrote:
> Opal is now working fine for me with tomcat6 when I run it on a single host.
> My next step is to turn it into a cluster service (Redhat Enterprise Linux 6
> clustering).  Using the exact same Opal configuration except changing:
>     tomcat.url=http://crick.cgl.ucsf.edu:8080
> to
>     tomcat.url=http://webservices.rbvi.ucsf.edu
> in etc/opal.properties, I get the error message in the attached catalina.out
> file.
>
> It appears to be a permissions problem, and I have a guess at what it might
> be.  webservices.rbvi.ucsf.edu:80 is actually an Apache instance configured
> to forward requests to opal2/* to tomcat.  I'm guessing that somehow the
> opal/tomcat instance can tell whether the deployment request came from
> itself.  In the crick:8080 case, it did, and everything worked; in the
> webservices:80 case, it did not, and resulted in the rejection.  What I do
> not know is where this permission check occurs (in tomcat or opal).  A
> couple hours of research suggested that I need to have a
>     <Valve className="org.apache.catalina.valves.RemoteAddrValve" ...
> statement somewhere, but I really do not know tomcat or opal well enough to
> figure it out.
>

I just push a minor fix for this specific problem. If you pull and
re-install it should get fixed.
I don't really like this solution since it uses an hard coded URL
("http://localhost:8080/opal2/services") but for the moment it should
be ok, since that URL is also used in other opal components (at least
they will all break consistently if you shut down port 8080 :-) ).

Are you trying to run multiple tomcats?
I fear it might not work (we never tested that configuration).
Consider that the deployment "configuration" of AXIS is saved in
webapps/opal2/WEB-INF/server-config.wsdd I don't know how that file
can be push to the other instances of tomcat.


Luca

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Conrad H. <co...@cg...>]

Opal is now working fine for me with tomcat6 when I run it on a single 
host.  My next step is to turn it into a cluster service (Redhat 
Enterprise Linux 6 clustering).  Using the exact same Opal configuration 
except changing:
     tomcat.url=http://crick.cgl.ucsf.edu:8080
to
     tomcat.url=http://webservices.rbvi.ucsf.edu
in etc/opal.properties, I get the error message in the attached 
catalina.out file.

It appears to be a permissions problem, and I have a guess at what it 
might be.  webservices.rbvi.ucsf.edu:80 is actually an Apache instance 
configured to forward requests to opal2/* to tomcat.  I'm guessing that 
somehow the opal/tomcat instance can tell whether the deployment request 
came from itself.  In the crick:8080 case, it did, and everything 
worked; in the webservices:80 case, it did not, and resulted in the 
rejection.  What I do not know is where this permission check occurs (in 
tomcat or opal).  A couple hours of research suggested that I need to have a
     <Valve className="org.apache.catalina.valves.RemoteAddrValve" ...
statement somewhere, but I really do not know tomcat or opal well enough 
to figure it out.

Any suggestions?

Thanks.

Conrad

On 1/10/2014 12:47 PM, Conrad Huang wrote:
> Ah, that was just stupidity on my part.  I moved tomcat6 and forgot to
> update hibernate-opal.cfg.xml.  Sorry about the silly question.
>
> Conrad
>
> On 1/10/2014 12:34 PM, Luca Clementi wrote:
>> On Fri, Jan 10, 2014 at 12:08 PM, Conrad Huang <co...@cg...> wrote:
>>> Hi, Luca.  Sorry to reopen the thread, but...
>>>
>>> Just to make sure I can reproduce things, I removed everything and started
>>> over.  I changed the tomcat startup script so that tomcat starts in
>>> $CATALINA_HOME.  I reset opal.deploy.path back to simply "deploy" instead of
>>> the absolute path.  I copied the tomcat6 files and reinstalled Opal 2.5.
>>> Unfortunately, when I start tomcat, I'm getting these strange database
>>> timeouts again.  I've attached logs/catalina.out.
>>>
>>> The Opal server does eventually serve up pages.  Service deployment works
>>> (copying file to "deploy" directory makes it show up in dashboard "List of
>>> Application").  Clicking on the dashboard Statistics tab does not work and
>>> generates the errors towards the end of catalina.out.
>>>
>>> Any suggestions?  Thanks.
>>
>>
>> What kind of database are you using?
>> The problem is probably located in your hibernate file:
>> etc/hibernate-opal.cfg.xml
>>
>> You have a communication problem (if you use hsql tomcat probably you
>> can't write to the file in connection.url:
>> <property name="connection.url">jdbc:hsqldb:file:/home/clem/projects/opaltoolkit/apache-tomcat-7.0.27/webapps/opal2/WEB-INF/data/opaldb</property>)
>>
>>
>> Luca
>>
>>
>>
>>> On 1/9/2014 2:36 PM, Conrad Huang wrote:
>>>>
>>>> On 1/9/2014 2:22 PM, Luca Clementi wrote:
>>>>>
>>>>> On Thu, Jan 9, 2014 at 1:45 PM, Conrad Huang <co...@cg...> wrote:
>>>>>>
>>>>>> On 1/9/2014 11:35 AM, Luca Clementi wrote:
>>>>>>>
>>>>>>>
>>>>> [...]
>>>>>>
>>>>>> The debug code clears it up a bit.  Here's the end of catalina.out
>>>>>> (adding
>>>>>> debugging code but leaving deploy as "deploy"):
>>>>>>
>>>>>>> INFO: Server startup in 2609 ms
>>>>>>> 2014-01-09 13:28:08,074 INFO
>>>>>>>
>>>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:160)
>>>>>>> - initDeployServlet: axis URL:
>>>>>>> http://xxx.xxx.ucsf.edu:8080/opal2/servlet/AxisServlet
>>>>>>> 2014-01-09 13:28:08,075 INFO
>>>>>>>
>>>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:161)
>>>>>>> - initDeployServlet: deploy path: deploy
>>>>>>> 2014-01-09 13:28:08,075 INFO
>>>>>>>
>>>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:162)
>>>>>>> - initDeployServlet: deploy path: /var/www/deploy
>>>>>>>
>>>>>>> Exception in thread "OpalDeployer" java.lang.NullPointerException
>>>>>>>             at
>>>>>>>
>>>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:178)
>>>>>>
>>>>>>
>>>>>>
>>>>>> The full deploy path is relative to /var/www, which is the home
>>>>>> directory of
>>>>>> user "apache" which is the account we use for running this instance of
>>>>>> tomcat.  I guess tomcat6 does not change directory from where it was
>>>>>> started
>>>>>> to $CATALINA_HOME.  Our startup script uses "su - apache -c ..." to
>>>>>> start
>>>>>> tomcat, so it starts in ~apache or /var/www. Specifying the full path in
>>>>>> etc/opal.properties makes everything work. I have one service deployed!
>>>>>>
>>>>>
>>>>> That does not make much sense to me :-(
>>>>> It should not use the current working directory (that was my first test).
>>>>> What script do you use to start up tomcat?
>>>>> You should use the $CATALINA_HOME/bin/startup.sh which sets the proper
>>>>> working directory:
>>>>> clem@hermes:~/projects/opaltoolkit$ apache-tomcat-6.0.37/bin/startup.sh
>>>>> Using CATALINA_BASE:
>>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
>>>>> Using CATALINA_HOME:
>>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
>>>>> Using CATALINA_TMPDIR:
>>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/temp
>>>>> Using JRE_HOME:        /usr
>>>>> Using CLASSPATH:
>>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/bootstrap.jar
>>>>>
>>>>> No matter where I start it from....
>>>>> I tried to reproduce your problem but still no luck
>>>>> cd /tmp
>>>>> su - clem -c
>>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/startup.sh
>>>>>
>>>>>
>>>>> Luca
>>>>>
>>>>
>>>> We're on Redhat Enterprise Linux 6.  There is no startup.sh in
>>>> /usr/share/tomcat6/bin.  I copied the startup file from
>>>> /etc/init.d/tomcat6.  In that script it invokes /usr/sbin/tomcat6, which
>>>> ultimately runs java with no intervening chdir:
>>>>
>>>> /usr/lib/jvm/java/bin/java
>>>>
>>>> -Djavax.sql.DataSource.Factory=org.apache.commons.dbcp.BasicDataSourceFactory
>>>> -classpath
>>>>
>>>> :/usr/local/opal-tomcat6/bin/bootstrap.jar:/usr/local/opal-tomcat6/bin/tomcat-juli.jar:/usr/share/java/commons-daemon.jar
>>>> -Dcatalina.base=/usr/local/opal-tomcat6
>>>> -Dcatalina.home=/usr/local/opal-tomcat6 -Djava.endorsed.dirs=
>>>> -Djava.io.tmpdir=/usr/local/opal-tomcat6/temp
>>>>
>>>> -Djava.util.logging.config.file=/usr/local/opal-tomcat6/conf/logging.properties
>>>> -Djava.util.logging.manager=org.apache.juli.ClassLoaderLogManager
>>>> org.apache.catalina.startup.Bootstrap start
>>>>
>>>> Conrad
>>>>
>>>>
>>>> ------------------------------------------------------------------------------
>>>> CenturyLink Cloud: The Leader in Enterprise Cloud Services.
>>>> Learn Why More Businesses Are Choosing CenturyLink Cloud For
>>>> Critical Workloads, Development Environments & Everything In Between.
>>>> Get a Quote or Start a Free Trial Today.
>>>>
>>>> http://pubads.g.doubleclick.net/gampad/clk?id=119420431&iu=/4140/ostg.clktrk
>>>>
>>>> _______________________________________________
>>>> Opaltoolkit-users mailing list
>>>> Opa...@li...
>>>> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users
>>>>
>>>
>
> ------------------------------------------------------------------------------
> CenturyLink Cloud: The Leader in Enterprise Cloud Services.
> Learn Why More Businesses Are Choosing CenturyLink Cloud For
> Critical Workloads, Development Environments & Everything In Between.
> Get a Quote or Start a Free Trial Today.
> http://pubads.g.doubleclick.net/gampad/clk?id=119420431&iu=/4140/ostg.clktrk
> _______________________________________________
> Opaltoolkit-users mailing list
> Opa...@li...
> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users
>

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Conrad H. <co...@cg...>]

Ah, that was just stupidity on my part.  I moved tomcat6 and forgot to 
update hibernate-opal.cfg.xml.  Sorry about the silly question.

Conrad

On 1/10/2014 12:34 PM, Luca Clementi wrote:
> On Fri, Jan 10, 2014 at 12:08 PM, Conrad Huang <co...@cg...> wrote:
>> Hi, Luca.  Sorry to reopen the thread, but...
>>
>> Just to make sure I can reproduce things, I removed everything and started
>> over.  I changed the tomcat startup script so that tomcat starts in
>> $CATALINA_HOME.  I reset opal.deploy.path back to simply "deploy" instead of
>> the absolute path.  I copied the tomcat6 files and reinstalled Opal 2.5.
>> Unfortunately, when I start tomcat, I'm getting these strange database
>> timeouts again.  I've attached logs/catalina.out.
>>
>> The Opal server does eventually serve up pages.  Service deployment works
>> (copying file to "deploy" directory makes it show up in dashboard "List of
>> Application").  Clicking on the dashboard Statistics tab does not work and
>> generates the errors towards the end of catalina.out.
>>
>> Any suggestions?  Thanks.
>
>
> What kind of database are you using?
> The problem is probably located in your hibernate file:
> etc/hibernate-opal.cfg.xml
>
> You have a communication problem (if you use hsql tomcat probably you
> can't write to the file in connection.url:
> <property name="connection.url">jdbc:hsqldb:file:/home/clem/projects/opaltoolkit/apache-tomcat-7.0.27/webapps/opal2/WEB-INF/data/opaldb</property>)
>
>
> Luca
>
>
>
>> On 1/9/2014 2:36 PM, Conrad Huang wrote:
>>>
>>> On 1/9/2014 2:22 PM, Luca Clementi wrote:
>>>>
>>>> On Thu, Jan 9, 2014 at 1:45 PM, Conrad Huang <co...@cg...> wrote:
>>>>>
>>>>> On 1/9/2014 11:35 AM, Luca Clementi wrote:
>>>>>>
>>>>>>
>>>> [...]
>>>>>
>>>>> The debug code clears it up a bit.  Here's the end of catalina.out
>>>>> (adding
>>>>> debugging code but leaving deploy as "deploy"):
>>>>>
>>>>>> INFO: Server startup in 2609 ms
>>>>>> 2014-01-09 13:28:08,074 INFO
>>>>>>
>>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:160)
>>>>>> - initDeployServlet: axis URL:
>>>>>> http://xxx.xxx.ucsf.edu:8080/opal2/servlet/AxisServlet
>>>>>> 2014-01-09 13:28:08,075 INFO
>>>>>>
>>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:161)
>>>>>> - initDeployServlet: deploy path: deploy
>>>>>> 2014-01-09 13:28:08,075 INFO
>>>>>>
>>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:162)
>>>>>> - initDeployServlet: deploy path: /var/www/deploy
>>>>>>
>>>>>> Exception in thread "OpalDeployer" java.lang.NullPointerException
>>>>>>            at
>>>>>>
>>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:178)
>>>>>
>>>>>
>>>>>
>>>>> The full deploy path is relative to /var/www, which is the home
>>>>> directory of
>>>>> user "apache" which is the account we use for running this instance of
>>>>> tomcat.  I guess tomcat6 does not change directory from where it was
>>>>> started
>>>>> to $CATALINA_HOME.  Our startup script uses "su - apache -c ..." to
>>>>> start
>>>>> tomcat, so it starts in ~apache or /var/www. Specifying the full path in
>>>>> etc/opal.properties makes everything work. I have one service deployed!
>>>>>
>>>>
>>>> That does not make much sense to me :-(
>>>> It should not use the current working directory (that was my first test).
>>>> What script do you use to start up tomcat?
>>>> You should use the $CATALINA_HOME/bin/startup.sh which sets the proper
>>>> working directory:
>>>> clem@hermes:~/projects/opaltoolkit$ apache-tomcat-6.0.37/bin/startup.sh
>>>> Using CATALINA_BASE:
>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
>>>> Using CATALINA_HOME:
>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
>>>> Using CATALINA_TMPDIR:
>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/temp
>>>> Using JRE_HOME:        /usr
>>>> Using CLASSPATH:
>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/bootstrap.jar
>>>>
>>>> No matter where I start it from....
>>>> I tried to reproduce your problem but still no luck
>>>> cd /tmp
>>>> su - clem -c
>>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/startup.sh
>>>>
>>>>
>>>> Luca
>>>>
>>>
>>> We're on Redhat Enterprise Linux 6.  There is no startup.sh in
>>> /usr/share/tomcat6/bin.  I copied the startup file from
>>> /etc/init.d/tomcat6.  In that script it invokes /usr/sbin/tomcat6, which
>>> ultimately runs java with no intervening chdir:
>>>
>>> /usr/lib/jvm/java/bin/java
>>>
>>> -Djavax.sql.DataSource.Factory=org.apache.commons.dbcp.BasicDataSourceFactory
>>> -classpath
>>>
>>> :/usr/local/opal-tomcat6/bin/bootstrap.jar:/usr/local/opal-tomcat6/bin/tomcat-juli.jar:/usr/share/java/commons-daemon.jar
>>> -Dcatalina.base=/usr/local/opal-tomcat6
>>> -Dcatalina.home=/usr/local/opal-tomcat6 -Djava.endorsed.dirs=
>>> -Djava.io.tmpdir=/usr/local/opal-tomcat6/temp
>>>
>>> -Djava.util.logging.config.file=/usr/local/opal-tomcat6/conf/logging.properties
>>> -Djava.util.logging.manager=org.apache.juli.ClassLoaderLogManager
>>> org.apache.catalina.startup.Bootstrap start
>>>
>>> Conrad
>>>
>>>
>>> ------------------------------------------------------------------------------
>>> CenturyLink Cloud: The Leader in Enterprise Cloud Services.
>>> Learn Why More Businesses Are Choosing CenturyLink Cloud For
>>> Critical Workloads, Development Environments & Everything In Between.
>>> Get a Quote or Start a Free Trial Today.
>>>
>>> http://pubads.g.doubleclick.net/gampad/clk?id=119420431&iu=/4140/ostg.clktrk
>>>
>>> _______________________________________________
>>> Opaltoolkit-users mailing list
>>> Opa...@li...
>>> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users
>>>
>>

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Luca C. <luc...@gm...>]

On Fri, Jan 10, 2014 at 12:08 PM, Conrad Huang <co...@cg...> wrote:
> Hi, Luca.  Sorry to reopen the thread, but...
>
> Just to make sure I can reproduce things, I removed everything and started
> over.  I changed the tomcat startup script so that tomcat starts in
> $CATALINA_HOME.  I reset opal.deploy.path back to simply "deploy" instead of
> the absolute path.  I copied the tomcat6 files and reinstalled Opal 2.5.
> Unfortunately, when I start tomcat, I'm getting these strange database
> timeouts again.  I've attached logs/catalina.out.
>
> The Opal server does eventually serve up pages.  Service deployment works
> (copying file to "deploy" directory makes it show up in dashboard "List of
> Application").  Clicking on the dashboard Statistics tab does not work and
> generates the errors towards the end of catalina.out.
>
> Any suggestions?  Thanks.


What kind of database are you using?
The problem is probably located in your hibernate file:
etc/hibernate-opal.cfg.xml

You have a communication problem (if you use hsql tomcat probably you
can't write to the file in connection.url:
<property name="connection.url">jdbc:hsqldb:file:/home/clem/projects/opaltoolkit/apache-tomcat-7.0.27/webapps/opal2/WEB-INF/data/opaldb</property>)


Luca



> On 1/9/2014 2:36 PM, Conrad Huang wrote:
>>
>> On 1/9/2014 2:22 PM, Luca Clementi wrote:
>>>
>>> On Thu, Jan 9, 2014 at 1:45 PM, Conrad Huang <co...@cg...> wrote:
>>>>
>>>> On 1/9/2014 11:35 AM, Luca Clementi wrote:
>>>>>
>>>>>
>>> [...]
>>>>
>>>> The debug code clears it up a bit.  Here's the end of catalina.out
>>>> (adding
>>>> debugging code but leaving deploy as "deploy"):
>>>>
>>>>> INFO: Server startup in 2609 ms
>>>>> 2014-01-09 13:28:08,074 INFO
>>>>>
>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:160)
>>>>> - initDeployServlet: axis URL:
>>>>> http://xxx.xxx.ucsf.edu:8080/opal2/servlet/AxisServlet
>>>>> 2014-01-09 13:28:08,075 INFO
>>>>>
>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:161)
>>>>> - initDeployServlet: deploy path: deploy
>>>>> 2014-01-09 13:28:08,075 INFO
>>>>>
>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:162)
>>>>> - initDeployServlet: deploy path: /var/www/deploy
>>>>>
>>>>> Exception in thread "OpalDeployer" java.lang.NullPointerException
>>>>>           at
>>>>>
>>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:178)
>>>>
>>>>
>>>>
>>>> The full deploy path is relative to /var/www, which is the home
>>>> directory of
>>>> user "apache" which is the account we use for running this instance of
>>>> tomcat.  I guess tomcat6 does not change directory from where it was
>>>> started
>>>> to $CATALINA_HOME.  Our startup script uses "su - apache -c ..." to
>>>> start
>>>> tomcat, so it starts in ~apache or /var/www. Specifying the full path in
>>>> etc/opal.properties makes everything work. I have one service deployed!
>>>>
>>>
>>> That does not make much sense to me :-(
>>> It should not use the current working directory (that was my first test).
>>> What script do you use to start up tomcat?
>>> You should use the $CATALINA_HOME/bin/startup.sh which sets the proper
>>> working directory:
>>> clem@hermes:~/projects/opaltoolkit$ apache-tomcat-6.0.37/bin/startup.sh
>>> Using CATALINA_BASE:
>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
>>> Using CATALINA_HOME:
>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
>>> Using CATALINA_TMPDIR:
>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/temp
>>> Using JRE_HOME:        /usr
>>> Using CLASSPATH:
>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/bootstrap.jar
>>>
>>> No matter where I start it from....
>>> I tried to reproduce your problem but still no luck
>>> cd /tmp
>>> su - clem -c
>>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/startup.sh
>>>
>>>
>>> Luca
>>>
>>
>> We're on Redhat Enterprise Linux 6.  There is no startup.sh in
>> /usr/share/tomcat6/bin.  I copied the startup file from
>> /etc/init.d/tomcat6.  In that script it invokes /usr/sbin/tomcat6, which
>> ultimately runs java with no intervening chdir:
>>
>> /usr/lib/jvm/java/bin/java
>>
>> -Djavax.sql.DataSource.Factory=org.apache.commons.dbcp.BasicDataSourceFactory
>> -classpath
>>
>> :/usr/local/opal-tomcat6/bin/bootstrap.jar:/usr/local/opal-tomcat6/bin/tomcat-juli.jar:/usr/share/java/commons-daemon.jar
>> -Dcatalina.base=/usr/local/opal-tomcat6
>> -Dcatalina.home=/usr/local/opal-tomcat6 -Djava.endorsed.dirs=
>> -Djava.io.tmpdir=/usr/local/opal-tomcat6/temp
>>
>> -Djava.util.logging.config.file=/usr/local/opal-tomcat6/conf/logging.properties
>> -Djava.util.logging.manager=org.apache.juli.ClassLoaderLogManager
>> org.apache.catalina.startup.Bootstrap start
>>
>> Conrad
>>
>>
>> ------------------------------------------------------------------------------
>> CenturyLink Cloud: The Leader in Enterprise Cloud Services.
>> Learn Why More Businesses Are Choosing CenturyLink Cloud For
>> Critical Workloads, Development Environments & Everything In Between.
>> Get a Quote or Start a Free Trial Today.
>>
>> http://pubads.g.doubleclick.net/gampad/clk?id=119420431&iu=/4140/ostg.clktrk
>>
>> _______________________________________________
>> Opaltoolkit-users mailing list
>> Opa...@li...
>> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users
>>
>

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Conrad H. <co...@cg...>]

Hi, Luca.  Sorry to reopen the thread, but...

Just to make sure I can reproduce things, I removed everything and 
started over.  I changed the tomcat startup script so that tomcat starts 
in $CATALINA_HOME.  I reset opal.deploy.path back to simply "deploy" 
instead of the absolute path.  I copied the tomcat6 files and 
reinstalled Opal 2.5.  Unfortunately, when I start tomcat, I'm getting 
these strange database timeouts again.  I've attached logs/catalina.out.

The Opal server does eventually serve up pages.  Service deployment 
works (copying file to "deploy" directory makes it show up in dashboard 
"List of Application").  Clicking on the dashboard Statistics tab does 
not work and generates the errors towards the end of catalina.out.

Any suggestions?  Thanks.

Conrad

On 1/9/2014 2:36 PM, Conrad Huang wrote:
> On 1/9/2014 2:22 PM, Luca Clementi wrote:
>> On Thu, Jan 9, 2014 at 1:45 PM, Conrad Huang <co...@cg...> wrote:
>>> On 1/9/2014 11:35 AM, Luca Clementi wrote:
>>>>
>> [...]
>>> The debug code clears it up a bit.  Here's the end of catalina.out (adding
>>> debugging code but leaving deploy as "deploy"):
>>>
>>>> INFO: Server startup in 2609 ms
>>>> 2014-01-09 13:28:08,074 INFO
>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:160)
>>>> - initDeployServlet: axis URL:
>>>> http://xxx.xxx.ucsf.edu:8080/opal2/servlet/AxisServlet
>>>> 2014-01-09 13:28:08,075 INFO
>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:161)
>>>> - initDeployServlet: deploy path: deploy
>>>> 2014-01-09 13:28:08,075 INFO
>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:162)
>>>> - initDeployServlet: deploy path: /var/www/deploy
>>>>
>>>> Exception in thread "OpalDeployer" java.lang.NullPointerException
>>>>           at
>>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:178)
>>>
>>>
>>> The full deploy path is relative to /var/www, which is the home directory of
>>> user "apache" which is the account we use for running this instance of
>>> tomcat.  I guess tomcat6 does not change directory from where it was started
>>> to $CATALINA_HOME.  Our startup script uses "su - apache -c ..." to start
>>> tomcat, so it starts in ~apache or /var/www. Specifying the full path in
>>> etc/opal.properties makes everything work. I have one service deployed!
>>>
>>
>> That does not make much sense to me :-(
>> It should not use the current working directory (that was my first test).
>> What script do you use to start up tomcat?
>> You should use the $CATALINA_HOME/bin/startup.sh which sets the proper
>> working directory:
>> clem@hermes:~/projects/opaltoolkit$ apache-tomcat-6.0.37/bin/startup.sh
>> Using CATALINA_BASE:   /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
>> Using CATALINA_HOME:   /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
>> Using CATALINA_TMPDIR: /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/temp
>> Using JRE_HOME:        /usr
>> Using CLASSPATH:
>> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/bootstrap.jar
>>
>> No matter where I start it from....
>> I tried to reproduce your problem but still no luck
>> cd /tmp
>> su - clem -c /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/startup.sh
>>
>>
>> Luca
>>
>
> We're on Redhat Enterprise Linux 6.  There is no startup.sh in
> /usr/share/tomcat6/bin.  I copied the startup file from
> /etc/init.d/tomcat6.  In that script it invokes /usr/sbin/tomcat6, which
> ultimately runs java with no intervening chdir:
>
> /usr/lib/jvm/java/bin/java
> -Djavax.sql.DataSource.Factory=org.apache.commons.dbcp.BasicDataSourceFactory
> -classpath
> :/usr/local/opal-tomcat6/bin/bootstrap.jar:/usr/local/opal-tomcat6/bin/tomcat-juli.jar:/usr/share/java/commons-daemon.jar
> -Dcatalina.base=/usr/local/opal-tomcat6
> -Dcatalina.home=/usr/local/opal-tomcat6 -Djava.endorsed.dirs=
> -Djava.io.tmpdir=/usr/local/opal-tomcat6/temp
> -Djava.util.logging.config.file=/usr/local/opal-tomcat6/conf/logging.properties
> -Djava.util.logging.manager=org.apache.juli.ClassLoaderLogManager
> org.apache.catalina.startup.Bootstrap start
>
> Conrad
>
> ------------------------------------------------------------------------------
> CenturyLink Cloud: The Leader in Enterprise Cloud Services.
> Learn Why More Businesses Are Choosing CenturyLink Cloud For
> Critical Workloads, Development Environments & Everything In Between.
> Get a Quote or Start a Free Trial Today.
> http://pubads.g.doubleclick.net/gampad/clk?id=119420431&iu=/4140/ostg.clktrk
> _______________________________________________
> Opaltoolkit-users mailing list
> Opa...@li...
> https://lists.sourceforge.net/lists/listinfo/opaltoolkit-users
>

Re: [Opaltoolkit-users] Opal 2.4 and Tomcat

[Conrad H. <co...@cg...>]

On 1/9/2014 2:22 PM, Luca Clementi wrote:
> On Thu, Jan 9, 2014 at 1:45 PM, Conrad Huang <co...@cg...> wrote:
>> On 1/9/2014 11:35 AM, Luca Clementi wrote:
>>>
> [...]
>> The debug code clears it up a bit.  Here's the end of catalina.out (adding
>> debugging code but leaving deploy as "deploy"):
>>
>>> INFO: Server startup in 2609 ms
>>> 2014-01-09 13:28:08,074 INFO
>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:160)
>>> - initDeployServlet: axis URL:
>>> http://xxx.xxx.ucsf.edu:8080/opal2/servlet/AxisServlet
>>> 2014-01-09 13:28:08,075 INFO
>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:161)
>>> - initDeployServlet: deploy path: deploy
>>> 2014-01-09 13:28:08,075 INFO
>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:162)
>>> - initDeployServlet: deploy path: /var/www/deploy
>>>
>>> Exception in thread "OpalDeployer" java.lang.NullPointerException
>>>          at
>>> edu.sdsc.nbcr.opal.util.OpalDeployService$Deployer.run(OpalDeployService.java:178)
>>
>>
>> The full deploy path is relative to /var/www, which is the home directory of
>> user "apache" which is the account we use for running this instance of
>> tomcat.  I guess tomcat6 does not change directory from where it was started
>> to $CATALINA_HOME.  Our startup script uses "su - apache -c ..." to start
>> tomcat, so it starts in ~apache or /var/www. Specifying the full path in
>> etc/opal.properties makes everything work. I have one service deployed!
>>
>
> That does not make much sense to me :-(
> It should not use the current working directory (that was my first test).
> What script do you use to start up tomcat?
> You should use the $CATALINA_HOME/bin/startup.sh which sets the proper
> working directory:
> clem@hermes:~/projects/opaltoolkit$ apache-tomcat-6.0.37/bin/startup.sh
> Using CATALINA_BASE:   /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
> Using CATALINA_HOME:   /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37
> Using CATALINA_TMPDIR: /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/temp
> Using JRE_HOME:        /usr
> Using CLASSPATH:
> /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/bootstrap.jar
>
> No matter where I start it from....
> I tried to reproduce your problem but still no luck
> cd /tmp
> su - clem -c /home/clem/projects/opaltoolkit/apache-tomcat-6.0.37/bin/startup.sh
>
>
> Luca
>

We're on Redhat Enterprise Linux 6.  There is no startup.sh in 
/usr/share/tomcat6/bin.  I copied the startup file from 
/etc/init.d/tomcat6.  In that script it invokes /usr/sbin/tomcat6, which 
ultimately runs java with no intervening chdir:

/usr/lib/jvm/java/bin/java 
-Djavax.sql.DataSource.Factory=org.apache.commons.dbcp.BasicDataSourceFactory 
-classpath 
:/usr/local/opal-tomcat6/bin/bootstrap.jar:/usr/local/opal-tomcat6/bin/tomcat-juli.jar:/usr/share/java/commons-daemon.jar 
-Dcatalina.base=/usr/local/opal-tomcat6 
-Dcatalina.home=/usr/local/opal-tomcat6 -Djava.endorsed.dirs= 
-Djava.io.tmpdir=/usr/local/opal-tomcat6/temp 
-Djava.util.logging.config.file=/usr/local/opal-tomcat6/conf/logging.properties 
-Djava.util.logging.manager=org.apache.juli.ClassLoaderLogManager 
org.apache.catalina.startup.Bootstrap start

Conrad