From: Adam P. <ada...@ya...> - 2006-03-24 22:10:50
|
Hi Aaron, Multiple fasta records are allowed in both the reference and query files. You are probably experiencing some "sequence uniqueness" complications. Try adding the --maxmatch option to the nucmer invocation, and things should start working for you. See: http://mummer.sourceforge.net/manual/#mummer for a *very* brief explanation of what the different uniqueness settings mean (mum, mumereference, maxmatch). Basically, if the same exact sequence is repeated multiple times in your reference file (or query file) it will be filtered from the output by default. If you turn on the --maxmatch flag and still have problems, get back to me. Best, Adam Aaron Gussman <agu...@ti...> wrote: Can there be multiple fasta records in either the reference or query fasta file passed to nucmer? I was following the steps in section "4.4 SNP detection" of the FAQ, but no snps are detected if I include more than one fasta record in the reference or query file. However, 1:1 comparisons do produce show-snps output. Section 3 of the FAQ says that the reference and query files can contain any number of sequences, so I'm puzzled as to what's going on. I've included the test sequences I was trying below. Any help is appreciated. Thanks, Aaron >QUERY_01 01 ATGACCCAAACCGAAATGTAGATGAAAATGCTAATGCCAACAATGCTGTAAAAAATAATAATAACGAAGAGCCAAGTGATCAGCACATAGAAAAATATTTAAAGAGAATACAAAATTCTCTTTCAACTGAATGGTCCCCATGTAGTGTAACTTGTGGAAATGGTATTCAAGTTAGAATAAAGCCTGGCTCTGCTAATAAACCTAAAGACCAATTAGATTATGCAAATGATATTGAAAAAAAAATTTGTAAAATGGAAAAATGTTCCAGTGTGTTTAATGTCGTAAATA >REFERENCE_02 02 ATGACCCAAACCGAAATGTAGATGAAAATGCTAATGCCAACAATGCTGTAAAAAATAATAATAACGAAGAACCAAGTGATCAGCACATAGAAAAATATTTAAAGAGAATACAAAATTCTCTTTCAACTGAATGGTCCCCATGTAGTGTAACTTGTGGAAATGGTATTCAAGTTAGAATAAAGCCTGGCTCTGCTAATAAACCTAGAGACCAATTAGATTATGCAAATGATATTGAAAAAAAAATTTGTAAAATGGAAAAATGTTCCAGTGTGTTTAATGTCGTAAATA >REFERENCE_03 03 TATTTACGACATTAAACACACTGGAACATTTTTCCATTTTACAAATTTTTTTTTCAATATCATTTGCATAATCTAATTGGTCTTTAGGTTTATTAGCAGAGCCAGGCTTTATTCTAACTTGAATACCATTTCCACAAGTTACACTACATGGGGACCATTCAGTTGAAAGAGAATTTTTTATTTTGTTTAAATATTTTTCTATGTGCTGATCACTTGGTTCTTCGTTATTATTATTTTTTACAGCATTGTTGGCATTAGCATTTTCATCTACATTTCGGTTTGGGTCA -- Aaron Gussman - Bioinformatics Engineer I The Institute for Genomic Research agu...@ti... (301) 795-7698 ------------------------------------------------------- This SF.Net email is sponsored by xPML, a groundbreaking scripting language that extends applications into web and mobile media. Attend the live webcast and join the prime developer group breaking into this new coding territory! http://sel.as-us.falkag.net/sel?cmd=lnk&kid=110944&bid=241720&dat=121642 _______________________________________________ MUMmer-help mailing list MUM...@li... https://lists.sourceforge.net/lists/listinfo/mummer-help --------------------------------- New Yahoo! Messenger with Voice. Call regular phones from your PC and save big. |