#308 Incorrect lengths in sam header. Sequences missing from output sam file.

v0.9.0
open
nobody
5
2014-04-26
2014-04-26
Magdalena
No

Hi,
I have been using bowtie 2.2.2 and have some issues with the sam output. For 2 reference sequences of length 100 I get a sam header reporting length 200. These are not the only 100-nt sequences in the reference and one of them has reads aligned to them and the other doesn't.
They are unique in both their names and sequence as far as I can tell ('grep' checked the multifasta):

TCONS_00138563_1_182293_182393
CCCAAAAACTGATATTTGCCTAAATTTAAAGCAGTTTCTCTGCACTGCTG
GTTCTGACTCCTGATACAACTCCCCAATATCCATTCATCCCTCATTCTCA
TCONS_00140189_2_51201_51301
CACATAATTATAAACCCAGTGAGAATGAGGGATGAATGGGTATTGGGGAG
TTGTATCAGGAGTCAGAACCAGCAGTGCAGGGAAGGGAAAGGGACAGACA

The relevant sam header lines:
@SQ SN:TCONS_00138563_1_182293_182393 LN:200
@SQ SN:TCONS_00140189_2_51201_51301 LN:200

The second one has a corresponding alignment:
@SQ SN:TCONS_00140189_2_51201_51301 LN:100
HWI-ST665R:160:D22BHACXX:8:1210:13247:88671 0 TCONS_00140189_2_51201_51301 10 1 68M * 0 0 ATAAACCCAGTGAGAATGAGGGATGAATGGGTATTGGGGAGTTGTATCAGGAGTCAGAACCAGCAGTG @@@=DDDDAFHDHI?CFFDEHGGGHCFHGHICC?BFGGGGBBFGBDFBH@FCBFAHGFGGH@@CHA.= AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:68 YT:Z:UU
HWI-ST665R:160:D22BHACXX:8:1316:2970:93328 0 TCONS_00140189_2_51201_51301 22 1 61M * 0 0 AGAATGAGGAATGAATGGGTATTGGGGAGTTGTATCAGGAGTCAGAACCAGCAGTGCAGGG @@?7BDDDFHH?F?EEGEHF?AFHGGH1CGEFD9?F<BGFH9??FDEHABF<FBFDGA@GA AS:i:-5="" XS:i:-5="" XN:i:0="" XM:i:1="" XO:i:0="" XG:i:0="" NM:i:1="" MD:Z:9G51="" YT:Z:UU="" HWI-ST665R:160:D22BHACXX:8:2201:15604:48863="" 0="" TCONS_00140189_2_51201_51301="" 17="" 1="" 48M="" *="" 0="" 0="" CAGTGAGAATGAGGGATGAATGGGTATTGGGGAGTTGTATCAGGAGTC="" ?@<a="" href="mailto:ABDD;?&lt;FCDFG@FBBABF">ABDD;?<FCDFG@FBBABF>CEGECGAEFA??BB<BDGEBFG) AS:i:0 XS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:48 YT:Z:UU

I would appreciate any input/comments.
Best,
Magdalena

Discussion