"passthrough output error"

2012-04-14
2013-06-05
  • Hello,

    I am trying to align paired-end reads using bowtie2. Its failing with the following error:

    Could not parse passthrough output:
    HWI-ST972:1057:D0RNTACXX:3:1103:11595:190910    133     chr12   24364013        0       *       =       24364013        0       ACTCCATCCGTGTTTCTTTTCTAGACTGGGCTGGATGCATCCCAATTCCCCACTGTTTTCCAGAGGCAGATCCTCATTAGTGGGAGCACTGGATGGGGGG        B@@FFDFFDF2AAFFGHIJIIIEHJJJJJIIJJIEGH9GIE9DECHGGHIIHGGFHGHIGHIGG=CGEH?EDB?;?;A>C.(6=A@@ADDCD:>A(9?<

    This is the command I use:
    time nice -n 20 bowtie2 -x ~/data/sequencing/bowtie2-indexes/mm9 -1 AGTCAA_L003_R1_001.fastq -2 AGTCAA_L003_R2_001.fastq -S AGTCAA_L003.sam -un-conc AGTCAA_L003_001_R%_unmapped.fastq

    The last line before failure  in AGTCAA_L003.sam is
    HWI-ST972:1057:D0RNTACXX:3:1103:11595:190910 73 chr12 24364013 0 95M1I4M = 24364013 0 ATGTGGCAGTTTCCCACAAGTGTGCCTACCAGCAAGGCAATTGCAAGAACAAGGTCCTTTGACCCCACATCCAGTGCTCCCACTAATGAGGATCTGCCTC @CCDDFFFHHHHHJJJJJGJFHEHHIIJGHIGCIJJJJIIJJIJIHHIIJJJFHBFHGHIIIIEIGHHDEHHFFFCDFECDEEDCDDACDCADCDDACDD AS:i:-33 XS:i:-33 XN:i:0 XM:i:5 XO:i:1 XG:i:1 NM:i:6 MD:Z:0G1C4T86A2A1 YT:Z:UP

    I am able to run the two files to completion when I run separately. But paired end alignment fails with error above. Looks like its not able to create the SAM record properly. Can you shed some light on this?

    Thanks!