Learn how easy it is to sync an existing GitHub or Google Code repo to a SourceForge project! See Demo

Close

#14 fq_all2std.pl sol2std bug

open
nobody
None
5
2008-11-07
2008-11-07
Nathan Weeks
No

When using "fq_all2std.pl sol2std", a newline character is being encoded
as "!" and appended to the end of the resulting Sanger-compatible FASTQ
quality scores; e.g.
Original sequence:

@SNPSTER_35_FC202G9_1_1_114_899
ATTTCCGCACTTCCAAAGGTTGCTCTTCCTTTTGCT
+SNPSTER_35_FC202G9_1_1_114_899
hhhhhhhhhhhhQhhhh`NZhfZhOhc_hhU_h_hV

Output of "fq_all2std.pl sol2std":

@SNPSTER_35_FC202G9_1_1_114_899
ATTTCCGCACTTCCAAAGGTTGCTCTTCCTTTTGCT
+
IIIIIIIIIIII2IIIIA/;IG;I0ID@II6@I@I7!

Here's a patch to fix this behavior:

*** fq_all2std.pl.orig Fri Nov 7 09:24:48 2008
--- fq_all2std.pl Mon Sep 29 15:23:41 2008
***************
*** 209,214 ****
--- 209,215 ----
if (/^@/) {
print;
$_ = <>; print; $_ = <>; $_ = <>;
+ chomp;
my @t = split('', $_);
my $qual = '';
$qual .= $conv_table[ord($_)] for (@t);

Discussion